Tag: HTSeq-count

Significance The plant-specific H3K27me1 methyltransferases ATXR5 and ATXR6 play integral roles connecting epigenetic silencing with genomic stability. However, how H3K27me1 relates to these processes is poorly understood. In this study, we performed a comprehensive transcriptome analysis of tissue- and ploidy-specific expression in a hypomorphic atxr5/6 mutant and revealed that the…

How to label columns in HTSeq output 0 I’ve been working to process RNAseq data and I’ve used hisat2 to align my reads to the reference genome. When I take those output files and put them into HTSeq-count using the below code, I get a count matrix but the columns…

I found a little problem. When I set the “-t gene”, the reads is mark “__no_feature”. But when I set the “-t exon”, the reads is mark “ENSG00000276104”. The gene “ENSG00000276104” is a single exon gene. I don’t know why this happens. reads: “TGTCTGTGGCGGTGGGATCCCGCGGCCGTGTTTTCCTGGTGGCCCGGCCGTGCCTGAGGTTTCTCCCCGAGCCGCCGCCTCTGCGGGCTCCCGGGTGCCCTTGCCCTCGCGGTCCCCGGCCCTCGCCCGTCTGTGCCCTCTTCCCCGCCCGCCGATCCTCTTCTTCCCCCCGAGCGGCTCACCGGCTTCACGTCCGTTGGTGGCCCCGCCTGGGAC”. I had aligned to hg38 by…

Hello, I’m following the htseq-count tutorial for RNA-seq (counting the overlapping genes and exons) here htseq.readthedocs.io/en/master/tour.html. However, when I get to the point where I need to find the overlaps in the .sam file and .gtf file, I get an error. This is the code I ran originally that gave…

htseq-count Error ‘_StepVector_Iterator_obj’ object has no attribute ‘next’ 0 I am trying to run htseq-count (v. 0.13.5) on a sorted and indexed bam file. The command I entered looks like this: htseq-count -f bam -r pos -s yes -t CDS -i gene_id -m union filename_sorted.bam filename.gtf I get the following…

Hello, I’m following the htseq-count tutorial for RNA-seq (counting the overlapping genes and exons) here htseq.readthedocs.io/en/master/tour.html. However, when I get to the point where I need to find the overlaps in the .sam file and .gtf file, I get an error. This is the code I ran originally that gave…

Running htseq-count to “grab” long non coding gene_id names 0 hi all, new to bioinformatics. so bare with me.. I am trying find long non coding RNA from RNA-seq data. As i checked the human gtf file there are 2 different types of long non coding RNA, “lnc_RNA” and “lncRNA”,…

hello I am currently trying to do RNA-seq using public data in brassica juncea. To use htseq-count for making count table, I have to convert gff file which downloaded in brassica database to gtf file. So I used gffread for converting gff file with below command gffread Bju.genome.gff -T -o…

HTseq doesn’t support Multi-Threading ? 1 Hello, everyone ! I’m looking for a way to use HTseq with multi-thread. I couldn’t find any options about multi-thread. Anybody knows how to, please ? (I know there are tools support multi-thread like STAR, HISAT2. but just wonder whether HTseq doesn’t support it.)…

FASTQ format – Wikipedia 06 September 2021 – by TC Collin · 2020 · Cited by 3 — Be accompanied by a step-by-step user-friendly manual, If the user performs FastQC prior to the removal of adapters (step 3), the length Both programs can be used on Linux/MacOS X machines and quite…

htseq-count returns : does not contain a ‘gene’ attribute 1 Dear BIOSTAR community, I’m trying to make count matrix with htseq-count, htseq-count -s yes -t gene -i gene 01.sorted.sam annotation_cattle.gff > 01.txt even with –idattr=gene , it returns error: Error processing GFF file (line 1864255 of file annotation_cattle.gff): Feature gene-D1Y31_gp1…

Mapping reads and quantifying genes – Metagenomic workshop 0 Hello, I am using the following metagenomic workshop tutorial to analyse my own metagenomic data. metagenomics-workshop.readthedocs.io/en/latest/annotation/quantification.html I performed the following steps: mapped reads with bowtie2 and generated .bam file with samtools sort. Removed duplicates with picard Extracted gene information from prokka…

I am trying to run DESeq2 using gene counts generated by HTSeq-Count. I combine files for different conditions: directory <- “~/GeneCountFiles/” WT_Files <- c( “P0CTRS3.aligned.sam.genecount”, “P0CTRS4.aligned.sam.genecount”, “P0CTRS5.aligned.sam.genecount” ) KO_Files <- c( “P0CTRS1.aligned.sam.genecount”, “P0CTRS2.aligned.sam.genecount”, “P0CTRS6.aligned.sam.genecount” ) I then create the sample table: sampleTable <- data.frame( sampleName=c(WT_Files, KO_Files), fileName=c(WT_Files, KO_Files), genotype=c(rep(“WT”, length(WT_Files)),…

how htseq-count counts unstranded RNA-seq data 1 preliminary Say I have some unstranded RNA-seq data and im mapping to the reference human genome using htseq-count (–stranded=no) My understanding (biologically) was that for a given protein_coding gene, reading DNA in the sense strand gives the protein_coding transcript, reading the gene in…

HTSeq-count TruSeq RNA Exome Lib Prep 0 Hello, I observed a high percentage of “no features” while running HTseq w/ the –stranded yes option enabled (>80%). The library prep kit I am using is Illumina TruSeq RNA Exome which generates stranded data. If I run HTseq-count w/ strand == “no”…

hisat2 compatibility for long read 0 Hi, I am trying to align PacBio transcriptome reads against the genome to count the gene number. For pair end read i used the following workflow: # convert gff to gtf /home/software/cufflinks-2.2.1/gffread xxx.gff -T -o xxx.gtf # build index /home/software/hisat2-2.2.1/hisat2_extract_exons.py xxx.gtf > xxx.exon /home/software/hisat2-2.2.1/hisat2_extract_splice_sites.py…