Tag: hisat2
Finding DEGs from HISAT2/STRINGTIE output
Finding DEGs from HISAT2/STRINGTIE output 0 Hello, I have to search for DEGs from four samples of crop. I am following reference based mapping of reads to genome using HISAT2. I have completed till the generation of merged .gtf files for the samples using STRINGTIE. Since I am new to…
The low successful assignment ratio of FeatureCounts
Hello, I would like to confirm if the low assignment ratio (54%) is normal, and please check the possible reason I found. I used Hisat2 to assign paired-end strand-specific transcriptomic sequences (rRNA removed) to a reference genome. Because I filtered out the unmapped sequences in advance, the overall assignment ratio…
A comparison of transcriptome analysis methods with reference genome
Background: The application of RNA-seq technology has become more extensive and the number of analysis procedures available has increased over the past years. Selecting an appropriate workflow has become an important issue for researchers in the field. Methods: In our study, six popular analytical procedures/pipeline were compared using four RNA-seq…
HT-Seq, Gene ID appeared in Gene Name row
HT-Seq, Gene ID appeared in Gene Name row 0 Hi, I am doing alignment with HISAT2 and couting with HT-seq. I got the counting matrix but i found there are gene ID appear in the gene name row. Is it normal that gene ID can appear like this or are…
Htseq is giving me 0 counts using the GFF3 of miRBase
Hello! I am trying to annotate a miRNA-seq so that it gives me mature miRNAs where I already have 5p and 3p. For this, I have used the index mm10.fa and the miRBase mmu.gff3. I have aligned with HISAT2 and am trying to count with HTSeq, however I get 0…
nf-core/circrna
circRNA quantification, differential expression analysis and miRNA target prediction of RNA-Seq data Introduction nf-core/circrna is a best-practice analysis pipeline for the quantification, miRNA target prediction and differential expression analysis of circular RNAs in paired-end RNA sequencing data. The pipeline is built using Nextflow, a workflow tool to run tasks across…
Introduction to RNA-seq data analysis – Extended Materials
Introduction to RNA-seq data analysis – Extended Materials | cruk-summer-school-2021 Github repo for 2021 CRUK-CC Bioinformatics Summer School (tinyurl.com/crukss2021) Taught remotely Bioinformatics Training, Craik-Marshall Building, Downing Site, University of Cambridge Supplementary materials These files contain some additional information and exercises not included during the taught course. Obtaining public data Raw…
Time-course RNASeq of Camponotus floridanus forager and nurse ant brains indicate links between plasticity in the biological clock and behavioral division of labor | BMC Genomics
1. Sharma VK. Adaptive significance of circadian clocks. Chronobiol Int. 2003;20(6):901–19. PubMed Google Scholar 2. Paranjpe DA, Sharma VK. Evolution of temporal order in living organisms. J Circadian Rhythms. 2005;3(1):7. PubMed PubMed Central Google Scholar 3. Yerushalmi S, Green RM. Evidence for the adaptive significance of circadian rhythms. Ecol Lett….
The role of ATXR6 expression in modulating genome stability and transposable element repression in Arabidopsis
Significance The plant-specific H3K27me1 methyltransferases ATXR5 and ATXR6 play integral roles connecting epigenetic silencing with genomic stability. However, how H3K27me1 relates to these processes is poorly understood. In this study, we performed a comprehensive transcriptome analysis of tissue- and ploidy-specific expression in a hypomorphic atxr5/6 mutant and revealed that the…
How to label columns in HTSeq output
How to label columns in HTSeq output 0 I’ve been working to process RNAseq data and I’ve used hisat2 to align my reads to the reference genome. When I take those output files and put them into HTSeq-count using the below code, I get a count matrix but the columns…
tranfering sam file easy and fast way
tranfering sam file easy and fast way 0 Hi everyone I was tried to align my fastq files by hisat2 but ı couldnot able done because my computer has 4gb ram and ı get error killed. So ı was perfomed process on my friend computer but now I should solve…
htseq-count -t gene not working
I found a little problem. When I set the “-t gene”, the reads is mark “__no_feature”. But when I set the “-t exon”, the reads is mark “ENSG00000276104”. The gene “ENSG00000276104” is a single exon gene. I don’t know why this happens. reads: “TGTCTGTGGCGGTGGGATCCCGCGGCCGTGTTTTCCTGGTGGCCCGGCCGTGCCTGAGGTTTCTCCCCGAGCCGCCGCCTCTGCGGGCTCCCGGGTGCCCTTGCCCTCGCGGTCCCCGGCCCTCGCCCGTCTGTGCCCTCTTCCCCGCCCGCCGATCCTCTTCTTCCCCCCGAGCGGCTCACCGGCTTCACGTCCGTTGGTGGCCCCGCCTGGGAC”. I had aligned to hg38 by…
Index of /~psgendb/doc/bioLegato/blreads
Name Last modified Size Description Parent Directory – SOAPdenovo2.hints.html 2019-05-04 15:52 3.9K Trimmomatic.hints.html 2019-05-20 13:32 6.3K Trinity.hints.html 2019-04-23 11:39 2.4K adaptercheck.hints.html 2021-05-13 12:27 8.0K adaptercheck.html 2021-05-12 17:45 4.9K adaptercheck_output.png 2021-05-12 17:17 51K fastq_pair.hints.html 2019-04-05 13:16 3.4K gffcompare.hints.html 2018-07-18 14:05 3.2K …
hisat2-align died with signal 6 (ABRT) (core dumped)
(ERR): hisat2-align died with signal 6 (ABRT) (core dumped) 0 Hi, run hisat2 ,I encountered an error. hisat2-build -p 10 ~/public_data/genome/Pt_V1.0.fa genome 1>hisat2-build.log 2>&1 ~/software/hisat2-2.2.0/hisat2 -x genome -1 ~/data/clean/NC1_5_clean_R1.fastq.gz -2 ~/data/clean/NC1_5_clean_R2.fastq.gz -S NC1_5.sam 1>NC1_5.log 2>&1 cat NC1_5.log terminate called after throwing an instance of ‘std::bad_alloc’ what(): std::bad_alloc (ERR): hisat2-align died…
HISAT2 question, index generation.
HISAT2 question, index generation. 0 Hello everyone, I have a question. Perform a basic line of work for RNA-seq analysis. A question arose when I generated the famous index in Hisat2 using the .FASTA extension reference genome. What is it means the information that Hisat2 throws at the end. E.g…
DESeq2 (or EdgeR) Exploratory Analysis with no Replicates
DESeq2 (or EdgeR) Exploratory Analysis with no Replicates 1 My pipeline so far is hisat2->featureCounts->DESeq2. I have generated heatmaps after rlog and log2 transformation of the genes with the most variance, which is somewhat meaningful. What I really want to do is compare everything to the control sample and take…
SeqMonk rRNA from QCplot 100%
SeqMonk rRNA from QCplot 100% 1 Dear all, I have single-end RNAseq data that I mapped with Hisat2 and am looking at in SeqMonk. I plotted the QC plot (default) + Measure rRNA. I got 100 % rRNA. Which I think is impossible right? Or did I do something horribly…
values (NA) in p value Deseq2 (reopen)
Hello how are you? I reopen this question because the following has happened: I am doing a differential expression exercise using the hisat2, stringie & DESeq2 workflow. Finally I use the python prepDE.py script recommended in the StringTie manual to extract the counts. So far so good, I have rows…
Alignment of de novo assembled transcripts to reference transcriptome?
Alignment of de novo assembled transcripts to reference transcriptome? 0 Hi all, I started with 40 samples of raw (but trimmed) RNASeq samples. I used these as inputs for SPAdes-rna and Trinity, to assemble them without a reference. I now have 80 assembled transcriptomes (?), and I tried to follow…
UCL-BLIC/rnaseq – Giters
Introduction UCL-BLIC/rnaseq is a bioinformatics analysis pipeline used for RNA sequencing data, modified to add kallisto. The workflow processes raw data from FastQ inputs (FastQC, Trim Galore!), aligns the reads (STAR or HiSAT2), generates gene counts (featureCounts, StringTie) as well as kallisto abundance files, and performs extensive quality-control on the…
High-Throughput RNA Sequencing Reveals the Effect of NB-UVB
Introduction Psoriasis vulgaris, major chronic immune-mediated skin disease, affects 1–3% of the adult population worldwide.1 Psoriasis is one of the major complex skin diseases that is significantly linked to genetic predisposition, major histocompatibility alleles, and environmental factors.2 Over the past few years, the cellular and molecular contributions to psoriasis were…
Genome sequencing of the multicellular alga Astrephomene provides insights into convergent evolution of germ-soma differentiation
1. Smith, J. M. & Száthmary, E. The Major Transitions in Evolution (Freeman, 1995). Google Scholar 2. Queller, D. C. Relatedness and the fraternal major transitions. Philos. Trans. R. Soc. Lond. B Biol. Sci. 355, 1647–1655 (2000). CAS PubMed PubMed Central Google Scholar 3. Grosberg, R. K. & Strathmann, R….
Can someone help me understand the RSeQC Output from infer_experiment.py?
Can someone help me understand the RSeQC Output from infer_experiment.py? I have RNAseq data from library constructed by TruSeq Stranded Total RNA (NEB Microbe), from pure bacterial culture so following some suggestions found here about this topic I run the mapping against the reference genome using a subsample by HISAT2…
DEG analysis without biological Replication
DEG analysis without biological Replication 0 Is it possible to analysis the differential expression genes/transcripts form RNA-seq without any replications!!!. Actually I am handling the year old plant transcriptome data of different tissue of male and female plant to find DEGs betwen the tissue of male and female plant using…
HISAT2 no properly paired alignments
HISAT2 no properly paired alignments 1 Hi All! I’m a wetlab guy quite new to data analysis and would appreciate some help if possible! Slowly i’m getting into commandline and understanding some of the workflow behind analysis but i’ve hit a bit of a wall. Following hisat2-build on the human…
Help for extraction of fasta sequences
Hello everyone, I hope you are well. I am writing this post because I have a question or rather I have a problem with my workflow. Perform a workflow for RNA-seq processing as follows: quality control – Hisat2 – Stringtie – Deseq2 A simple, normal workflow that threw me important…
featureCounts low annotation rate RNA-seq
Hey everybody! I am trying to annotate my RNA-seq files (paired-end) with featureCounts. However, I keep having a quite low annotation rate, ~35-36% for all the files. My command line is the following: featureCounts -T 6 -p -s 2 -a annotation_file.gtf -o output_file.txt input_files.bam I am using the parameter -s…
RNA-seq normalization methods between samples
RNA-seq normalization methods between samples 0 I’m a beginner in RNA-seq. I’m trying to learn RNA-seq analysis with a practical and simple analysis with public RNA-seq data. I downloaded 9 RNA-seq files (same sample prepared on 9 different days) I’ve done mapping them with Hisat2. so far it seems pretty…
Running Hisat2 but it seems not working at all
Running Hisat2 but it seems not working at all 0 I’m running Hisat2 with the code below: hisat2 -p 9 -f ../0.Reference/CHO-PICRH -1 ../2.Trimmomatic/ERR2593198_1_trimmed.fastq.gz -2 ../2.Trimmomatic/ERR2593198_2_trimmed.fastq.gz 2> ../3.HISAT/ERR25593198.log| samtools view -Sbo ../3.HISAT/ERR2593198.bam It’s been running over 24 hours but it doesn’t seem work well. Can you please check the code…
Error in Galaxy using Deseq2 “Error in data.frame(…, check.names = FALSE) :”
Hello everyone How are things going? Currently, I am processing ARN-seq data using Galaxy. I would like to observe the differential expression between controls and cases. For that, I follow the following steps: I did a quality check of my library first (obviously) Second, I used HISAT2 for reference genome…
hisat2 SyntaxError: invalid syntax
hisat2 SyntaxError: invalid syntax 0 Hi all, I am really struggling with hisat2 recently and getting confused. I’m trying to run hisat2: hisat2 -t -p 2 -x shiryn RNAseq data/reference/grch38_genome/grch38 -1 shiryn RNAseq data/trimmed data/ly1_paired_1.trim.fq.gz shiryn RNAseq data/trimmed data/ly1_paired_2.trim.fq.gz -S shiryn RNAseq data/alighed/ly1.sam This is my error: File “/home/yun/Downloads/hisat2-2.2.0/hisat2_read_statistics.py”, line…
hisat SyntaxError: invalid syntax
hisat SyntaxError: invalid syntax 2 Hi all, I am really struggling with hisat2 recently and getting confused. I’m trying to run hisat2 python2 /home/yun/Downloads/hisat2-2.2.0/hisat2 -t -p 2 -x shiryn RNAseq data/reference/grch38_genome/grch38 -1 shiryn RNAseq data/trimmed data/ly1_paired_1.trim.fq.gz shiryn RNAseq data/trimmed data/ly1_paired_2.trim.fq.gz -S shiryn RNAseq data/alighed/ly1.sam Heie is my error: File “/home/yun/Downloads/hisat2-2.2.0/hisat2”,…
RNA seq trimming
RNA seq trimming 1 I am writing to know if 2-4 percent n content near the both ends of a sequence (RNA seq, read length:150) would be a problem and need trimming? RNA-Seq • 1.4k views It depends on the aligner that you use. If you’re using something like hisat2…
Paired-end reads somehow counted twice?
Paired-end reads somehow counted twice? 0 Hi. I’m new in Bioinformatics and try to extract read counts from fastq files. I compared my result with answer count matrix, and read counts are doubled. (Left one is from the answer read count matrix, and right one is my result.) I used…
Numerical result out of range
samtools: Numerical result out of range 1 I am working with a SAM file (created with hisat2) with header: @SQ SN:chr1A LN:594006513 @SQ SN:chr1B LN:693261537 … When doing sorting and indexing, I get this error with samtools: [E::hts_idx_check_range] Region 536907741..536907892 cannot be stored in a bai index. Try using a…
bowtie2 and then HISAT2? What does it mean in Data processing details on a paper?
bowtie2 and then HISAT2? What does it mean in Data processing details on a paper? 1 IMHO that must be a mistake: the data seems to be RNA so I would’ve directly gone for TopHat2 (or HISAT2). (Unless they wanted to run Fastqc in BAM, not fastq mode – in…
Does hisat2 –rg flag eat the “/” character in multiline definitions?
Does hisat2 –rg flag eat the “/” character in multiline definitions? 0 Hello, I am trying to use hisat2, but I noticed something weird. When running it like so: hisat2 -p 8 –rg-id=UHR_Rep2 –rg SM:UHR –rg LB:UHR_Rep2_ERCC-Mix1 –rg PL:ILLUMINA –rg PU:CXX1234-TGACAC.1 -x $RNA_REF_INDEX –dta –rna-strandness RF -1 “$RNA_DATA_DIR/${SAMPLE}_1.fastq.gz” -2 “$RNA_DATA_DIR/${SAMPLE}_2.fastq.gz”…
What is the difference between HISAT2 index “genome.tran” and “genome”
What is the difference between HISAT2 index “genome.tran” and “genome” 1 I try to use HISAT2 in order to map the reads to the genome, while HISAT2 pre-index the genome for users. I saw that alternative sequences will affect the mapping results, does genome.tran index includes the alternative splicing and…
High counts of rRNA in RNA-Seq
Hi there, I have recently performed RNA-Seq on the total RNA of a mosquito tissue, where I have three biological replicates of the tissue at three different time points. The pipeline I used was HISAT2 –> featureCounts –> DESeq2. Looking at the normalized counts (output of DESeq2), the counts of…
extract gene sequence from multiple bam files in order to do Ka/Ks test
extract gene sequence from multiple bam files in order to do Ka/Ks test 0 Hello, I have a dataset of RNA bulk rna-seq (single-end), mapped with hisat2 and now I want to extract the sequences of some genes of my interest in order to run a Ka/Ks test for them…
Why my reads mapping rate extremely low
I am using a script to analyze a large amount of ribo-seq data, which comes from different studies. Because from different research, I use trim_galore to remove the adaptor. Use bowtie2 to remove rRNA and use STAR mapping. After mapping, I found that the mapping rate of some of the…
TPMCalculator returns zero for some genes, which are non-zero with Cuffdiff (FPKM).
TPMCalculator returns zero for some genes, which are non-zero with Cuffdiff (FPKM). 0 I ran TPMCalculator on my RNA-seq data. This was my first time using this package. It seemed to have done without any problems, but I realized that counts of some genes are zero. I performed DEG analysis…
What to do with genes that appear as NA but have statistics
What to do with genes that appear as NA but have statistics 0 Hi I’m doing an RNA-seq analysis and I’m having problems identifying some of the genes in the output of the DESeq2 tool because the list of genes obtained are in Entrez id, for context the pipeline used…
deepvariant is very slow on alignements produced by hisat2 and reports only half of expected SNPs/INDELs
Hi @lpryszcz With respect to your aligner question, we have evaluated DeepVariant with BWA-MEM/BWA-MEM2, minimap2, DRAGEN, and the graph mapper Giraffe. For mapping to a linear reference, we would recommend BWA-MEM/BWA-MEM2 or DRAGEN. DeepVariant is trained on BWA MEM data. Minimap2 will work, but has slightly lower accuracy. We have…
iCOMIC: a graphical interface-driven bioinformatics pipeline for analyzing cancer omics data
Abstract Despite the tremendous increase in omics data generated by modern sequencing technologies, their analysis can be tricky and often requires substantial expertise in bioinformatics. To address this concern, we have developed a user-friendly pipeline to analyze (cancer) genomic data that takes in raw sequencing data (FASTQ format) as input…
Genome indexing with hisat2 and samtools
Genome indexing with hisat2 and samtools 0 Hello, I found this code in Biostar handbook (RNA-Seq by Example) in section about genome indexing. # The reference genome. IDX=refs/genome.fa # Build the genome index. hisat2-build $IDX $IDX # Index the reference genome with samtools. samtools faidx $IDX I was wondering about…
Differences in HISAT2 indexes for download
Differences in HISAT2 indexes for download 0 Hi all, hope you guys are doing fine in the pandemic. So I have just recently beginning to move into computational biology stuff (and found it amazing) and one of the first things Im trying to do is to map fastq files against…
How to install hisat2 on Mac OS Big Sur
How to install hisat2 on Mac OS Big Sur 0 I’d like to install HISAT2 on Mac OS Big Sur ver.11.5.2. I have tried to install HISAT2 by using bioconda (Hisate2 :: Anaconda), and the installation seemed to be successful, but when I tried to start hisat2, I’m getting the…
hisat2-align exited with value 1″ in mapping long noncoding RNAs
what does mean this error ? “(ERR): hisat2-align exited with value 1” in mapping long noncoding RNAs 0 Hello everyone.what does mean this error ? “(ERR): hisat2-align exited with value 1” in mapping long noncoding RNAs. mapping long RNAs non-coding • 30 views • link updated 2 hours ago by…
Does Hisat2 automatically align strandedness
Does Hisat2 automatically align strandedness 0 I’ve been using Hisat2 to align some RNA. RNA was prepped using NEB Directional library kit. When I originally aligned, I did not use the –rna-strandedness option. I then realised I do want stranded, as part of my reference (which is human genome plus…
HTseq doesn’t support Multi-Threading ?
HTseq doesn’t support Multi-Threading ? 1 Hello, everyone ! I’m looking for a way to use HTseq with multi-thread. I couldn’t find any options about multi-thread. Anybody knows how to, please ? (I know there are tools support multi-thread like STAR, HISAT2. but just wonder whether HTseq doesn’t support it.)…
Fastqc user manual – vodosp.ru
FASTQ format – Wikipedia 06 September 2021 – by TC Collin · 2020 · Cited by 3 — Be accompanied by a step-by-step user-friendly manual, If the user performs FastQC prior to the removal of adapters (step 3), the length Both programs can be used on Linux/MacOS X machines and quite…
Methylkit (differential methylation analysis) error in data frame
Methylkit (differential methylation analysis) error in data frame 0 Hi Friends, I am performing the differential methylation analysis using methylkit but it is throwing error in data frame. ” Error in [.data.frame(data, , 6) : undefined columns selected”. Can anyone help me to solve this error. Following is my R…
Hisat2 error
Hisat2 error 1 Hi all I am using this command. hisat2 -p 8 -q -X ${READDIR}/hisat2_index_Cm_genome -1 ${READDIR}/tr.p.UE-2955-CMLib1_S88_L004_R1_001.fastq.gz -2 ${READDIR}/tr.p.UE-2955-CMLib1_S88_L004_R2_001.fastq.gz -S ${Output}/UE-2955-CMLib1.sam Error: Encountered internal HISAT2 exception (#1) Need a help to fix this problem. thanks Hisat2 • 24 views It is a lowercase x, so -x for the index….
hisat2 alignment showing 0% aligned but sam file is 6GB in size.
hisat2 alignment showing 0% aligned but sam file is 6GB in size. 0 Hello, I am trying to align my fastq files with the reference genome assembly (MRSA ATCC 33591). The sam file formed is some 5-6 GB in size whereas hisat2 output is showing 0.0% alignment rate. I am…
How to select uniquely and concordantly reads from hisat2 alingment for raw read count
Ok, let’s go through it. The -f 0x2 bitwise flag selection keeps proper pairs, which are read pairs mapped in correct orientation (I suppose illumina reads facing each other) and within insert size (-X and -I) -> concordantly. Now, if you want the uniquely mapped, you should basically exclude all…
How to align fastq files against a reference assembly
How to align fastq files against a reference assembly 0 Hello, I am trying to align fastq files against the bacterial MRSA ATCC 33591 reference genome. The problem I am facing is that I have the reference assembly in fasta format with multiple sequences and upon creating index with hisat2-build…
samtools server vs cluster error
Using inspiration from this thread HISAT2 output direct to bam, I’m attempting to run this command. The shell variables in this case represent paths to files/locations that make sense and in fact this command runs fine on my Ubuntu 18.04 LTS server using hisat 2.1 and samtools 1.10 (this seems…
Unable to locate package hisat2″
how to solve this error when I want to install HISAT2? “E: Unable to locate package hisat2” 1 Dear all, I need to install HISAT2 aligner in my study. My Linux version is 16.04 (Xenial Xerus). So I used the below command : sudo apt-get install -y hisat2 but I…
Pybedtools error sans
Pybedtools error sans 20-08-2021 pysam – Error when I install samtools for python on windows – i trying install pysam, pybedtools modules on python got error: ($i=1; $i[email protected] temp]$ conda install pysam bedtools hisat2 [ snip. However,…
Running featureCounts separately for each sample and merging results
Running featureCounts separately for each sample and merging results 3 I am running a differential expression analysis project using HISAT2 for alignment and featureCounts for assembly. I have 27 samples with paired-end reads, and the FASTQ files alone take up about 270 GB. After running alignment for a few samples,…
Question regarding providing file path to indexed genome folder
HISAT2: Question regarding providing file path to indexed genome folder 0 hisat2 -p 1 -x hisatIndex/genome.fa –dta –rna-strandness RF -1 $R1 -2 $R2 -S genome.sam(ERR): “hisatIndex/genome.fa” does not exist Exiting now … this error showing up every time i run the code and I dont know what is the problem…
align using file.ht2
align using file.ht2 1 now i downloaded in my terminal indexed file of UCSC hg19 and when i uncompress it , i found two files genome.5.ht2 genome.8.ht2 and every time i want to align my samples at indexed file this error show up [e::bwa_idx_load_from_disk] fail to locate the index files…
hisat2 compatibility for long read
hisat2 compatibility for long read 0 Hi, I am trying to align PacBio transcriptome reads against the genome to count the gene number. For pair end read i used the following workflow: # convert gff to gtf /home/software/cufflinks-2.2.1/gffread xxx.gff -T -o xxx.gtf # build index /home/software/hisat2-2.2.1/hisat2_extract_exons.py xxx.gtf > xxx.exon /home/software/hisat2-2.2.1/hisat2_extract_splice_sites.py…