Tag: hisat2

hisat2-align exited with value 1 1 I am a beginner with command and bioinformatics I am trying to alignment with HISAT2 for RNA seq so first I install the HISTA2 by bioconda using this command: bioconda -c install hisat2 after that i made index for my reference genome with this…

Tool:ChatGPT optimized for bioinformatics questions 1 Hey everyone! I launched a new chatbot today that is bioinformatics focused! It’s trained on bioinformatics content and should help debug / ideate much faster for you than vanilla ChatGPT. Check it out here: ai.tinybio.cloud/chat Thanks! gpt • 165 views • link updated 1…

Yang, Q. L., Gao, T. X. & Miao, Z. Q. Differentiation between populations of Japanese grenadier anchovy (Coilia nasus) in Northwestern Pacific based on ISSR markers: Implications for biogeography. Biochem Syst and Ecol 39, 286–296 (2011). CAS  Google Scholar  Shen, H. S. et al. In-depth transcriptome analysis of Coilia ectenes,…

hisat2 Error 137 0 hi every body, I am running hisat2 with below command: hisat2 –dta -x /home/genetics/apps/Proj/Index/hg38/genom -1 SRR11573854_1P -2 SRR11573854_2P -S SRR11573854.sam -p 4 and I face this error: Killed (ERR): hisat2-align exited with value 137 could you help me to solve this problem? Thank you very much…

The Seibold Laboratory is a cutting-edge, NIH funded, laboratory focused on elucidating the pathobiological basis of asthma and other complex lung and allergic diseases. Our goal is to discover pathobiological subgroups of disease (termed disease endotypes) and the genetic, environmental, and immune factors driving their development. We are accomplishing these…

Hi all, I am working with the RNA-Seq data on human (24Cases-20 controls) to find differentially expressed genes. my RNA-Seq data is unstranded. Here is the comments that I used to align the fastq files: ls *_1P.fastq.gz | parallel –bar -j8 ‘R2=$(echo {} | sed s/_1/_2/) && out=$(echo {} |…

Mutant collection development We mutagenized 2,700 seeds of the wheat–Th. elongatum introgression line RWG34 containing Sr43 (ref. 29). Dry seeds were incubated for 16 h with 200 ml of a 0.8% (w/v) EMS solution with constant shaking on a Roller Mixer (Model SRT1, Stuart Scientific) to ensure maximum homogenous exposure of the…

At Lilly, we unite caring with discovery to make life better for people around the world. We are a global healthcare leader headquartered in Indianapolis, Indiana. Our 35,000 employees around the world work to discover and bring life-changing medicines to those who need them, improve the understanding and management of…

Name Last modified Size Description Parent Directory   –   e2t.ctab 2023-04-28 14:22 2.7M   e_data.ctab 2023-04-28 14:22 14M   heart-hisat2_stats.txt 2023-04-28 13:58 647   heart.cov_refs.gtf 2023-04-28 14:22 5.4M   heart.gtf 2023-04-28 14:22 38M   heart.sorted.bam 2023-04-28 14:07 12G   heart.sorted.bam.bai 2023-04-28 14:11 2.0M   heart_checksums.md5 2023-04-28 14:23 484  …

Topic participation The examine protocol was accredited by the ethics committees of Osaka College and associated medical establishments in addition to the Translational Well being Science and Know-how Institute (Faridabad). Japanese people (n = 343) for whom intestine metagenome shotgun sequencing had been carried out in earlier research had been included on…

Subject participation The study protocol was approved by the ethics committees of Osaka University and related medical institutions as well as the Translational Health Science and Technology Institute (Faridabad). Japanese individuals (n = 343) for whom gut metagenome shotgun sequencing were performed in previous studies were included in this study46,47,48. Among these…

What is the best aligner for stranded RNASeq 2 If you only need to quantify expression at the transcript/gene level, use Salmon or Kallisto. If you need to align reads to the transcriptome or genome go with STAR. Not sure about the best aligner, but there are some aligners that…

No differentially expressed genes after multiple testing correction in mice 0 Hi all, I am working with the RNA-seq data on mice (group A N=3 vs group B N=3). Mice are littermates, of which group A overexpresses a human transgene which I verified. I have had .cram files from mouse…

Cell strains E. coli DH5α and B. subtilis 168 strains were grown overnight in Luria-Bertani broth at 37 °C and 180 rpm to a final OD600 ~1.7. B. subtilis strain 168 was kindly provided by Dr. S.A. Dubiley (Institute of Gene Biology, Russian Academy of Sciences, Moscow, Russia). T. adornatum strain…

Posting Details Position Information Fiscal Year2022-2023 Position TitleBioinformatics Analyst, UB Genomics & Bioinformatics Core Classification TitleProgrammer/Analyst (Project) DepartmentUB Genomics and Bioinformatics Posting NumberR230011 Posting Link www.ubjobs.buffalo.edu/postings/39824 EmployerResearch Foundation Position TypeRF Professional TypeFull-Time Appointment Term Salary GradeE.79 Posting Detail Information Position Summary The University at Buffalo, Department of UB Genomics and…

Materials The materials used for cell cultures and characterization are listed in Additional file 1: Table S1. Cell sources After getting informed consent, PB was drawn from three healthy O, Rh D-positive donors. CB was collected from three healthy newborn babies at the Department of Obstetrics and Gynecology at Severance…

Multi-mapping read adjacency in alignment tool outputs 0 Hello friends, I often work with SAM/BAM formatted short read alignments in a context where it is beneficial to know all alignments for each read rather than best/primary/secondary. My question: Among short read alignment tools and their configurations, is there ever a…

HISAT2 relaxing parameters? 1 Hi, It’s my first time using HISAT2 and the options have gotten me all confused. How can I run HISAT2 such that I increase the number of mapped reads by relaxing the parameters? Essentially, how can I increase the number of mismatches, etc allowed (which options…

Mosquitoes The Armigeres subalbatus GZ strain (Guangzhou Guangdong Province, China) was established in the laboratory in 2018 and reared in 30-cm3 nylon cages in the insectary at 28 ± 1 °C with 70–80% humidity and a 12:12 h (light: dark) light cycles. Larvae were fed with finely-ground fish food mixed 1:1 with yeast powder,…

Cell culture and reagents Non-cancerous mammary epithelium cell (MCF10A), breast cancer cells including luminal (MCF7, MDA-MB-361, T47D, and BT474), HER2amp (SKBR3), and triple-negative (MDA-MB-231, CAL51, BT20, and MDA-MB-468) subtypes, as well as human embryonic kidney 293T (HEK-293T) cells, were purchased from the American Type Culture Collection (Manassas, VA, USA). MDA-MB-231,…

FAO. Faostat: FAO Statistical Databases. (Food & Agriculture Organization of the United Nations (FAO), 2000). The war in Ukraine is exposing gaps in the world’s food-systems research. Nature 604, 217–218 (2022). Chapman, M. A., He, Y. & Zhou, M. Beyond a reference genome: pangenomes and population genomics of underutilized and…

single exon quantification using RNA-seq 0 Hi, I have done the RNA-seq (mRNA) on gene knockout mice. I have evaluated the gene knockout from protein level. However, after RNA-seq data analysis, I didn’t see down-regulation of this gene. I used the pipeline Hisat2-HTseq to do the RNA-seq analysis. Technicholy, this…

Tool Tool Name Description Removes adapter sequences and trims low quality bases from the 3′ end of reads. Overlapping paired-ended reads can be merged into consensus sequences and adapter sequence can be found for paired-ended data if not known. Automatic Filtering, Trimming, Error Removing and Quality Control for fastq data….

Finding the expression levels of non-canonical RNA splicing 1 Hello everyone! I would really appreciate advice on a research problem I’ve been getting stuck on for the past few weeks. I am working with tomato SL4 genomes. I have bam files with RNA-seq data for multiple tomatoes, and fasta files…

Handa IT, Aerts R, Berendse F, Berg MP, Bruder A, Butenschoen O, et al. Consequences of biodiversity loss for litter decomposition across biomes. Nature. 2014;509:218–21. Article  CAS  PubMed  Google Scholar  Roux S, Adriaenssens EM, Dutilh BE, Koonin EV, Kropinski AM, Krupovic M, et al. Minimum information about an uncultivated virus…

Giovannoni, J. J. Genetic regulation of fruit development and ripening. Plant Cell 16, S170–S180 (2004). CAS  PubMed  PubMed Central  Google Scholar  Tieman, D. et al. A chemical genetic roadmap to improved tomato flavor. Science 355, 391–394 (2017). CAS  PubMed  Google Scholar  Peralta, I. E., Spooner, D. M. & Knapp, S….

B16 melanin(+) tdTomato cell line generation The generation and characterization of a lentivirus encoding tdTomato has been described previously22. The B16-D5-HER2 stable cell line was a generous gift from Louis Weiner (Georgetown University)13,23. Cell lines were cultured in DMEM Dulbecco’s modified Eagle’s medium (DMEM; Sigma) supplemented with 10% (v/v) fetal…

Bradley, B. A. et al. Cheatgrass (Bromus tectorum) distribution in the intermountain western United States and its relationship to fire frequency, seasonality, and ignitions. Biol. Invasions 20, 1493–1506 (2018). Article  Google Scholar  Balch, J. K., Bradley, B. A., D’Antonio, C. M. & Gomez-Dans, J. Introduced annual grass increases regional fire…

Ross, J., Jiang, H., Kanost, M. R. & Wang, Y. Serine proteases and their homologs in the Drosophila melanogaster genome: An initial analysis of sequence conservation and phylogenetic relationships. Gene 304, 117–131 (2003). Article  CAS  PubMed  Google Scholar  Rawlings, N. D. & Barrett, A. J. Evolutionary families of peptidases. Biochem….

Hi, I am performing RNA-seq analysis on 12 samples. After mapping the reads with Hisat2, I want to count the number of reads using feaureCounts, but I reencountered a problem in reading the gff file downloaded from TAIR. (I also tried downloading it from Ensmbl, but no difference). featureCounts -p…

Using multimaping reads or unique reads on featurecounts? 0 I’m working with Rat transcriptome (mRNA) using HISAT as aligner and featurecounts (subread) to count reads using BAM files from HISAT. Featurecounts has the possibility to count only unique reads or multi-mapping reads. What is the best practice, taking into account…

Discordinant aligment 0 hi my result of hisat2 alignment is : 23250959 reads; of these: 23250959 (100.00%) were paired; of these: 2462449 (10.59%) aligned concordantly 0 times 19974163 (85.91%) aligned concordantly exactly 1 time 814347 (3.50%) aligned concordantly >1 times —- 2462449 pairs aligned concordantly 0 times; of these: 1511718…

Add HI:i:<n> tag to a BAM file 0 Hi all, I’ve been using STAR in conjunction with RSEM to get the most accurate quantification of RNA-seq for a while now. However, in one of the recent projects, I needed to map reads to a repetitive reference, generating an alignment with…

Hi guys, I have RNA-seq data (paired-end reads) from several organ samples from 2 species: Jaculus jaculus and Jaculus hirtipes; I mapped all samples (w/ hisat2) to Jaculus jaculus genome: For J. jaculus I got mapping scores of around >96% and for J. hirtipes around 80%. Then I had interest…

FastQ file not recognized by hisat2 allignment 1 I have created a nextflow pipeline to complete hisat2 alignment on a set of fastq.gz files found in the flist_parsed.txt file. When I attempt to have these fastq files run in the pipeline, i receive an error: I assume the pipeline is…

At Lilly, we unite caring with discovery to make life better for people around the world. We are a global healthcare leader headquartered in Indianapolis, Indiana. Our 35,000 employees around the world work to discover and bring life-changing medicines to those who need them, improve the understanding and management of…

Introduction Colorectal cancer (CRC) is a leading cause of cancer-related death1 and its mortality rate is expected to rise worldwide, due to population growth and aging, thus entailing a global public health challenge. CRC mortality is mainly due to therapy resistance and metastasis, which are driven by a small population…

Hello, I am having some trouble interpreting the output of featureCounts. I am interested in completing differential gene expression analysis. This is my input code: results=/blue/RNAseq2022/results DATA=/blue/RNAseq2022/results/HISAT2_Alignment_Index1 GTF=/blue/RNAseq2022/results/GTF OUTPUT=/blue/RNAseq2022/results/FeatureCounts cd ${results} ml subread prefix=$(basename ${1} “.bam”) featureCounts -p -s 0 -a ${GTF}/Bos_taurus.ARS-UCD1.2.109.gtf.gz -o ${OUTPUT}/${prefix}Counts.txt ${DATA}/${prefix}.bam All samples were run in…

HISAT2 0 How long does it take for HISAT2 aligner to complete the aligning process ? im using 24 threads and 251RAM. the size of forward and reverse read files is 990MB and 1,4GB respectively. its been more than two hours, and its mentioned in the paper (www.nature.com/articles/nprot.2016.095) that it…

HISAT2 paired end multiple files loop error 0 Hi, I got stuck with running hisat2 with a loop. my input files are here, here is my loop code, for f in `ls -1 *_1_fp.fastq.gz | sed ‘s/_1_fp.fastq.gz//’ ` do hisat2 -rna-strandness RF -x GRCm39 -1 ${f}_1_fp.fastq.gz -2 ${f}_2_rp.fastq.gz 2> ${f}.log|…

Good evening, I’d like to compare the alignment quality of hisat2, bowtie2 and bwa for my files. The first 2 packages output the percentage of reads aligned concordantly exactly 1 time, bwa does not, because does not output alignment summary. The samtools flagstat report is not enough, because it outputs…

Ethics statement and animals All animals and experimental protocols used in this study were approved by the Beijing Institute of Animal Science, Chinese Academy of Agricultural Sciences (the scientific research department responsible for animal welfare issues) (No.: IASCAAS-AE20140615). In this study, experimental chickens (JXH) were selected on H/L, with the…

[E::idx_find_and_load] warning in htseq-count 0 I am running the htseq-count but get the [E::idx_find_and_load] warning. The bam files were sorted with name but without index. It is not required for index when running htseq-count, correct? *CODE: htseq-count -f bam \ -s no \ -t exon \ -m union \ -i…

Alignment in bioinformatics 1 my project talk about gene expression profile of Mycobacterium tuberculosis on lung , i choose my samples from ENA :www.ebi.ac.uk/ena/browser/view/PRJEB19976 , I download reference genome from NCBI : www.ncbi.nlm.nih.gov/genome/?term=h37rvand , I create an index by myself using HISAT2 and after that i started the process of…

Using salmon on HISAT2 BAM files for transcript quantification 1 Hi, I am wondering if there is any need to align data at all if the goal is to quantify transcripts with salmon. Are there any advantages to aligning versus doing direct. quantification using salmon, since both options seem to…

Tophat2 manual pdf Rna$ sequencing- data- analysis, – nsci- 580a3, – fall, -! linux_ x86_ 64/ tophat2. ln – s ~ / tophat- 2. qiagen, with its leading expertise in sample preparation technologies, has developed a complete portfolio of dedicated products to optimize your workflow – on any ngs instrument….

Index with unmasked or masked in HISAT2 1 Hello everyone, I have a couple of doubts about the query source and the genome that I have to use to create an index to align with HISAT2. The first is whether it is correct to build the index with a “top…

Creating reference genome that includes HIV genome 1 Hi all, In this paper (www.ncbi.nlm.nih.gov/pmc/articles/PMC9831945/) the authors use a reference genome that includes the HIV genome. Seen in this sentence of the paper: “Adapters and low-quality bases were trimmed using Cutadapt v1.18 software 11 before alignment with the human reference genome(hg38andHIV-1:…

Error 134 while aligning using hisat2 0 Hello, I am using the below command to align the reads and get bam file: hisat2 -x /hisat/grch38/genome -1 /fastq/output_forward_paired.fq.gz -2 /fastq/output_reverse_paired.fq.gz | samtools sort -o /bams/outout.bam This was running perfectly ok for the last try, however, for the new try I got…

HISAT2 output direct to bam sorted 0 Hi all, I am mapping my samples to a reference genome with HISAT2 and I was wondering if it is possible to get the outputs in bam format and also if it is possible to sort by coordinates directly? Could you help me…

Materials Medakamo hakoo 311 was obtained from the personal aquarium of Prof. Kuroiwa (Kagurazaka, Tokyo, Japan)4. The M. hakoo strain was cultured in 0.05% HYPONeX (HYPONeX Japan Corp., Ltd., Osaka, Japan) liquid medium and on 0.05% HYPONeX gellan gum-based solid medium in plates. Cyanidioschyzon merolae 10D (Toda et al. 1995)…

Source: pigx-rnaseq Version: 0.1.0-1.1 Severity: serious Justification: FTBFS Tags: bookworm sid ftbfs User: lu…@debian.org Usertags: ftbfs-20230113 ftbfs-bookworm Hi, During a rebuild of all packages in sid, your package failed to build on amd64. Relevant part (hopefully): > input: > /<<PKGBUILDDIR>>/tests/output/feature_counts/raw_counts/hisat2/counts.tsv, > /<<PKGBUILDDIR>>/tests/output/colData.tsv > output: > /<<PKGBUILDDIR>>/tests/output/report/hisat2/analysis1.deseq.report.html > log: /<<PKGBUILDDIR>>/tests/output/logs/hisat2/analysis1.report.log >…

Analyzing time-series RNA-seq data using DEseq2 1 Hello everyone, I need a direction in using DEseq2. my Input : I have RNAseq data from two groups of mice (groups based on type of bacterial treatment). Each group was harvested at 7 different time points. In other words I have two…

Is it okay to use dna.toplevel file for alignment if primary assembly file is not available? 0 I cannot fine the primary assembly file for glycine max on ensembl plants. Can I use dna.top.level file or should i just stick to the sm files? I have read somewhere that “If…

HISAT2 and HTSEQ command 0 @4fedfa78 Last seen 10 hours ago Japan Hello, For analysis of the data by rna-sequencing I selected HISAT2 and HTSeq-count for mapping and counting the genes levels, the libraryLayout is paired, I am using the below command for both but the results are not exact…

Chu, B. B. et al. Cholesterol transport through lysosome-peroxisome membrane contacts. Cell 161, 291–306 (2015). CAS  Article  Google Scholar  Luo, J., Yang, H. & Song, B. L. Mechanisms and regulation of cholesterol homeostasis. Nat. Rev. Mol. Cell Biol. 21, 225–245 (2020). CAS  Article  Google Scholar  Luo, J., Jiang, L., Yang,…

using gatk haplotypecaller for variants extraction 0 Hi, I have rna-sequenced data from covid patients. I am using hisat2 for aligning the reads to reference. So, the resulted bam files after indexing are now ready. I would like to use gatk happlotypecaller for extracting variants from my bam files. First,…

Details Posted: 13-Aug-22 Location: Minneapolis, Minnesota Salary: 43944.32 – 123022.07 Categories: Research Support – Laboratory/Non-Laboratory Staff/Administrative Additional Information: 2 openings available. The Research Informatics Solutions (RIS) group within the University of Minnesota Supercomputing Institute (MSI) is hiring two full-time Bioinformatics Analysts to support research at the University of Minnesota. Analysts…

I have a query regarding differential gene expression using limma-voom. 1 @28946033 Last seen 1 day ago India I used the following pipeline for RNA Seq Analysis Fastq-Trimmomatic- Hisat2(gtf file was annotated)-featurecounts After featurecounts I tried to do limmavoom, but I get error saying this An error occurred with this…

Could not locate a HISAT2 index to basename 2 First time trying out HISAT2 and I’m having a problem here, even with the pre-made indices for GRCH38. $ hisat2 -x /share/projects/RNASeq/data/reference/GRCh38/grch38_tran -1 /home/echang/PANCANCER-030817-JE3-35880845/KTP-10-43736695/KTP-10_S3_L001_R1_001.fastq.gz -2 /home/echang/PANCANCER-030817-JE3-35880845/KTP-10-43736695/KTP-10_S3_L001_R2_001.fastq.gz -S tmp.sam Error follows Could not locate a HISAT2 index corresponding to basename “/share/projects/RNASeq/data/reference/GRCh38/grch38_tran” Error:…

Context: I’m trying to call variants on a sequencing project using pooled genotyping-by-sequencing. Pools consist of 94 samples each, alongside a number of individuals. Sequence data was demultiplexed and then aligned to a reference genome using hisat2, and the resultant bams were merged with samtools merge. The problem bam is…

Low exonic mapping of RNASeq data to draft genome. Should I suspect poor annotation? 0 I am working on RNASeq data for DE from a non-traditional organism (Artemia franciscana, a eukaryotic arthropod) whose draft genome was published last year. I should note here that although the genome was assembled with…

Software official website ： Hisat2： Manual | HISAT2 StringTie：StringTie article ：Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown | Nature Protocols It is recommended to watch the nanny level tutorial ： 1. RNA-seq : Hisat2+Stringtie+DESeq2 – Hengnuo Xinzhi 2. RNA-seq use hisat2、stringtie、DESeq2 analysis – Simple books Basic usage…

Finding DEGs from HISAT2/STRINGTIE output 0 Hello, I have to search for DEGs from four samples of crop. I am following reference based mapping of reads to genome using HISAT2. I have completed till the generation of merged .gtf files for the samples using STRINGTIE. Since I am new to…

Hello, I would like to confirm if the low assignment ratio (54%) is normal, and please check the possible reason I found. I used Hisat2 to assign paired-end strand-specific transcriptomic sequences (rRNA removed) to a reference genome. Because I filtered out the unmapped sequences in advance, the overall assignment ratio…

Background: The application of RNA-seq technology has become more extensive and the number of analysis procedures available has increased over the past years. Selecting an appropriate workflow has become an important issue for researchers in the field. Methods: In our study, six popular analytical procedures/pipeline were compared using four RNA-seq…

HT-Seq, Gene ID appeared in Gene Name row 0 Hi, I am doing alignment with HISAT2 and couting with HT-seq. I got the counting matrix but i found there are gene ID appear in the gene name row. Is it normal that gene ID can appear like this or are…

Hello! I am trying to annotate a miRNA-seq so that it gives me mature miRNAs where I already have 5p and 3p. For this, I have used the index mm10.fa and the miRBase mmu.gff3. I have aligned with HISAT2 and am trying to count with HTSeq, however I get 0…

circRNA quantification, differential expression analysis and miRNA target prediction of RNA-Seq data Introduction nf-core/circrna is a best-practice analysis pipeline for the quantification, miRNA target prediction and differential expression analysis of circular RNAs in paired-end RNA sequencing data. The pipeline is built using Nextflow, a workflow tool to run tasks across…

Introduction to RNA-seq data analysis – Extended Materials | cruk-summer-school-2021 Github repo for 2021 CRUK-CC Bioinformatics Summer School (tinyurl.com/crukss2021) Taught remotely Bioinformatics Training, Craik-Marshall Building, Downing Site, University of Cambridge Supplementary materials These files contain some additional information and exercises not included during the taught course. Obtaining public data Raw…

1. Sharma VK. Adaptive significance of circadian clocks. Chronobiol Int. 2003;20(6):901–19. PubMed  Google Scholar  2. Paranjpe DA, Sharma VK. Evolution of temporal order in living organisms. J Circadian Rhythms. 2005;3(1):7. PubMed  PubMed Central  Google Scholar  3. Yerushalmi S, Green RM. Evidence for the adaptive significance of circadian rhythms. Ecol Lett….

Significance The plant-specific H3K27me1 methyltransferases ATXR5 and ATXR6 play integral roles connecting epigenetic silencing with genomic stability. However, how H3K27me1 relates to these processes is poorly understood. In this study, we performed a comprehensive transcriptome analysis of tissue- and ploidy-specific expression in a hypomorphic atxr5/6 mutant and revealed that the…

How to label columns in HTSeq output 0 I’ve been working to process RNAseq data and I’ve used hisat2 to align my reads to the reference genome. When I take those output files and put them into HTSeq-count using the below code, I get a count matrix but the columns…

tranfering sam file easy and fast way 0 Hi everyone I was tried to align my fastq files by hisat2 but ı couldnot able done because my computer has 4gb ram and ı get error killed. So ı was perfomed process on my friend computer but now I should solve…

I found a little problem. When I set the “-t gene”, the reads is mark “__no_feature”. But when I set the “-t exon”, the reads is mark “ENSG00000276104”. The gene “ENSG00000276104” is a single exon gene. I don’t know why this happens. reads: “TGTCTGTGGCGGTGGGATCCCGCGGCCGTGTTTTCCTGGTGGCCCGGCCGTGCCTGAGGTTTCTCCCCGAGCCGCCGCCTCTGCGGGCTCCCGGGTGCCCTTGCCCTCGCGGTCCCCGGCCCTCGCCCGTCTGTGCCCTCTTCCCCGCCCGCCGATCCTCTTCTTCCCCCCGAGCGGCTCACCGGCTTCACGTCCGTTGGTGGCCCCGCCTGGGAC”. I had aligned to hg38 by…

Name Last modified Size Description Parent Directory   –   SOAPdenovo2.hints.html 2019-05-04 15:52 3.9K   Trimmomatic.hints.html 2019-05-20 13:32 6.3K   Trinity.hints.html 2019-04-23 11:39 2.4K   adaptercheck.hints.html 2021-05-13 12:27 8.0K   adaptercheck.html 2021-05-12 17:45 4.9K   adaptercheck_output.png 2021-05-12 17:17 51K   fastq_pair.hints.html 2019-04-05 13:16 3.4K   gffcompare.hints.html 2018-07-18 14:05 3.2K  …

(ERR): hisat2-align died with signal 6 (ABRT) (core dumped) 0 Hi, run hisat2 ,I encountered an error. hisat2-build -p 10 ~/public_data/genome/Pt_V1.0.fa genome 1>hisat2-build.log 2>&1 ~/software/hisat2-2.2.0/hisat2 -x genome -1 ~/data/clean/NC1_5_clean_R1.fastq.gz -2 ~/data/clean/NC1_5_clean_R2.fastq.gz -S NC1_5.sam 1>NC1_5.log 2>&1 cat NC1_5.log terminate called after throwing an instance of ‘std::bad_alloc’ what(): std::bad_alloc (ERR): hisat2-align died…

HISAT2 question, index generation. 0 Hello everyone, I have a question. Perform a basic line of work for RNA-seq analysis. A question arose when I generated the famous index in Hisat2 using the .FASTA extension reference genome. What is it means the information that Hisat2 throws at the end. E.g…

DESeq2 (or EdgeR) Exploratory Analysis with no Replicates 1 My pipeline so far is hisat2->featureCounts->DESeq2. I have generated heatmaps after rlog and log2 transformation of the genes with the most variance, which is somewhat meaningful. What I really want to do is compare everything to the control sample and take…

SeqMonk rRNA from QCplot 100% 1 Dear all, I have single-end RNAseq data that I mapped with Hisat2 and am looking at in SeqMonk. I plotted the QC plot (default) + Measure rRNA. I got 100 % rRNA. Which I think is impossible right? Or did I do something horribly…

Hello how are you? I reopen this question because the following has happened: I am doing a differential expression exercise using the hisat2, stringie & DESeq2 workflow. Finally I use the python prepDE.py script recommended in the StringTie manual to extract the counts. So far so good, I have rows…

Alignment of de novo assembled transcripts to reference transcriptome? 0 Hi all, I started with 40 samples of raw (but trimmed) RNASeq samples. I used these as inputs for SPAdes-rna and Trinity, to assemble them without a reference. I now have 80 assembled transcriptomes (?), and I tried to follow…

Introduction UCL-BLIC/rnaseq is a bioinformatics analysis pipeline used for RNA sequencing data, modified to add kallisto. The workflow processes raw data from FastQ inputs (FastQC, Trim Galore!), aligns the reads (STAR or HiSAT2), generates gene counts (featureCounts, StringTie) as well as kallisto abundance files, and performs extensive quality-control on the…

Introduction Psoriasis vulgaris, major chronic immune-mediated skin disease, affects 1–3% of the adult population worldwide.1 Psoriasis is one of the major complex skin diseases that is significantly linked to genetic predisposition, major histocompatibility alleles, and environmental factors.2 Over the past few years, the cellular and molecular contributions to psoriasis were…

1. Smith, J. M. & Száthmary, E. The Major Transitions in Evolution (Freeman, 1995). Google Scholar  2. Queller, D. C. Relatedness and the fraternal major transitions. Philos. Trans. R. Soc. Lond. B Biol. Sci. 355, 1647–1655 (2000). CAS  PubMed  PubMed Central  Google Scholar  3. Grosberg, R. K. & Strathmann, R….

Can someone help me understand the RSeQC Output from infer_experiment.py? I have RNAseq data from library constructed by TruSeq Stranded Total RNA (NEB Microbe), from pure bacterial culture so following some suggestions found here about this topic I run the mapping against the reference genome using a subsample by HISAT2…

DEG analysis without biological Replication 0 Is it possible to analysis the differential expression genes/transcripts form RNA-seq without any replications!!!. Actually I am handling the year old plant transcriptome data of different tissue of male and female plant to find DEGs betwen the tissue of male and female plant using…

HISAT2 no properly paired alignments 1 Hi All! I’m a wetlab guy quite new to data analysis and would appreciate some help if possible! Slowly i’m getting into commandline and understanding some of the workflow behind analysis but i’ve hit a bit of a wall. Following hisat2-build on the human…

Hello everyone, I hope you are well. I am writing this post because I have a question or rather I have a problem with my workflow. Perform a workflow for RNA-seq processing as follows: quality control – Hisat2 – Stringtie – Deseq2 A simple, normal workflow that threw me important…

Hey everybody! I am trying to annotate my RNA-seq files (paired-end) with featureCounts. However, I keep having a quite low annotation rate, ~35-36% for all the files. My command line is the following: featureCounts -T 6 -p -s 2 -a annotation_file.gtf -o output_file.txt input_files.bam I am using the parameter -s…

RNA-seq normalization methods between samples 0 I’m a beginner in RNA-seq. I’m trying to learn RNA-seq analysis with a practical and simple analysis with public RNA-seq data. I downloaded 9 RNA-seq files (same sample prepared on 9 different days) I’ve done mapping them with Hisat2. so far it seems pretty…

Running Hisat2 but it seems not working at all 0 I’m running Hisat2 with the code below: hisat2 -p 9 -f ../0.Reference/CHO-PICRH -1 ../2.Trimmomatic/ERR2593198_1_trimmed.fastq.gz -2 ../2.Trimmomatic/ERR2593198_2_trimmed.fastq.gz 2> ../3.HISAT/ERR25593198.log| samtools view -Sbo ../3.HISAT/ERR2593198.bam It’s been running over 24 hours but it doesn’t seem work well. Can you please check the code…

Hello everyone How are things going? Currently, I am processing ARN-seq data using Galaxy. I would like to observe the differential expression between controls and cases. For that, I follow the following steps: I did a quality check of my library first (obviously) Second, I used HISAT2 for reference genome…

hisat2 SyntaxError: invalid syntax 0 Hi all, I am really struggling with hisat2 recently and getting confused. I’m trying to run hisat2: hisat2 -t -p 2 -x shiryn RNAseq data/reference/grch38_genome/grch38 -1 shiryn RNAseq data/trimmed data/ly1_paired_1.trim.fq.gz shiryn RNAseq data/trimmed data/ly1_paired_2.trim.fq.gz -S shiryn RNAseq data/alighed/ly1.sam This is my error: File “/home/yun/Downloads/hisat2-2.2.0/hisat2_read_statistics.py”, line…

hisat SyntaxError: invalid syntax 2 Hi all, I am really struggling with hisat2 recently and getting confused. I’m trying to run hisat2 python2 /home/yun/Downloads/hisat2-2.2.0/hisat2 -t -p 2 -x shiryn RNAseq data/reference/grch38_genome/grch38 -1 shiryn RNAseq data/trimmed data/ly1_paired_1.trim.fq.gz shiryn RNAseq data/trimmed data/ly1_paired_2.trim.fq.gz -S shiryn RNAseq data/alighed/ly1.sam Heie is my error: File “/home/yun/Downloads/hisat2-2.2.0/hisat2”,…

RNA seq trimming 1 I am writing to know if 2-4 percent n content near the both ends of a sequence (RNA seq, read length:150) would be a problem and need trimming? RNA-Seq • 1.4k views It depends on the aligner that you use. If you’re using something like hisat2…

Paired-end reads somehow counted twice? 0 Hi. I’m new in Bioinformatics and try to extract read counts from fastq files. I compared my result with answer count matrix, and read counts are doubled. (Left one is from the answer read count matrix, and right one is my result.) I used…

samtools: Numerical result out of range 1 I am working with a SAM file (created with hisat2) with header: @SQ SN:chr1A LN:594006513 @SQ SN:chr1B LN:693261537 … When doing sorting and indexing, I get this error with samtools: [E::hts_idx_check_range] Region 536907741..536907892 cannot be stored in a bai index. Try using a…

bowtie2 and then HISAT2? What does it mean in Data processing details on a paper? 1 IMHO that must be a mistake: the data seems to be RNA so I would’ve directly gone for TopHat2 (or HISAT2). (Unless they wanted to run Fastqc in BAM, not fastq mode – in…

Does hisat2 –rg flag eat the “/” character in multiline definitions? 0 Hello, I am trying to use hisat2, but I noticed something weird. When running it like so: hisat2 -p 8 –rg-id=UHR_Rep2 –rg SM:UHR –rg LB:UHR_Rep2_ERCC-Mix1 –rg PL:ILLUMINA –rg PU:CXX1234-TGACAC.1 -x $RNA_REF_INDEX –dta –rna-strandness RF -1 “$RNA_DATA_DIR/${SAMPLE}_1.fastq.gz” -2 “$RNA_DATA_DIR/${SAMPLE}_2.fastq.gz”…