Categories
Tag: HMM
A Benchmark of Genetic Variant Calling Pipelines Using Metagenomic Short-Read Sequencing
Introduction Short-read metagenomic sequencing is the technique most widely used to explore the natural habitat of millions of bacteria. In comparison with 16S rRNA sequencing, shotgun metagenomic sequencing (MGS) provides sequence information of the whole genomes, which can be used to identify different genes present in an individual bacterium and…
Structure-guided discovery of anti-CRISPR and anti-phage defense proteins
Identification of putative anti-crispr proteins using structural features To identify Acrs in phage genomes, we began by retrieving ~66.5 million proteins from Integrated Microbial Genomes Virus database (IMG/VR)37. We excluded large proteins because over 90% of known Acrs contain less than 200 amino acids38 (Fig. 1A, Supplementary Data 1). To reduce computational…
Accurate detection of identity-by-descent segments in human ancient DNA
Ethics No new aDNA data were generated for this study and we only analysed previously published and publicly available aDNA data. Identifying biological kin is a standard analysis in the aDNA field. Permission for aDNA work on the archaeological samples was granted by the respective excavators, archaeologists, curators and museum…
How to Create an HMMER Profile with VFDB Files?
How to Create an HMMER Profile with VFDB Files? 1 How do I create an HMM profile using the files from www.mgc.ac.cn/VFs/ to run HMMER? I have the file.faa after running Prodigal and I need to generate a profile with hmmbuild called profile.hmm. This is my first time creating a…
Topological structures and syntenic conservation in sea anemone genomes
Putnam, N. H. et al. Sea anemone genome reveals ancestral eumetazoan gene repertoire and genomic organization. Science 317, 86–94 (2007). Article ADS CAS PubMed Google Scholar Chapman, J. A. et al. The dynamic genome of Hydra. Nature 464, 592–596 (2010). Article ADS CAS PubMed PubMed Central Google Scholar Srivastava, M….
Phyloecology of nitrate ammonifiers and their importance relative to denitrifiers in global terrestrial biomes
Steffen, W. et al. Planetary boundaries: guiding human development on a changing planet. Science 347, 1259855 (2015). Article PubMed Google Scholar Kanter, D. R. et al. Nitrogen pollution policy beyond the farm. Nat. Food 1, 27–32 (2020). Article ADS Google Scholar Tian, H. et al. A comprehensive quantification of global…
Origin and evolution of the triploid cultivated banana genome
Rouard, M. et al. Three new genome assemblies support a rapid radiation in Musa acuminata (wild banana). Genome Biol. Evol. 10, 3129–3140 (2018). CAS PubMed PubMed Central Google Scholar Langhe, E. D., Vrydaghs, L., Maret, P. D., Perrier, X. & Denham, T. Why bananas matter: an introduction to the history…
An article on how to quickly, efficiently and robustly screen metagenomic-derived enzymes
Over the past few decades, the use of metagenomics to mine genomes from non-cultured microorganisms has been a powerful tool for discovering new proteins and other valuable biomolecules. The vast amounts of sequencing data generated by metagenomics provide a glimpse into the biosynthetic potential of uncultured microorganisms. However, functional characterization…
Genomic evidence that microbial carbon degradation is dominated by iron redox metabolism in thawing permafrost
Tarnocai C, Canadell JG, Schuur EA, Kuhry P, Mazhitova G, Zimov S. Soil organic carbon pools in the northern circumpolar permafrost region. Global Biogeochem Cycles. 2009;23:1–11. Article Google Scholar Hugelius G, Strauss J, Zubrzycki S, Harden JW, Schuur EA, Ping CL, et al. Estimated stocks of circumpolar permafrost carbon with…
The Mla system of diderm Firmicute Veillonella parvula reveals an ancestral transenvelope bridge for phospholipid trafficking
Bacterial strains and growth conditions Veillonella parvula SKV38 was grown in SK medium (10 g/L tryptone [Difco], 10 g/L yeast extract [Difco], 0.4 g/L disodium phosphate, 2 g/L sodium chloride, and 10 ml/L 60% [wt/vol] sodium DL-lactate; described in ref. 51. Cultures were incubated at 37 °C in anaerobic conditions, either in anaerobic bags (GENbag anaero;…
Infant microbiome cultivation and metagenomic analysis reveal Bifidobacterium 2’-fucosyllactose utilization can be facilitated by coexisting species
Stewart, C. J. et al. Temporal development of the gut microbiome in early childhood from the TEDDY study. Nature 562, 583–588 (2018). Article CAS ADS PubMed PubMed Central Google Scholar Tamburini, S., Shen, N., Wu, H. C. & Clemente, J. C. The microbiome in early life: implications for health outcomes….
Primate-specific ZNF808 is essential for pancreatic development in humans
Subjects The study was conducted in accordance with the Declaration of Helsinki and all subjects or their parents/guardian gave informed written consent for genetic testing. DNA testing and storage in the Beta Cell Research Bank was approved by the Wales Research Ethics Committee 5 Bangor (REC 17/WA/0327, IRAS project ID…
Bacteria can maintain rRNA operons solely on plasmids for hundreds of millions of years
Egan, E. S., Fogel, M. A. & Waldor, M. K. Divided genomes: negotiating the cell cycle in prokaryotes with multiple chromosomes. Mol. Microbiol. 56, 1129–1138 (2005). Article CAS PubMed Google Scholar Harrison, P. W., Lower, R. P., Kim, N. K. & Young, J. P. Introducing the bacterial ‘chromid’: not a…
Evolutionary insights into 3D genome organization and epigenetic landscape of Vigna mungo
Introduction The non-random packaging of chromatin within the nucleus is a universal feature of eukaryotic genomes. The three-dimensional (3D) spatial organization of chromatin could be partitioned at different levels based on the interaction frequency between two given loci in the genome. Advances in sequencing technologies have led to the identification…
Textbook knowledge turned on its head: 3-in-1 microorganism discovered
Phylogenomic reconstruction and metabolic potential of 19 Acidobacteriota metagenome assembled genomes (MAGs) recovered in this study. MAGs from this study (bold) that contained dsrAB are highlighted in red. The class is indicated at the left of the phylogenetic tree and family affiliation on the right (according to GTDB taxonomy99). Abbreviations…
The Evolving Role of Hidden Markov Models in Data Science
Artificial Intelligence (AI) has transformed countless industries, revolutionizing the way we live and work. One powerful tool in the arsenal of data scientists is the Hidden Markov Model (HMM). HMMs are statistical models that have become integral to a wide range of fields, such as speech recognition and bioinformatics. At…
Can someone help me explain this part of a lecture regarding gene finding HMM’s
Can someone help me explain this part of a lecture regarding gene finding HMM’s 0 I’m trying to learn about computational biology and this professor is describing an example of how a gene finding prediction model works. He then proceeds to explain why models should be designed to predict along…
Diverse electron carriers drive syntrophic interactions in an enriched anaerobic acetate-oxidizing consortium
Nobu MK, Narihiro T, Mei R, Kamagata Y, Lee PKH, Lee P-H, et al. Catabolism and interactions of uncultured organisms shaped by eco-thermodynamics in methanogenic bioprocesses. Microbiome. 2020;8:111. Article CAS PubMed PubMed Central Google Scholar Conrad R. Contribution of hydrogen to methane production and control of hydrogen concentrations in methanogenic…
Disease-specific loss of microbial cross-feeding interactions in the human gut
Wang, T., Goyal, A., Dubinkina, V. & Maslov, S. Evidence for a multi-level trophic organization of the human gut microbiome. PLOS Comput. Biol. 15, e1007524 (2019). Article ADS PubMed PubMed Central Google Scholar Fischbach, M. A. & Sonnenburg, J. L. Eating for two: how metabolism establishes interspecies interactions in the…
Common loss of far-red light photoacclimation in cyanobacteria from hot and cold deserts: a case study in the Chroococcidiopsidales
Quesada A, Vincent WF. Strategies of adaptation by antarctic cyanobacteria to ultraviolet radiation. Eur J Phycol. 1997;32:335–42. Article Google Scholar Genuário DB, Corrêa DM, Komárek J, Fiore MF. Characterization of freshwater benthic biofilm-forming Hydrocoryne (Cyanobacteria) isolates from Antarctica. J Phycol. 2013;49:1142–53. Article PubMed Google Scholar Makhalanyane TP, Valverde A, Gunnigle…
Antiviral type III CRISPR signalling via conjugation of ATP and SAM
Cloning Supplementary Table 1 shows the synthetic gene, DNA and RNA oligonucleotide sequences used in this study. The synthetic genes encoding B.fragilis Cas6, CorA, NrN and C. botulinum SAM lyase purchased as g-blocks (IDT) were codon-optimized for expression in E. coli C43 (DE3) via the vector pEhisV5TEV, which encodes eight…
EasyCGTree: a pipeline for prokaryotic phylogenomic analysis based on core gene sets | BMC Bioinformatics
EasyCGTree was implemented in Perl programming languages (www.perl.org/) and was built using a collection of published reputable tools, including Clustal Omega version 1.2.4 [12]; consense from PHYLIP version 3.698 [13]; FastTree version 2.1 [14]; hmmbuild and hmmsearch from HMMER version 3.0 (hmmer.org/); IQ-TREE version 2.1.1 [15]; trimAl version 1.2 [16];…
Microbial-enrichment method enables high-throughput metagenomic characterization from host-rich samples
Tuganbaev, T. et al. Diet diurnally regulates small intestinal microbiome-epithelial-immune homeostasis and enteritis. Cell 182, 1441–1459 (2020). Article CAS PubMed Google Scholar Dejea, C. M. et al. Patients with familial adenomatous polyposis harbor colonic biofilms containing tumorigenic bacteria. Science 359, 592–597 (2018). Article CAS PubMed PubMed Central Google Scholar Bullman,…
plotnineSeqSuite: a Python package for visualizing sequence data using ggplot2 style | BMC Genomics
Schneider TD, Stephens RM. Sequence logos: a new way to display consensus sequences. Nucleic Acids Res. 1990;18(20):6097–100. Article CAS PubMed PubMed Central Google Scholar Colaert N, Helsens K, Martens L, Vandekerckhove J, Gevaert K. Improved visualization of protein consensus sequences by iceLogo. Nat Methods. 2009;6(11):786–7. Article CAS PubMed Google Scholar …
The blackcap (Sylvia atricapilla) genome reveals a recent accumulation of LTR retrotransposons
The genome assembly was performed with the pipeline v1.5 of the Vertebrate Genomes Project (VGP) and can be found under NCBI BioProject PRJNA558064, accession number GCA_009819655.1, for further details on the sample collection and assembly see Ishigohoka et al.9. In brief, a female blackcap from mainland Spain was caught to…
A subset of viruses thrives following microbial resuscitation during rewetting of a seasonally dry California grassland soil
Field sample collection Topsoil samples (0–15 cm, roughly 0.5 m3) from replicate field plots were collected from the Hopland Research and Extension Center (HREC) in Northern California, which is unceded land of the Shóqowa and Hopland People, on August 28th, 2018 after experiencing mean annual precipitation during the rainy season, see our…
Phylotranscriptomics unveil a Paleoproterozoic-Mesoproterozoic origin and deep relationships of the Viridiplantae
Brocks, J. J. et al. The rise of algae in Cryogenian oceans and the emergence of animals. Nature 548, 578–581 (2017). Article ADS CAS PubMed Google Scholar Leliaert, F. Green algae: Chlorophyta and Streptophyta. In Encyclopedia of microbiology 457–468 (Academic Press, 2019). Zhang, Z. et al. Origin and evolution of…
Solved explain these figuresSummary of the 16S and 18S
explain these figuresSummary of the 16S and 18S small-subunit (SSU) rRNA genes extracted in four different ways: three assembly sets run against HMMs {long reads assembled with metaFlye (“metaFlye + HMMs”), long and short reads assembled with hybridSPAdes (“hybridSPAdes + HMMs”), and short reads assembled with metaSPAdes [“Illumina (SPAdes +…
Installation – environment file not found – Technical Support
rjay428 (Rylee Jensen) September 5, 2023, 10:34pm 1 Hi all! Brand new to QIIME2 and with the Python environment as well. I’m running into an issue during the installation process that is close to what is posted on here, but I haven’t been able to figure out this exact problem….
Multi-omics data provide insight into the adaptation of the glasshouse plant Rheum nobile to the alpine subnival zone
Yang, Y. et al. Advances in the studies of plant diversity and ecological adaptation in the subnival ecosystem of the Qinghai-Tibet plateau. Chin. Sci. Bull. 64, 2856–2864 (2019). Article Google Scholar Zhang, Y., Li, B. & Zheng, D. Datasets of the boundary and area of the Tibetan plateau. Acta Geographica…
i am having trouble with the VIBRANT embedded in Viroprofiler
Hi, I am trying to run the Viroprofiler, the new program to analyze viral metagenome data. Since the Viroprofiler encompasses multiple programs to run them all at once, I am facing error message after error message while running the command. While I was running my command as suggested, $nextflow run…
Interrogating the viral dark matter of the rumen ecosystem with a global virome database
Gregory, A. C. et al. Marine DNA viral macro-and microdiversity from pole to pole. Cell 177, 1109–1123.e1114 (2019). Article CAS PubMed PubMed Central Google Scholar Roux, S. et al. Ecogenomics and potential biogeochemical impacts of globally abundant ocean viruses. Nature 537, 689–693 (2016). Article CAS PubMed Google Scholar Camarillo-Guerrero, L….
Non-cell-autonomous cancer progression from chromosomal instability
Cell culture IMR90, 4T1, CT26, RAW264.7 and B16F10 cell lines were purchased from the American Type Culture Collection and cultured in MEM (IMR90), DMEM (B16F10, RAW264.7) or RPMI (4T1, IMR90, CT26) supplemented with 10% FBS in the presence of penicillin (50 U ml−1) and streptomycin (50 μg ml−1). All cells were found to be…
Assembly of 43 human Y chromosomes reveals extensive complexity and variation
Skaletsky, H. et al. The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 423, 825–837 (2003). Article ADS CAS PubMed Google Scholar Porubsky, D. et al. Recurrent inversion polymorphisms in humans associate with genetic instability and genomic disorders. Cell 185, 1986–2005 (2022). Article …
RefSeq: WP_042393373
LOCUS WP_042393373 702 aa linear BCT 24-JUN-2023 DEFINITION MULTISPECIES: bifunctional GTP diphosphokinase/guanosine-3′,5′-bis pyrophosphate 3′-pyrophosphohydrolase [Enterobacteriaceae]. ACCESSION WP_042393373 VERSION WP_042393373.1 KEYWORDS RefSeq. SOURCE Enterobacteriaceae ORGANISM Enterobacteriaceae Bacteria; Pseudomonadota; Gammaproteobacteria; Enterobacterales. COMMENT REFSEQ: This record represents a single, non-redundant, protein sequence which may be annotated on many different RefSeq genomes from the…
RefSeq: WP_058844194
LOCUS WP_058844194 304 aa linear BCT 14-MAR-2021 DEFINITION diacylglycerol kinase [Lysinibacillus sp. F5]. ACCESSION WP_058844194 VERSION WP_058844194.1 KEYWORDS RefSeq. SOURCE Lysinibacillus sp. F5 ORGANISM Lysinibacillus sp. F5 Bacteria; Bacillota; Bacilli; Bacillales; Bacillaceae; Lysinibacillus. COMMENT REFSEQ: This record represents a single, non-redundant, protein sequence which may be annotated on many different…
RefSeq: WP_011445543
LOCUS WP_011445543 482 aa linear BCT 09-JAN-2021 DEFINITION glucose-6-phosphate dehydrogenase [Novosphingobium aromaticivorans]. ACCESSION WP_011445543 VERSION WP_011445543.1 KEYWORDS RefSeq. SOURCE Novosphingobium aromaticivorans ORGANISM Novosphingobium aromaticivorans Bacteria; Pseudomonadota; Alphaproteobacteria; Sphingomonadales; Sphingomonadaceae; Novosphingobium. COMMENT REFSEQ: This record represents a single, non-redundant, protein sequence which may be annotated on many different RefSeq genomes from…
Well-hidden methanogenesis in deep, organic-rich sediments of Guaymas Basin
Magnabosco C, Lin LH, Dong H, Bomberg M, Ghiorse W, Stan-Lotter H, et al. The biomass and biodiversity of the continental subsurface. Nat Geosci. 2018;11:707–17. Article CAS Google Scholar LaRowe DE, Amend JP. Catabolic rates, population sizes and doubling/replacement times of microorganisms in natural settings. Am J Sci. 2015;315:167–203. Article …
RefSeq: WP_045550181
LOCUS WP_045550181 285 aa linear BCT 02-JUN-2021 DEFINITION glutamate racemase [Nocardioides luteus]. ACCESSION WP_045550181 VERSION WP_045550181.1 KEYWORDS RefSeq. SOURCE Nocardioides luteus ORGANISM Nocardioides luteus Bacteria; Actinomycetota; Actinomycetes; Propionibacteriales; Nocardioidaceae; Nocardioides. COMMENT REFSEQ: This record represents a single, non-redundant, protein sequence which may be annotated on many different RefSeq genomes from…
RefSeq: WP_040025597
LOCUS WP_040025597 375 aa linear BCT 26-JUL-2021 DEFINITION PD-(D/E)XK nuclease family protein [Streptomyces sp. 150FB]. ACCESSION WP_040025597 VERSION WP_040025597.1 KEYWORDS RefSeq. SOURCE Streptomyces sp. 150FB ORGANISM Streptomyces sp. 150FB Bacteria; Actinomycetota; Actinomycetes; Kitasatosporales; Streptomycetaceae; Streptomyces. COMMENT REFSEQ: This record represents a single, non-redundant, protein sequence which may be annotated on…
SRA obtained metagenomic reads appears to corrupt
Hello, I am trying to run SingleM on data obtained using sratoolkit (2.10.7) I used prefetch SRR2103020 to download and fastq-dump –outdir ./fastq –split-e ./SRR2103020/SRR2103020.sra to split. when I check the file : head SRR2103020_1.fastq @SRR2103020.1 D7RS0RN1:177:C12Y0ACXX:3:1101:1404:2079 length=93 AATGTGGACAGCGCCGTCTTCAAACAGGCGCTGTCCAGCTAGCAGCTCAACGCTCCGCGCCGCCGTCTTCGCCGTCTTCAGGCAGGGGGAGAA +SRR2103020.1 D7RS0RN1:177:C12Y0ACXX:3:1101:1404:2079 length=93 @BCFFFDDHHHHHJJJGIJIBHHIJJCH?HBG<GIG@HEGIGFIFG@>CGHHHFFFDD@BB::BD@B??CDBDD@BD@DA@CCDDBD###### @SRR2103020.2 D7RS0RN1:177:C12Y0ACXX:3:1101:1440:2113 length=93 GGTATAAGTTCTATGTGTAATGAACCACAGAGTTATCAAAAAACTCAAGATCTGTCTCTTATACACATCTGACGCTGCCGACGAGCGATCTAG +SRR2103020.2 D7RS0RN1:177:C12Y0ACXX:3:1101:1440:2113 length=93…
Evolutionary genomics of camouflage innovation in the orchid mantis
Sample collection Captive breeding individuals of H. coronatus (Mantodea, Hymenopodidae) hatched from the same ootheca that was collected from the Xishuangbanna rainforest, Yunnan Province, China in 2018. Individuals of D. lobata (Mantodea, Deroplatyidae) were collected from a captive breeding center in Beijing, China in 2018. All individuals were housed in semitransparent…
Haplotype-resolved genomes of wild octoploid progenitors illuminate genomic diversifications from wild relatives to cultivated strawberry
Soltis, P. S. & Soltis, D. E. Polyploidy and Genome Evolution (Springer, 2012). Chen, J. Z. & Birchler, J. A. Polyploid and Hybrid Genomics (Wiley-Blackwell, 2013). Ye, C. Y. et al. The genomes of the allohexaploid Echinochloa crus-galli and its progenitors provide insights into polyploidization-driven adaptation. Mol. Plant 13, 1298–1310…
Introduction to Deep Learning – Part 5
Introduction to Deep Learning – Part 5 Introduction to Deep Learning – Part 5 In Introduction to Deep Learning – Part 4 of this series, we started to get our hands dirty in using PyTorch, a popular open source deep learning framework called PyTorch. In this article, we will continue…
A genome catalogue of lake bacterial diversity and its drivers at continental scale
Newton, R. J., Jones, S. E., Eiler, A., McMahon, K. D. & Bertilsson, S. A guide to the natural history of freshwater lake bacteria. Microbiol. Mol. Biol. Rev. 75, 14–49 (2011). Article CAS PubMed PubMed Central Google Scholar Pernthaler, J. Competition and niche separation of pelagic bacteria in freshwater habitats….
A predicted CRISPR-mediated symbiosis between uncultivated archaea
Garneau, J. E. et al. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468, 67 (2010). Article CAS PubMed Google Scholar Andersson, A. F. & Banfield, J. F. Virus population dynamics and acquired virus resistance in natural microbial communities. Science 320, 1047–1050 (2008). Article CAS PubMed Google…
Demystifying the AI Baum-Welch Algorithm: A Comprehensive Guide
Demystifying the AI Baum-Welch Algorithm: A Comprehensive Guide Artificial intelligence (AI) has come a long way since its inception, and with its rapid advancements, it has become an integral part of our daily lives. From virtual assistants like Siri and Alexa to recommendation engines on Netflix and Amazon, AI…
The Key to Unlocking Complex Sequential Data
Exploring AI Hidden Markov Models: The Key to Unlocking Complex Sequential Data Artificial Intelligence (AI) has been instrumental in transforming numerous sectors, from healthcare to finance, and continues to push the boundaries of what is possible. One of the key elements of AI that is making waves in the field…
The Game-Changer in Time Series Analysis and Prediction
Exploring AI Hidden Markov Models: The Game-Changer in Time Series Analysis and Prediction Artificial Intelligence (AI) has been making waves in various sectors, from healthcare to finance, and its influence in time series analysis and prediction is no exception. A specific AI model that has been a game-changer in this…
The Unseen Powerhouse Behind Cutting-Edge Technologies
Unveiling the Mystery: AI Hidden Markov Models and Their Role in Modern Technologies Artificial Intelligence (AI) has become an integral part of our daily lives, driving a plethora of modern technologies. However, the underlying mechanisms that power these technologies often remain hidden, shrouded in a veil of complexity. One such…
Bridging the Gap Between Theory and Practice
Unraveling the Mysteries of AI: The Forward-Backward Algorithm in Real-World Applications The world of artificial intelligence (AI) is a complex larinth of algorithms and computations, each with its unique purpose and functionality. Among these, the Forward-Backward Algorithm stands out as a critical tool in the realm of machine learning and…
Running hmmsearch against all fasta files in a directory
Running hmmsearch against all fasta files in a directory 0 I’m trying to run hmmsearch against a set of fasta files stored in a directory and save the results individually. I came up with the following python script: # extract fasta file names for input/output files Filename = [] for…
HMM gets zero or 1 hits when many more expected
HMM gets zero or 1 hits when many more expected 1 Hi all, My ultimate goal is to understand the phylogeny of a set of restriction-modification enzymes among certain genomes. For this, I have done the following: Downloaded all RM genes DNA sequences into psych_rm_genes.fna from REBASE Cleaned rebase file…
Essential Tools and Techniques for Data Scientists
Mastering AI Hidden Markov Models (HMMs) is a vital skill for data scientists, offering a robust framework for analyzing temporal data. This powerful statistical tool is used in a variety of applications, from speech recognition and natural language processing to bioinformatics and econometrics. As we delve into the world of…
Generation of CRB1 RP Patient-Derived iPSCs and a CRISPR/Cas9-Mediated Homology-Directed Repair Strategy for the CRB1 c.2480G>T Mutation
doi: 10.1007/978-3-031-27681-1_83. Affiliations Expand Affiliations 1 Department of Biomedical Engineering, Columbia University, New York, NY, USA. 2 Edward S. Harkness Eye Institute, Department of Ophthalmology, Columbia University Irving Medical Center/New York-Presbyterian Hospital, New York, NY, USA. 3 Jonas Children’s Vision Care, and Bernard & Shirlee Brown Glaucoma Laboratory, Department of…
The Silent Force Driving Innovation in Machine Learning
Unveiling the Power of AI Hidden Markov Models in Modern Machine Learning Artificial Intelligence (AI) has been making waves in the technological world, but one of its most influential yet underappreciated components is the Hidden Markov Model (HMM). This statistical model, which is used to represent systems that are…
Roving methyltransferases generate a mosaic epigenetic landscape and influence evolution in Bacteroides fragilis group
Isolate storage, growth, and identification Historical BFG isolates originally cultured from clinical material between 1973 and 2018 were stored either lyophilized or frozen in skim milk media at the National Institutes of Health Clinical Center Department of Laboratory Medicine (Bethesda, MD). Isolates were de-identified and metadata including year and source/site…
Atlantic water influx and sea-ice cover drive taxonomic and functional shifts in Arctic marine bacterial communities
Rantanen M, Karpechko AY, Lipponen A, Nordling K, Hyvärinen O, Ruosteenoja K, et al. The Arctic has warmed nearly four times faster than the globe since 1979. Commun Earth Environ. 2022;3:1–10. Article Google Scholar Kwok R. Arctic sea ice thickness, volume, and multiyear ice coverage: losses and coupled variability (1958–2018)….
Theory, Applications, and Best Practices
Unveiling the Intricacies of AI Hidden Markov Models: A Comprehensive Guide on Theory, Applications, and Best Practices Artificial Intelligence (AI) has become a transformative force in various industries, from healthcare to finance, and the technology behind it is continually evolving. One of the most intriguing and powerful tools in the…
Prediction of Ribosomal RNA Genes Using RNAmmer Software
Introduction Ribosomal RNA (rRNA) genes are known to be an integral part of ribosome synthesis machinery hence been studied extensively. Due to their repetitive nature, evolutionary converseness, and ubiquitous distribution /omnipresence, these genes are playing a key role in varying functions and mechanisms including maintenance of genome integrity, control of…
Accurate rare variant phasing of whole-genome and whole-exome sequencing data in the UK Biobank
Ethics statement This study relied on analyses of genetic data from the UKB cohort, which was collected with informed consent obtained from all participants. Data for this study were obtained under the UKB applications licence number 66995. All data used in this research are publicly available to registered researchers through…
Incongruence in the phylogenomics era
Simpson, G. G. The Principles of Classification and a Classification of Mammals Vol. 85 (American Museum of Natural History, 1945). Jarvis, E. D. et al. Whole-genome analyses resolve early branches in the tree of life of modern birds. Science 346, 1320–1331 (2014). Article CAS PubMed PubMed Central Google Scholar Parks,…
tacotron – Korea
The Tacotron 2 and WaveGlow model form a text-to-speech system that enables user to synthesise a natural sounding speech from raw transcripts without any …Tacotron (/täkōˌträn/): An end-to-end speech synthesis system by Google. Publications. (March 2017) Tacotron: Towards End-to-End Speech Synthesis.Tacotron 2 (without wavenet). PyTorch implementation of Natural TTS Synthesis By…
Understanding the Hidden Markov Model
Hidden Markov models (HMMs) were first introduced and explored in the early 1970s. They are named after the Russian mathematician Andrey Andreyevich Markov, who pioneered most of the related statistical theory. Since the late 1980s, they have been successfully used in analyzing biological sequences originating in speech recognition. Dynamic Bayesian…
Harnessing the Potential of the AI Baum-Welch Algorithm for Improved Predictions
Exploring the AI Baum-Welch Algorithm: Enhancing Predictive Capabilities for Future Applications In recent years, artificial intelligence (AI) has been making significant strides in various fields, from healthcare to finance, and from education to entertainment. One of the key factors contributing to this rapid progress is the development of sophisticated algorithms…
[Detailed Question] How to Normalize of Metagenomics Gene Abundances (with HMMs models)
Hi everyone, Me and my colleagues have been thinking about normalization for quite some time, and we have a hard time finding a consensus both within us, and within the literature, for this reason, this is going to be a long and detailed post. Talking with other researchers we feel…
How the AI Baum-Welch Algorithm is Transforming Data Analysis
Unveiling the Secrets of the AI Baum-Welch Algorithm: Revolutionizing Data Analysis The rapid advancements in artificial intelligence (AI) and machine learning have revolutionized various industries, including data analysis. Among the many AI algorithms that have been developed, the Baum-Welch algorithm stands out as a game-changer in the field of data…
A Vital Component in Modern Artificial Intelligence
The AI Baum-Welch Algorithm: A Vital Component in Modern Artificial Intelligence Artificial intelligence (AI) has come a long way since its inception, and one of the most vital components in modern AI is the Baum-Welch algorithm. This powerful tool is used in various applications, including speech recognition, natural language processing,…
A Comprehensive Guide for Researchers and Practitioners
Exploring the AI Baum-Welch Algorithm: A Comprehensive Guide for Researchers and Practitioners The AI Baum-Welch algorithm, named after its inventors Leonard E. Baum and Lloyd R. Welch, is a powerful statistical tool that has found widespread application in various fields, including natural language processing, speech recognition, and bioinformatics. This comprehensive…
A Comprehensive Review of its Applications and Limitations
Exploring the AI Baum-Welch Algorithm: A Comprehensive Review of its Applications and Limitations The AI Baum-Welch algorithm, a cornerstone of modern artificial intelligence, has been widely adopted across various industries and research fields. This powerful tool, which is a specific instance of the more general Expectation-Maximization (EM) algorithm, is used…
Applications of long-read sequencing to Mendelian genetics | Genome Medicine
Kingsmore SF, Cakici JA, Clark MM, Gaughran M, Feddock M, Batalov S, et al. A randomized, controlled trial of the analytic and diagnostic performance of singleton and trio, rapid genome and exome sequencing in ill infants. Am J Hum Genet. 2019;105(4):719–33. Article CAS PubMed PubMed Central Google Scholar Costain G,…
Culturing of a complex gut microbial community in mucin-hydrogel carriers reveals strain- and gene-associated spatial organization
Wang, Wei-Lin et al. Application of metagenomics in the human gut microbiome. World J. Gastroenterol. 21, 803–814 (2015). Article ADS PubMed PubMed Central Google Scholar Almeida, A. et al. A unified catalog of 204,938 reference genomes from the human gut microbiome. Nat. Biotechnol. 39, 105–114 (2021). Article CAS PubMed Google…
Inference and reconstruction of the heimdallarchaeial ancestry of eukaryotes
Eme, L., Spang, A., Lombard, J., Stairs, C. W. & Ettema, T. J. G. Archaea and the origin of eukaryotes. Nat. Rev. Microbiol. 15, 711–723 (2017). Article CAS PubMed Google Scholar Spang, A. et al. Complex archaea that bridge the gap between prokaryotes and eukaryotes. Nature 521, 173–179 (2015). Article …
A Crucial Tool for Bioinformatics and Genomics
Exploring the Baum-Welch Algorithm: Applications in Bioinformatics and Genomics The field of bioinformatics and genomics has experienced rapid growth in recent years, thanks to the advancements in technology and computational methods. As researchers continue to explore the depths of the human genome and the intricacies of biological systems, the need…
Staff scientist Bioinformatics – WUR
Your job Are you our new Staff Scientist Bioinformatics? We seek to hire an expert who is dedicated to implement, support, and develop bioinformatics strategies used in the breath of our research palette. The hiring of a permanent staff scientist in bioinformatics will ensure continued support to our research, and…
From Theory to Real-World Applications
The AI Baum-Welch Algorithm: From Theory to Real-World Applications The AI Baum-Welch algorithm, a powerful statistical tool, has been making waves in the world of artificial intelligence (AI) and machine learning. Developed by Leonard E. Baum and Lloyd R. Welch in the 1970s, this algorithm has been widely adopted in…
Metagenomic highlight contrasting elevational pattern of bacteria- and fungi-derived compound decompositions in forest soils
Bomble YJ, Lin CY, Amore A, Wei H, Holwerda EK, Ciesielski PN, Donohoe BS, Decker SR, Lynd LR, Himmel ME (2017) Lignocellulose deconstruction in the biosphere. Curr Opin Chem Biol 41:61–70. doi.org/10.1016/j.cbpa.2017.10.013 Article CAS PubMed Google Scholar Cardenas E, Kranabetter JM, Hope G, Maas KR, Hallam S, Mohn WW (2015)…
Accounting for 16S rRNA copy number prediction uncertainty and its implications in bacterial diversity analyses
Time-independent variation is present in 16S GCN evolution To evaluate the extent of time-independent or intraspecific variation in 16S GCN, we examined 5437 pairs of genomes with identical 16S rRNA gene alignments. The 16S GCN differs in 607 (11%) of them, suggesting the presence of significant time-independent variation. For the…
Genome-resolved carbon processing potential of tropical peat microbiomes from an oil palm plantation
Dargie, G. C. et al. Age, extent and carbon storage of the central Congo Basin peatland complex. Nature 542, 86–90 (2017). Article ADS CAS PubMed Google Scholar Page, S. E., Rieley, J. O. & Banks, C. J. Global and regional importance of the tropical peatland carbon pool. Global Change Biology…
Making Sense of Sequential Data
Unraveling the Mysteries of Hidden Markov Models: A Deep Dive into Sequential Data Analysis Hidden Markov Models (HMMs) have become an essential tool in the world of data analysis, particularly when it comes to analyzing sequential data. These models have been widely used in various fields, including finance, speech…
Unveiling the Most Likely Sequence in Hidden Markov Models
Exploring the Viterbi Algorithm: Decoding Hidden Markov Models for Optimal Sequence Prediction The Viterbi Algorithm, named after its inventor Andrew Viterbi, is a powerful tool for unveiling the most likely sequence of hidden states in a Hidden Markov Model (HMM). This dynamic programming algorithm has found numerous applications in…
Endogenous viral elements reveal associations between a non-retroviral RNA virus and symbiotic dinoflagellate genomes
Johnson, W. E. Endogenous retroviruses in the genomics era. Annu. Rev. Virol. 2, 135–159 (2015). Article CAS PubMed Google Scholar Johnson, W. E. Origins and evolutionary consequences of ancient endogenous retroviruses. Nat. Rev. Microbiol. 17, 355–370 (2019). Article CAS PubMed Google Scholar Johnson, W. E. Endless forms most viral. PLoS…
Distribution and diversity of ‘Tectomicrobia’, a deep-branching uncultivated bacterial lineage harboring rich producers of bioactive metabolites
Amann RI, Ludwig W, Schleifer KH. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev. 1995;59:143–69. CAS PubMed PubMed Central Google Scholar Konstantinidis K, Rosselló-Móra R, Amann R. Uncultivated microbes in need of their own taxonomy. ISME J. 2017;11:2399–406. PubMed PubMed Central Google Scholar Parks…
A compendium of bacterial and archaeal single-cell amplified genomes from oxygen deficient marine waters
Revsbech, N. P. et al. Determination of ultra-low oxygen concentrations in oxygen minimum zones by the STOX sensor. Limnol. Oceanogr.: Methods. 7, 371-381. (2009). Wright, J. J., Konwar, K. M. & Hallam, S. J. Microbial ecology of expanding oxygen minimum zones. Nat. Rev. Microbiol. 10, 381–394 (2012). Article CAS PubMed …
Prediction of protein subplastid localization and origin with PlastoGram
Data sets To create data sets of sequences corresponding to compartments of photosynthetic plastids, we searched the UniProt database for proteins annotated as localized in the chloroplast. Importantly, the UniProt keyword ’Chloroplast’ includes not only chloroplasts of green algae and land plants but also plastids of Rhodophyta, haptophytes and the…
Independent rediploidization masks shared whole genome duplication in the sturgeon-paddlefish ancestor
Mandáková, T. & Lysak, M. A. Post-polyploid diploidization and diversification through dysploid changes. Curr. Opin. Plant Biol. 42, 55–65 (2018). Article PubMed Google Scholar Blanc, G. & Wolfe, K. H. Widespread paleopolyploidy in model plant species inferred from age distributions of duplicate genes. Plant Cell 16, 1667–1678 (2004). Article CAS …
r – Plotting infercnv results
I’m working with matched single cell data, where we have treated and untreated samples for the same patient. I ran CNV analysis using the infercnv package. I’ve followed the tutorial: # data matrix counts_matrix <- scData@assays$RNA@counts meta = data.frame(labels = Idents(scData), row.names = names(Idents(scData))) unique(meta$labels) # check the cell labels…
Apoptotic gene loss in Cnidaria is associated with transition to parasitism
Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 35, 495–516 (2007). Article CAS PubMed PubMed Central Google Scholar Shi, Y. Caspase activation, inhibition, and reactivation: A mechanistic view. Protein Sci. 13, 1979–1987 (2004). Article CAS PubMed PubMed Central Google Scholar Alberts, B., Johnson, A. & Lewis, J….
Circular mitochondrial-encoded mRNAs are a distinct subpopulation of mitochondrial mRNA in Trypanosoma brucei
Some mitochondrial mRNA are circularized CircTAIL-seq is a technique used to Illumina sequence individual transcript PCR libraries of mitochondrial mRNA tails. The approach captures enough of each molecule’s 5′ and 3′ termini that the presence of editing can be confirmed if necessary17. Library preparation first requires circularizing total RNA with…
Error when converting hmmsearch output to gff file
Error when converting hmmsearch output to gff file 0 Hello, I’m trying to convert a hmmsearch output to gff format. For this, I ran the following: hmmsearch –domtblout dom_results.txt –cpu 10 hydrocarbon.hmm orfs_file.faai > demo.log After getting the dom_Results.txt table, I ran the hmmer2gff program from the mgkit program: hmmer2gff…
error when converting hmmer table to off table
Hello, I performed an alignment using hmmer hmmsearch tool using metagenomic contigs as a query and a hydrocarbon database (hydrocarbon.hmm file). I n first instance I first retrieved all ORFs from the contigs and translated them with esl-translate program as following: esl-translate -c 11 input_contigs.fa > translated_orfs.fa After getting the…
HMSS2: an advanced tool for the analysis of sulfur metabolism, including organosulfur compound transformation, in genome and metagenome assemblies
HMSS2: an advanced tool for the analysis of sulfur metabolism, including organosulfur compound transformation, in genome and metagenome assemblies Abstract The global sulfur cycle has implications for human health, climate change, biogeochemistry, and bioremediation. The organosulfur compounds that participate in this cycle not only represent a vast reservoir of sulfur,…
Sulfur cycling connects microbiomes and biogeochemistry in deep-sea hydrothermal plumes
Dick G, Anantharaman K, Baker B, Li M, Reed D, Sheik C. The microbiology of deep-sea hydrothermal vent plumes: ecological and biogeographic linkages to seafloor and water column habitats. Front Microbiol. 2013;4:124. Dick GJ. The microbiomes of deep-sea hydrothermal vents: distributed globally, shaped locally. Nat Rev Microbiol. 2019;17:271–83. Article CAS …
Trying to use hmmer to search genes over metagenome assembled genomes
Trying to use hmmer to search genes over metagenome assembled genomes 0 Hello I have a hmm file (my genes.hmm) that I want to use to search some genes over some MAGs that I elaborated. For this purpose I installed hmmer and tried to run hmmsearch as the following: First…
Long-Read Metagenomics and CAZyme Discovery
La Rosa SL, Ostrowski MP, Vera-Ponce de León A, McKee LS, Larsbrink J, Eijsink VG, Lowe EC, Martens EC, Pope PB (2022) Glycan processing in gut microbiomes. Curr Opin Microbiol 67:102143. doi.org/10.1016/j.mib.2022.102143 CrossRef CAS PubMed Google Scholar Warnecke F, Luginbuhl P, Ivanova N, Ghassemian M, Richardson TH, Stege JT, Cayouette…
Low SNP Overlap with Michigan 1KG and TopMed reference panel
I extracted three samples (HG02024 – HG02026) from the 1000 Genomes Project’s 30x alignment files, employing the Genome Analysis Toolkit (GATK) best practice pipeline. This process involved performing base quality score recalibration, identifying and removing duplicate reads, utilizing the HaplotypeCaller to generate a genomic VCF (gVCF) file, and calling variants…
HaplotypeCaller VCF depth is greater than the number of reads in bam
Hi, I call gvcf file using GATK HaplotypeCaller as following: gatk HaplotypeCaller -R my.fasta \ -I s-95.sort.noDup.bam \ -L 3R:23000000-27905053 \ -ERC GVCF \ -bamout test_s95.bamout.bam \ –native-pair-hmm-threads 28 \ -O test_s95.sort.noDup.g.vcf The above ouput gvcf reports a variant at 3R:25063300 3R 25063300 . C T,<NON_REF> 804.64 . BaseQRankSum=-2.060;DP=59;ExcessHet=3.0103;MLEAC=1,0;MLEAF=0.500,0.00;MQRankSum=0.000;RAW_MQandDP=212400,59;ReadPosRankSum=-1.269 GT:AD:DP:GQ:PGT:PID:PL:PS:SB…
Scan multiple sequences on multiple hmm profiles
Scan multiple sequences on multiple hmm profiles 1 I want to “align” multiple protein sequences in a multi-fasta file against thousand of hmm profiles (.hmm) that I’ve downloaded. I though on using hmmscan. Should I do that on each profile separately? Or is there a way to work on multiple…
A ubiquitous gammaproteobacterial clade dominates expression of sulfur oxidation genes across the mesopelagic ocean
Whitman, W. B., Coleman, D. C. & Wiebe, W. J. Prokaryotes: the unseen majority. Proc. Natl Acad. Sci. USA 95, 6578–6583 (1998). Article CAS PubMed PubMed Central Google Scholar Herndl, G. J. & Reinthaler, T. Microbial control of the dark end of the biological pump. Nat. Geosci. 6, 718–724 (2013)….
Mirusviruses link herpesviruses to giant viruses
Vincent, F., Sheyn, U., Porat, Z., Schatz, D. & Vardi, A. Visualizing active viral infection reveals diverse cell fates in synchronized algal bloom demise. Proc. Natl Acad. Sci. USA 118, e2021586118 (2021). Article CAS PubMed PubMed Central Google Scholar Suttle, C. A. Marine viruses — major players in the global…