Tag: HTSeq-count

The role of ATXR6 expression in modulating genome stability and transposable element repression in Arabidopsis

Significance The plant-specific H3K27me1 methyltransferases ATXR5 and ATXR6 play integral roles connecting epigenetic silencing with genomic stability. However, how H3K27me1 relates to these processes is poorly understood. In this study, we performed a comprehensive transcriptome analysis of tissue- and ploidy-specific expression in a hypomorphic atxr5/6 mutant and revealed that the…

Continue Reading The role of ATXR6 expression in modulating genome stability and transposable element repression in Arabidopsis

How to label columns in HTSeq output

How to label columns in HTSeq output 0 I’ve been working to process RNAseq data and I’ve used hisat2 to align my reads to the reference genome. When I take those output files and put them into HTSeq-count using the below code, I get a count matrix but the columns…

Continue Reading How to label columns in HTSeq output

htseq-count -t gene not working

I found a little problem. When I set the “-t gene”, the reads is mark “__no_feature”. But when I set the “-t exon”, the reads is mark “ENSG00000276104”. The gene “ENSG00000276104” is a single exon gene. I don’t know why this happens. reads: “TGTCTGTGGCGGTGGGATCCCGCGGCCGTGTTTTCCTGGTGGCCCGGCCGTGCCTGAGGTTTCTCCCCGAGCCGCCGCCTCTGCGGGCTCCCGGGTGCCCTTGCCCTCGCGGTCCCCGGCCCTCGCCCGTCTGTGCCCTCTTCCCCGCCCGCCGATCCTCTTCTTCCCCCCGAGCGGCTCACCGGCTTCACGTCCGTTGGTGGCCCCGCCTGGGAC”. I had aligned to hg38 by…

Continue Reading htseq-count -t gene not working

htseq-count python tutorial attribute counts error

Hello, I’m following the htseq-count tutorial for RNA-seq (counting the overlapping genes and exons) here htseq.readthedocs.io/en/master/tour.html. However, when I get to the point where I need to find the overlaps in the .sam file and .gtf file, I get an error. This is the code I ran originally that gave…

Continue Reading htseq-count python tutorial attribute counts error

htseq-count Error ‘_StepVector_Iterator_obj’ object has no attribute ‘next’

htseq-count Error ‘_StepVector_Iterator_obj’ object has no attribute ‘next’ 0 I am trying to run htseq-count (v. 0.13.5) on a sorted and indexed bam file. The command I entered looks like this: htseq-count -f bam -r pos -s yes -t CDS -i gene_id -m union filename_sorted.bam filename.gtf I get the following…

Continue Reading htseq-count Error ‘_StepVector_Iterator_obj’ object has no attribute ‘next’

HTSeq is a Python library to facilitate processing and analysis of data from high-throughput sequencing (HTS) experiments.

Hello, I’m following the htseq-count tutorial for RNA-seq (counting the overlapping genes and exons) here htseq.readthedocs.io/en/master/tour.html. However, when I get to the point where I need to find the overlaps in the .sam file and .gtf file, I get an error. This is the code I ran originally that gave…

Continue Reading HTSeq is a Python library to facilitate processing and analysis of data from high-throughput sequencing (HTS) experiments.

Running htseq-count to “grab” long non coding gene_id names

Running htseq-count to “grab” long non coding gene_id names 0 hi all, new to bioinformatics. so bare with me.. I am trying find long non coding RNA from RNA-seq data. As i checked the human gtf file there are 2 different types of long non coding RNA, “lnc_RNA” and “lncRNA”,…

Continue Reading Running htseq-count to “grab” long non coding gene_id names

gffread error

hello I am currently trying to do RNA-seq using public data in brassica juncea. To use htseq-count for making count table, I have to convert gff file which downloaded in brassica database to gtf file. So I used gffread for converting gff file with below command gffread Bju.genome.gff -T -o…

Continue Reading gffread error

HTseq doesn’t support Multi-Threading ?

HTseq doesn’t support Multi-Threading ? 1 Hello, everyone ! I’m looking for a way to use HTseq with multi-thread. I couldn’t find any options about multi-thread. Anybody knows how to, please ? (I know there are tools support multi-thread like STAR, HISAT2. but just wonder whether HTseq doesn’t support it.)…

Continue Reading HTseq doesn’t support Multi-Threading ?

Fastqc user manual – vodosp.ru

FASTQ format – Wikipedia 06 September 2021 – by TC Collin · 2020 · Cited by 3 — Be accompanied by a step-by-step user-friendly manual, If the user performs FastQC prior to the removal of adapters (step 3), the length Both programs can be used on Linux/MacOS X machines and quite…

Continue Reading Fastqc user manual – vodosp.ru

does not contain a ‘gene’ attribute

htseq-count returns : does not contain a ‘gene’ attribute 1 Dear BIOSTAR community, I’m trying to make count matrix with htseq-count, htseq-count -s yes -t gene -i gene 01.sorted.sam annotation_cattle.gff > 01.txt even with –idattr=gene , it returns error: Error processing GFF file (line 1864255 of file annotation_cattle.gff): Feature gene-D1Y31_gp1…

Continue Reading does not contain a ‘gene’ attribute

Mapping reads and quantifying genes

Mapping reads and quantifying genes – Metagenomic workshop 0 Hello, I am using the following metagenomic workshop tutorial to analyse my own metagenomic data. metagenomics-workshop.readthedocs.io/en/latest/annotation/quantification.html I performed the following steps: mapped reads with bowtie2 and generated .bam file with samtools sort. Removed duplicates with picard Extracted gene information from prokka…

Continue Reading Mapping reads and quantifying genes

Error creating DESeq2 Data Set from HTSeq-Count

I am trying to run DESeq2 using gene counts generated by HTSeq-Count. I combine files for different conditions: directory <- “~/GeneCountFiles/” WT_Files <- c( “P0CTRS3.aligned.sam.genecount”, “P0CTRS4.aligned.sam.genecount”, “P0CTRS5.aligned.sam.genecount” ) KO_Files <- c( “P0CTRS1.aligned.sam.genecount”, “P0CTRS2.aligned.sam.genecount”, “P0CTRS6.aligned.sam.genecount” ) I then create the sample table: sampleTable <- data.frame( sampleName=c(WT_Files, KO_Files), fileName=c(WT_Files, KO_Files), genotype=c(rep(“WT”, length(WT_Files)),…

Continue Reading Error creating DESeq2 Data Set from HTSeq-Count

how htseq-count counts unstranded RNA-seq data

how htseq-count counts unstranded RNA-seq data 1 preliminary Say I have some unstranded RNA-seq data and im mapping to the reference human genome using htseq-count (–stranded=no) My understanding (biologically) was that for a given protein_coding gene, reading DNA in the sense strand gives the protein_coding transcript, reading the gene in…

Continue Reading how htseq-count counts unstranded RNA-seq data

HTSeq-count TruSeq RNA Exome Lib Prep

HTSeq-count TruSeq RNA Exome Lib Prep 0 Hello, I observed a high percentage of “no features” while running HTseq w/ the –stranded yes option enabled (>80%). The library prep kit I am using is Illumina TruSeq RNA Exome which generates stranded data. If I run HTseq-count w/ strand == “no”…

Continue Reading HTSeq-count TruSeq RNA Exome Lib Prep

hisat2 compatibility for long read

hisat2 compatibility for long read 0 Hi, I am trying to align PacBio transcriptome reads against the genome to count the gene number. For pair end read i used the following workflow: # convert gff to gtf /home/software/cufflinks-2.2.1/gffread xxx.gff -T -o xxx.gtf # build index /home/software/hisat2-2.2.1/hisat2_extract_exons.py xxx.gtf > xxx.exon /home/software/hisat2-2.2.1/hisat2_extract_splice_sites.py…

Continue Reading hisat2 compatibility for long read