Tag: hisat2

Introduction to RNA-seq data analysis – Extended Materials

Introduction to RNA-seq data analysis – Extended Materials | cruk-summer-school-2021 Github repo for 2021 CRUK-CC Bioinformatics Summer School (tinyurl.com/crukss2021) Taught remotely Bioinformatics Training, Craik-Marshall Building, Downing Site, University of Cambridge Supplementary materials These files contain some additional information and exercises not included during the taught course. Obtaining public data Raw…

Continue Reading Introduction to RNA-seq data analysis – Extended Materials

Time-course RNASeq of Camponotus floridanus forager and nurse ant brains indicate links between plasticity in the biological clock and behavioral division of labor | BMC Genomics

1. Sharma VK. Adaptive significance of circadian clocks. Chronobiol Int. 2003;20(6):901–19. PubMed  Google Scholar  2. Paranjpe DA, Sharma VK. Evolution of temporal order in living organisms. J Circadian Rhythms. 2005;3(1):7. PubMed  PubMed Central  Google Scholar  3. Yerushalmi S, Green RM. Evidence for the adaptive significance of circadian rhythms. Ecol Lett….

Continue Reading Time-course RNASeq of Camponotus floridanus forager and nurse ant brains indicate links between plasticity in the biological clock and behavioral division of labor | BMC Genomics

The role of ATXR6 expression in modulating genome stability and transposable element repression in Arabidopsis

Significance The plant-specific H3K27me1 methyltransferases ATXR5 and ATXR6 play integral roles connecting epigenetic silencing with genomic stability. However, how H3K27me1 relates to these processes is poorly understood. In this study, we performed a comprehensive transcriptome analysis of tissue- and ploidy-specific expression in a hypomorphic atxr5/6 mutant and revealed that the…

Continue Reading The role of ATXR6 expression in modulating genome stability and transposable element repression in Arabidopsis

How to label columns in HTSeq output

How to label columns in HTSeq output 0 I’ve been working to process RNAseq data and I’ve used hisat2 to align my reads to the reference genome. When I take those output files and put them into HTSeq-count using the below code, I get a count matrix but the columns…

Continue Reading How to label columns in HTSeq output

tranfering sam file easy and fast way

tranfering sam file easy and fast way 0 Hi everyone I was tried to align my fastq files by hisat2 but ı couldnot able done because my computer has 4gb ram and ı get error killed. So ı was perfomed process on my friend computer but now I should solve…

Continue Reading tranfering sam file easy and fast way

htseq-count -t gene not working

I found a little problem. When I set the “-t gene”, the reads is mark “__no_feature”. But when I set the “-t exon”, the reads is mark “ENSG00000276104”. The gene “ENSG00000276104” is a single exon gene. I don’t know why this happens. reads: “TGTCTGTGGCGGTGGGATCCCGCGGCCGTGTTTTCCTGGTGGCCCGGCCGTGCCTGAGGTTTCTCCCCGAGCCGCCGCCTCTGCGGGCTCCCGGGTGCCCTTGCCCTCGCGGTCCCCGGCCCTCGCCCGTCTGTGCCCTCTTCCCCGCCCGCCGATCCTCTTCTTCCCCCCGAGCGGCTCACCGGCTTCACGTCCGTTGGTGGCCCCGCCTGGGAC”. I had aligned to hg38 by…

Continue Reading htseq-count -t gene not working

Index of /~psgendb/doc/bioLegato/blreads

Name Last modified Size Description Parent Directory   –   SOAPdenovo2.hints.html 2019-05-04 15:52 3.9K   Trimmomatic.hints.html 2019-05-20 13:32 6.3K   Trinity.hints.html 2019-04-23 11:39 2.4K   adaptercheck.hints.html 2021-05-13 12:27 8.0K   adaptercheck.html 2021-05-12 17:45 4.9K   adaptercheck_output.png 2021-05-12 17:17 51K   fastq_pair.hints.html 2019-04-05 13:16 3.4K   gffcompare.hints.html 2018-07-18 14:05 3.2K  …

Continue Reading Index of /~psgendb/doc/bioLegato/blreads

hisat2-align died with signal 6 (ABRT) (core dumped)

(ERR): hisat2-align died with signal 6 (ABRT) (core dumped) 0 Hi, run hisat2 ,I encountered an error. hisat2-build -p 10 ~/public_data/genome/Pt_V1.0.fa genome 1>hisat2-build.log 2>&1 ~/software/hisat2-2.2.0/hisat2 -x genome -1 ~/data/clean/NC1_5_clean_R1.fastq.gz -2 ~/data/clean/NC1_5_clean_R2.fastq.gz -S NC1_5.sam 1>NC1_5.log 2>&1 cat NC1_5.log terminate called after throwing an instance of ‘std::bad_alloc’ what(): std::bad_alloc (ERR): hisat2-align died…

Continue Reading hisat2-align died with signal 6 (ABRT) (core dumped)

HISAT2 question, index generation.

HISAT2 question, index generation. 0 Hello everyone, I have a question. Perform a basic line of work for RNA-seq analysis. A question arose when I generated the famous index in Hisat2 using the .FASTA extension reference genome. What is it means the information that Hisat2 throws at the end. E.g…

Continue Reading HISAT2 question, index generation.

DESeq2 (or EdgeR) Exploratory Analysis with no Replicates

DESeq2 (or EdgeR) Exploratory Analysis with no Replicates 1 My pipeline so far is hisat2->featureCounts->DESeq2. I have generated heatmaps after rlog and log2 transformation of the genes with the most variance, which is somewhat meaningful. What I really want to do is compare everything to the control sample and take…

Continue Reading DESeq2 (or EdgeR) Exploratory Analysis with no Replicates

SeqMonk rRNA from QCplot 100%

SeqMonk rRNA from QCplot 100% 1 Dear all, I have single-end RNAseq data that I mapped with Hisat2 and am looking at in SeqMonk. I plotted the QC plot (default) + Measure rRNA. I got 100 % rRNA. Which I think is impossible right? Or did I do something horribly…

Continue Reading SeqMonk rRNA from QCplot 100%

values (NA) in p value Deseq2 (reopen)

Hello how are you? I reopen this question because the following has happened: I am doing a differential expression exercise using the hisat2, stringie & DESeq2 workflow. Finally I use the python prepDE.py script recommended in the StringTie manual to extract the counts. So far so good, I have rows…

Continue Reading values (NA) in p value Deseq2 (reopen)

Alignment of de novo assembled transcripts to reference transcriptome?

Alignment of de novo assembled transcripts to reference transcriptome? 0 Hi all, I started with 40 samples of raw (but trimmed) RNASeq samples. I used these as inputs for SPAdes-rna and Trinity, to assemble them without a reference. I now have 80 assembled transcriptomes (?), and I tried to follow…

Continue Reading Alignment of de novo assembled transcripts to reference transcriptome?

UCL-BLIC/rnaseq – Giters

Introduction UCL-BLIC/rnaseq is a bioinformatics analysis pipeline used for RNA sequencing data, modified to add kallisto. The workflow processes raw data from FastQ inputs (FastQC, Trim Galore!), aligns the reads (STAR or HiSAT2), generates gene counts (featureCounts, StringTie) as well as kallisto abundance files, and performs extensive quality-control on the…

Continue Reading UCL-BLIC/rnaseq – Giters

High-Throughput RNA Sequencing Reveals the Effect of NB-UVB

Introduction Psoriasis vulgaris, major chronic immune-mediated skin disease, affects 1–3% of the adult population worldwide.1 Psoriasis is one of the major complex skin diseases that is significantly linked to genetic predisposition, major histocompatibility alleles, and environmental factors.2 Over the past few years, the cellular and molecular contributions to psoriasis were…

Continue Reading High-Throughput RNA Sequencing Reveals the Effect of NB-UVB

Genome sequencing of the multicellular alga Astrephomene provides insights into convergent evolution of germ-soma differentiation

1. Smith, J. M. & Száthmary, E. The Major Transitions in Evolution (Freeman, 1995). Google Scholar  2. Queller, D. C. Relatedness and the fraternal major transitions. Philos. Trans. R. Soc. Lond. B Biol. Sci. 355, 1647–1655 (2000). CAS  PubMed  PubMed Central  Google Scholar  3. Grosberg, R. K. & Strathmann, R….

Continue Reading Genome sequencing of the multicellular alga Astrephomene provides insights into convergent evolution of germ-soma differentiation

Can someone help me understand the RSeQC Output from infer_experiment.py?

Can someone help me understand the RSeQC Output from infer_experiment.py? I have RNAseq data from library constructed by TruSeq Stranded Total RNA (NEB Microbe), from pure bacterial culture so following some suggestions found here about this topic I run the mapping against the reference genome using a subsample by HISAT2…

Continue Reading Can someone help me understand the RSeQC Output from infer_experiment.py?

DEG analysis without biological Replication

DEG analysis without biological Replication 0 Is it possible to analysis the differential expression genes/transcripts form RNA-seq without any replications!!!. Actually I am handling the year old plant transcriptome data of different tissue of male and female plant to find DEGs betwen the tissue of male and female plant using…

Continue Reading DEG analysis without biological Replication

HISAT2 no properly paired alignments

HISAT2 no properly paired alignments 1 Hi All! I’m a wetlab guy quite new to data analysis and would appreciate some help if possible! Slowly i’m getting into commandline and understanding some of the workflow behind analysis but i’ve hit a bit of a wall. Following hisat2-build on the human…

Continue Reading HISAT2 no properly paired alignments

Help for extraction of fasta sequences

Hello everyone, I hope you are well. I am writing this post because I have a question or rather I have a problem with my workflow. Perform a workflow for RNA-seq processing as follows: quality control – Hisat2 – Stringtie – Deseq2 A simple, normal workflow that threw me important…

Continue Reading Help for extraction of fasta sequences

featureCounts low annotation rate RNA-seq

Hey everybody! I am trying to annotate my RNA-seq files (paired-end) with featureCounts. However, I keep having a quite low annotation rate, ~35-36% for all the files. My command line is the following: featureCounts -T 6 -p -s 2 -a annotation_file.gtf -o output_file.txt input_files.bam I am using the parameter -s…

Continue Reading featureCounts low annotation rate RNA-seq

RNA-seq normalization methods between samples

RNA-seq normalization methods between samples 0 I’m a beginner in RNA-seq. I’m trying to learn RNA-seq analysis with a practical and simple analysis with public RNA-seq data. I downloaded 9 RNA-seq files (same sample prepared on 9 different days) I’ve done mapping them with Hisat2. so far it seems pretty…

Continue Reading RNA-seq normalization methods between samples

Running Hisat2 but it seems not working at all

Running Hisat2 but it seems not working at all 0 I’m running Hisat2 with the code below: hisat2 -p 9 -f ../0.Reference/CHO-PICRH -1 ../2.Trimmomatic/ERR2593198_1_trimmed.fastq.gz -2 ../2.Trimmomatic/ERR2593198_2_trimmed.fastq.gz 2> ../3.HISAT/ERR25593198.log| samtools view -Sbo ../3.HISAT/ERR2593198.bam It’s been running over 24 hours but it doesn’t seem work well. Can you please check the code…

Continue Reading Running Hisat2 but it seems not working at all

Error in Galaxy using Deseq2 “Error in data.frame(…, check.names = FALSE) :”

Hello everyone How are things going? Currently, I am processing ARN-seq data using Galaxy. I would like to observe the differential expression between controls and cases. For that, I follow the following steps: I did a quality check of my library first (obviously) Second, I used HISAT2 for reference genome…

Continue Reading Error in Galaxy using Deseq2 “Error in data.frame(…, check.names = FALSE) :”

hisat2 SyntaxError: invalid syntax

hisat2 SyntaxError: invalid syntax 0 Hi all, I am really struggling with hisat2 recently and getting confused. I’m trying to run hisat2: hisat2 -t -p 2 -x shiryn RNAseq data/reference/grch38_genome/grch38 -1 shiryn RNAseq data/trimmed data/ly1_paired_1.trim.fq.gz shiryn RNAseq data/trimmed data/ly1_paired_2.trim.fq.gz -S shiryn RNAseq data/alighed/ly1.sam This is my error: File “/home/yun/Downloads/hisat2-2.2.0/hisat2_read_statistics.py”, line…

Continue Reading hisat2 SyntaxError: invalid syntax

hisat SyntaxError: invalid syntax

hisat SyntaxError: invalid syntax 2 Hi all, I am really struggling with hisat2 recently and getting confused. I’m trying to run hisat2 python2 /home/yun/Downloads/hisat2-2.2.0/hisat2 -t -p 2 -x shiryn RNAseq data/reference/grch38_genome/grch38 -1 shiryn RNAseq data/trimmed data/ly1_paired_1.trim.fq.gz shiryn RNAseq data/trimmed data/ly1_paired_2.trim.fq.gz -S shiryn RNAseq data/alighed/ly1.sam Heie is my error: File “/home/yun/Downloads/hisat2-2.2.0/hisat2”,…

Continue Reading hisat SyntaxError: invalid syntax

RNA seq trimming

RNA seq trimming 1 I am writing to know if 2-4 percent n content near the both ends of a sequence (RNA seq, read length:150) would be a problem and need trimming? RNA-Seq • 1.4k views It depends on the aligner that you use. If you’re using something like hisat2…

Continue Reading RNA seq trimming

Paired-end reads somehow counted twice?

Paired-end reads somehow counted twice? 0 Hi. I’m new in Bioinformatics and try to extract read counts from fastq files. I compared my result with answer count matrix, and read counts are doubled. (Left one is from the answer read count matrix, and right one is my result.) I used…

Continue Reading Paired-end reads somehow counted twice?

Numerical result out of range

samtools: Numerical result out of range 1 I am working with a SAM file (created with hisat2) with header: @SQ SN:chr1A LN:594006513 @SQ SN:chr1B LN:693261537 … When doing sorting and indexing, I get this error with samtools: [E::hts_idx_check_range] Region 536907741..536907892 cannot be stored in a bai index. Try using a…

Continue Reading Numerical result out of range

bowtie2 and then HISAT2? What does it mean in Data processing details on a paper?

bowtie2 and then HISAT2? What does it mean in Data processing details on a paper? 1 IMHO that must be a mistake: the data seems to be RNA so I would’ve directly gone for TopHat2 (or HISAT2). (Unless they wanted to run Fastqc in BAM, not fastq mode – in…

Continue Reading bowtie2 and then HISAT2? What does it mean in Data processing details on a paper?

Does hisat2 –rg flag eat the “/” character in multiline definitions?

Does hisat2 –rg flag eat the “/” character in multiline definitions? 0 Hello, I am trying to use hisat2, but I noticed something weird. When running it like so: hisat2 -p 8 –rg-id=UHR_Rep2 –rg SM:UHR –rg LB:UHR_Rep2_ERCC-Mix1 –rg PL:ILLUMINA –rg PU:CXX1234-TGACAC.1 -x $RNA_REF_INDEX –dta –rna-strandness RF -1 “$RNA_DATA_DIR/${SAMPLE}_1.fastq.gz” -2 “$RNA_DATA_DIR/${SAMPLE}_2.fastq.gz”…

Continue Reading Does hisat2 –rg flag eat the “/” character in multiline definitions?

What is the difference between HISAT2 index “genome.tran” and “genome”

What is the difference between HISAT2 index “genome.tran” and “genome” 1 I try to use HISAT2 in order to map the reads to the genome, while HISAT2 pre-index the genome for users. I saw that alternative sequences will affect the mapping results, does genome.tran index includes the alternative splicing and…

Continue Reading What is the difference between HISAT2 index “genome.tran” and “genome”

High counts of rRNA in RNA-Seq

Hi there, I have recently performed RNA-Seq on the total RNA of a mosquito tissue, where I have three biological replicates of the tissue at three different time points. The pipeline I used was HISAT2 –> featureCounts –> DESeq2. Looking at the normalized counts (output of DESeq2), the counts of…

Continue Reading High counts of rRNA in RNA-Seq

extract gene sequence from multiple bam files in order to do Ka/Ks test

extract gene sequence from multiple bam files in order to do Ka/Ks test 0 Hello, I have a dataset of RNA bulk rna-seq (single-end), mapped with hisat2 and now I want to extract the sequences of some genes of my interest in order to run a Ka/Ks test for them…

Continue Reading extract gene sequence from multiple bam files in order to do Ka/Ks test

Why my reads mapping rate extremely low

I am using a script to analyze a large amount of ribo-seq data, which comes from different studies. Because from different research, I use trim_galore to remove the adaptor. Use bowtie2 to remove rRNA and use STAR mapping. After mapping, I found that the mapping rate of some of the…

Continue Reading Why my reads mapping rate extremely low

TPMCalculator returns zero for some genes, which are non-zero with Cuffdiff (FPKM).

TPMCalculator returns zero for some genes, which are non-zero with Cuffdiff (FPKM). 0 I ran TPMCalculator on my RNA-seq data. This was my first time using this package. It seemed to have done without any problems, but I realized that counts of some genes are zero. I performed DEG analysis…

Continue Reading TPMCalculator returns zero for some genes, which are non-zero with Cuffdiff (FPKM).

What to do with genes that appear as NA but have statistics

What to do with genes that appear as NA but have statistics 0 Hi I’m doing an RNA-seq analysis and I’m having problems identifying some of the genes in the output of the DESeq2 tool because the list of genes obtained are in Entrez id, for context the pipeline used…

Continue Reading What to do with genes that appear as NA but have statistics

deepvariant is very slow on alignements produced by hisat2 and reports only half of expected SNPs/INDELs

Hi @lpryszcz With respect to your aligner question, we have evaluated DeepVariant with BWA-MEM/BWA-MEM2, minimap2, DRAGEN, and the graph mapper Giraffe. For mapping to a linear reference, we would recommend BWA-MEM/BWA-MEM2 or DRAGEN. DeepVariant is trained on BWA MEM data. Minimap2 will work, but has slightly lower accuracy. We have…

Continue Reading deepvariant is very slow on alignements produced by hisat2 and reports only half of expected SNPs/INDELs

iCOMIC: a graphical interface-driven bioinformatics pipeline for analyzing cancer omics data

Abstract Despite the tremendous increase in omics data generated by modern sequencing technologies, their analysis can be tricky and often requires substantial expertise in bioinformatics. To address this concern, we have developed a user-friendly pipeline to analyze (cancer) genomic data that takes in raw sequencing data (FASTQ format) as input…

Continue Reading iCOMIC: a graphical interface-driven bioinformatics pipeline for analyzing cancer omics data

Genome indexing with hisat2 and samtools

Genome indexing with hisat2 and samtools 0 Hello, I found this code in Biostar handbook (RNA-Seq by Example) in section about genome indexing. # The reference genome. IDX=refs/genome.fa # Build the genome index. hisat2-build $IDX $IDX # Index the reference genome with samtools. samtools faidx $IDX I was wondering about…

Continue Reading Genome indexing with hisat2 and samtools

Differences in HISAT2 indexes for download

Differences in HISAT2 indexes for download 0 Hi all, hope you guys are doing fine in the pandemic. So I have just recently beginning to move into computational biology stuff (and found it amazing) and one of the first things Im trying to do is to map fastq files against…

Continue Reading Differences in HISAT2 indexes for download

How to install hisat2 on Mac OS Big Sur

How to install hisat2 on Mac OS Big Sur 0 I’d like to install HISAT2 on Mac OS Big Sur ver.11.5.2. I have tried to install HISAT2 by using bioconda (Hisate2 :: Anaconda), and the installation seemed to be successful, but when I tried to start hisat2, I’m getting the…

Continue Reading How to install hisat2 on Mac OS Big Sur

hisat2-align exited with value 1″ in mapping long noncoding RNAs

what does mean this error ? “(ERR): hisat2-align exited with value 1” in mapping long noncoding RNAs 0 Hello everyone.what does mean this error ? “(ERR): hisat2-align exited with value 1” in mapping long noncoding RNAs. mapping long RNAs non-coding • 30 views • link updated 2 hours ago by…

Continue Reading hisat2-align exited with value 1″ in mapping long noncoding RNAs

Does Hisat2 automatically align strandedness

Does Hisat2 automatically align strandedness 0 I’ve been using Hisat2 to align some RNA. RNA was prepped using NEB Directional library kit. When I originally aligned, I did not use the –rna-strandedness option. I then realised I do want stranded, as part of my reference (which is human genome plus…

Continue Reading Does Hisat2 automatically align strandedness

HTseq doesn’t support Multi-Threading ?

HTseq doesn’t support Multi-Threading ? 1 Hello, everyone ! I’m looking for a way to use HTseq with multi-thread. I couldn’t find any options about multi-thread. Anybody knows how to, please ? (I know there are tools support multi-thread like STAR, HISAT2. but just wonder whether HTseq doesn’t support it.)…

Continue Reading HTseq doesn’t support Multi-Threading ?

Fastqc user manual – vodosp.ru

FASTQ format – Wikipedia 06 September 2021 – by TC Collin · 2020 · Cited by 3 — Be accompanied by a step-by-step user-friendly manual, If the user performs FastQC prior to the removal of adapters (step 3), the length Both programs can be used on Linux/MacOS X machines and quite…

Continue Reading Fastqc user manual – vodosp.ru

Methylkit (differential methylation analysis) error in data frame

Methylkit (differential methylation analysis) error in data frame 0 Hi Friends, I am performing the differential methylation analysis using methylkit but it is throwing error in data frame. ” Error in [.data.frame(data, , 6) : undefined columns selected”. Can anyone help me to solve this error. Following is my R…

Continue Reading Methylkit (differential methylation analysis) error in data frame

Hisat2 error

Hisat2 error 1 Hi all I am using this command. hisat2 -p 8 -q -X ${READDIR}/hisat2_index_Cm_genome -1 ${READDIR}/tr.p.UE-2955-CMLib1_S88_L004_R1_001.fastq.gz -2 ${READDIR}/tr.p.UE-2955-CMLib1_S88_L004_R2_001.fastq.gz -S ${Output}/UE-2955-CMLib1.sam Error: Encountered internal HISAT2 exception (#1) Need a help to fix this problem. thanks Hisat2 • 24 views It is a lowercase x, so -x for the index….

Continue Reading Hisat2 error

hisat2 alignment showing 0% aligned but sam file is 6GB in size.

hisat2 alignment showing 0% aligned but sam file is 6GB in size. 0 Hello, I am trying to align my fastq files with the reference genome assembly (MRSA ATCC 33591). The sam file formed is some 5-6 GB in size whereas hisat2 output is showing 0.0% alignment rate. I am…

Continue Reading hisat2 alignment showing 0% aligned but sam file is 6GB in size.

How to select uniquely and concordantly reads from hisat2 alingment for raw read count

Ok, let’s go through it. The -f 0x2 bitwise flag selection keeps proper pairs, which are read pairs mapped in correct orientation (I suppose illumina reads facing each other) and within insert size (-X and -I) -> concordantly. Now, if you want the uniquely mapped, you should basically exclude all…

Continue Reading How to select uniquely and concordantly reads from hisat2 alingment for raw read count

How to align fastq files against a reference assembly

How to align fastq files against a reference assembly 0 Hello, I am trying to align fastq files against the bacterial MRSA ATCC 33591 reference genome. The problem I am facing is that I have the reference assembly in fasta format with multiple sequences and upon creating index with hisat2-build…

Continue Reading How to align fastq files against a reference assembly

samtools server vs cluster error

Using inspiration from this thread HISAT2 output direct to bam, I’m attempting to run this command. The shell variables in this case represent paths to files/locations that make sense and in fact this command runs fine on my Ubuntu 18.04 LTS server using hisat 2.1 and samtools 1.10 (this seems…

Continue Reading samtools server vs cluster error

Unable to locate package hisat2″

how to solve this error when I want to install HISAT2? “E: Unable to locate package hisat2” 1 Dear all, I need to install HISAT2 aligner in my study. My Linux version is 16.04 (Xenial Xerus). So I used the below command : sudo apt-get install -y hisat2 but I…

Continue Reading Unable to locate package hisat2″

Pybedtools error sans

Pybedtools error sans 20-08-2021 pysam – Error when I install samtools for python on windows – i trying install pysam, pybedtools modules on python got error: ($i=1; $i[email protected] temp]$ conda install pysam bedtools hisat2 [ snip. However,…

Continue Reading Pybedtools error sans

Running featureCounts separately for each sample and merging results

Running featureCounts separately for each sample and merging results 3 I am running a differential expression analysis project using HISAT2 for alignment and featureCounts for assembly. I have 27 samples with paired-end reads, and the FASTQ files alone take up about 270 GB. After running alignment for a few samples,…

Continue Reading Running featureCounts separately for each sample and merging results

Question regarding providing file path to indexed genome folder

HISAT2: Question regarding providing file path to indexed genome folder 0 hisat2 -p 1 -x hisatIndex/genome.fa –dta –rna-strandness RF -1 $R1 -2 $R2 -S genome.sam(ERR): “hisatIndex/genome.fa” does not exist Exiting now … this error showing up every time i run the code and I dont know what is the problem…

Continue Reading Question regarding providing file path to indexed genome folder

align using file.ht2

align using file.ht2 1 now i downloaded in my terminal indexed file of UCSC hg19 and when i uncompress it , i found two files genome.5.ht2 genome.8.ht2 and every time i want to align my samples at indexed file this error show up [e::bwa_idx_load_from_disk] fail to locate the index files…

Continue Reading align using file.ht2

hisat2 compatibility for long read

hisat2 compatibility for long read 0 Hi, I am trying to align PacBio transcriptome reads against the genome to count the gene number. For pair end read i used the following workflow: # convert gff to gtf /home/software/cufflinks-2.2.1/gffread xxx.gff -T -o xxx.gtf # build index /home/software/hisat2-2.2.1/hisat2_extract_exons.py xxx.gtf > xxx.exon /home/software/hisat2-2.2.1/hisat2_extract_splice_sites.py…

Continue Reading hisat2 compatibility for long read