Tag: HTseq

The Seibold Laboratory is a cutting-edge, NIH funded, laboratory focused on elucidating the pathobiological basis of asthma and other complex lung and allergic diseases. Our goal is to discover pathobiological subgroups of disease (termed disease endotypes) and the genetic, environmental, and immune factors driving their development. We are accomplishing these…

Counting intronic reads in bulk RNA-seq 0 My experience with single-cell RNA-seq shows that the inclusion of intronic reads improves the sensitivity for several genes of interest, which otherwise have zero expression when only exonic reads are considered. While single-cell sequencing quantifiers now often have options to count intronic reads,…

Hi all, I am working with the RNA-Seq data on human (24Cases-20 controls) to find differentially expressed genes. my RNA-Seq data is unstranded. Here is the comments that I used to align the fastq files: ls *_1P.fastq.gz | parallel –bar -j8 ‘R2=$(echo {} | sed s/_1/_2/) && out=$(echo {} |…

Introduction Carbon nanotubes (CNTs) are nano-sized one-dimensional tubular structures rolled by single (single-walled CNTs, SWCNTs) or multiple layers (multi-walled CNTs, MWCNTs) of graphene with unique electrochemical, mechanical and thermal properties, which render them as attracted engineered nanomaterials for various commercial applications.1–4 An increase in the production and utilization of CNTs…

No differentially expressed genes after multiple testing correction in mice 0 Hi all, I am working with the RNA-seq data on mice (group A N=3 vs group B N=3). Mice are littermates, of which group A overexpresses a human transgene which I verified. I have had .cram files from mouse…

htseq-count : dosen’t show options in bash ln ubuntu 1 foad@Linux:~/Example/Sam$ htseq-count -h usage: htseq-count [options] alignment_file gff_file This script takes one or more alignment files in SAM/BAM format and a feature file in GFF format and calculates for each feature the number of reads mapping to it. See htseq.readthedocs.io/en/master/count.html…

single exon quantification using RNA-seq 0 Hi, I have done the RNA-seq (mRNA) on gene knockout mice. I have evaluated the gene knockout from protein level. However, after RNA-seq data analysis, I didn’t see down-regulation of this gene. I used the pipeline Hisat2-HTseq to do the RNA-seq analysis. Technicholy, this…

Media The minimal marine media, MBL media, was used for serial dilution growth of Tritonibacter mobilis A3R06. It contained 10 mM NH4Cl, 10 mM Na2HPO4, 1 mM Na2SO4, 50 mM HEPES buffer (pH 8.2), NaCl (20 g/liter), MgCl2*6H2O (3 g/l), CaCl2*2H2O (0.15 g/l), and KCl (0.5 g/l). Glucose was added as the only carbon source at a…

problem with downloading htseq 0 hi, I want to download htseq from pypi.org/project/HTSeq/ but I face this error: ERROR: Could not install packages due to an OSError: HTTPSConnectionPool(host=”files.pythonhosted.org“, port=443): Max retries exceeded with url: /packages/a8/0f/04405b7fa4aab62adc7d7d12af3aaeb5015acffffdc0a03f372b7083c0fa/HTSeq- 2.0.2-cp310-cp310-manylinux_2_17_x86_64.manylinux2014_x86_64.whl (Caused by ReadTimeoutError(“HTTPSConnectionPool(host=”files.pythonhosted.org“, port=443): Read timed out. (read timeout=15)”)) I tried both “pip install…

HTSeq count stranded setting 0 Hello, In HTSeq’s manual for the stranded parameter, they state: “For stranded=no, a read is considered overlapping with a feature regardless of whether it is mapped to the same or the opposite strand as the feature. For stranded=yes and single-end reads, the read has to…

I have quality controlled paired end environmental transcriptomic data that I want to map against a reference database of 8 cyanobacterial genomes. I made this reference by joining together the fasta files of each genome. I performed this mapping with BWA v0.7.3a but noticed that when I tried to count…

B16 melanin(+) tdTomato cell line generation The generation and characterization of a lentivirus encoding tdTomato has been described previously22. The B16-D5-HER2 stable cell line was a generous gift from Louis Weiner (Georgetown University)13,23. Cell lines were cultured in DMEM Dulbecco’s modified Eagle’s medium (DMEM; Sigma) supplemented with 10% (v/v) fetal…

Mice Rosa26-YFP48, Rosa-tDTomato49, K14creER, Lgr5creER (ref. 50), KrasLSLG12D (ref. 51) and Trp53fl/fl (ref. 52) mice were obtained from the NCI mouse repository and Jackson Laboratories. Rhojfl/fl mice53 were a gift from A. Uemura. All mice used in this study were composed of males and females with mixed genetic background. Mouse…

Fungi, ain’t a kingdom most of us will know much about. The only thing I can guess at is that in bacteria there has resurgence in methods for de novo assembly specifically aimed at reducing the total number of contigs in an assembly. The ‘new wave’ is summarised in this…

BULK mRNA-seq with UMIs. Does it make sense to run bedtools genomecov? 0 Hi, I am using BULK rna-seq which includes UMI added after cDNA fragmentation, before PCR amplification (see my previous post BULK mRNA-seq with UMIs. Do I need to normalize by gene length? ). I am trying to…

Weird looking dispersion & MA plot? 0 I have 99 samples (96 treated, 3 untreated cells) subjected to bulk RNA seq. All the Fastqc parameters look fine + the sequencing depth is pretty similar across all samples. I generated gene counts for all of them with htseq and ran DeSeq2…

Stringtie does not work with NCBI GTF file? 1 Hi all, I wanted to rerun my DGE analysis to see if there were any differences between HTseq-count -> edgeR and StringTie-Ballgown. However, when I tried to run my stringtie command using the same BAM file, I got an error: “Error:…

Calculating RPKM for DESeq 1 Hi friends DESeq works via count table and create DE genes by count fold change, but it’s better to know about gene RPKM values. Is there any possible way to use / show RPKM for DESeq’s output? And how can i normalized those RPKM values?…

HTseq no features 0 I have got some problem when analyzing my RNAseq data and I would like to seek for a help. Here is the brief description of my pipeline: Obtained fasta file of 150 PE reads from Novaseq platform followed by non-stranded library prep I conducted fastQC and…

Inagaki, F., Takai, K., Kobayashi, H., Nealson, K. H. & Horikoshi, K. Sulfurimonas autotrophica gen. nov., sp. nov., a novel sulfur-oxidizing e-proteobacterium isolated from hydrothermal sediments in the Mid-Okinawa Trough. Int. J. Syst. Evol. Microbiol. 53, 1801–1805 (2003). Article  CAS  PubMed  Google Scholar  Timmer-Ten Hoor, A. A new type of…

BS1_Pdp1_0-1.5.+.bw   50.00b   October 14 2022 at 00:06 BS1_Pdp1_0-1.5.-.bw   50.00b   October 14 2022 at 00:06 BS1_Pdp1_0-1.5.bam   49.00b   October 14 2022 at 00:06 BS1_Pdp1_0-1.5.bw   48.00b   October 14 2022 at 00:06 BS1_Pdp1_0-1.5.htseq-count   57.00b   October 14 2022 at 00:06 BS1_Pdp1_14-16.+.bw   50.00b   October 14 2022 at 00:06 BS1_Pdp1_14-16.-.bw   50.00b   October 14 2022 at 00:06 BS1_Pdp1_14-16.bam…

BS1_Blimp-1_kay_mCherry_0-1.5.+.bw   65.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_0-1.5.-.bw   65.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_0-1.5.bam   64.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_0-1.5.bw   63.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_0-1.5.htseq-count   72.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_10-12.+.bw   65.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_10-12.-.bw   65.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_10-12.bam…

BS1_Fer1_Camta_CG10209_mCherry_0-1.5.+.bw   79.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_0-1.5.-.bw   79.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_0-1.5.bam   78.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_0-1.5.bw   77.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_0-1.5.htseq-count   86.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_12-14.+.bw   79.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_12-14.-.bw   79.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_12-14.bam…

BS1_Fer1_0-1.5.+.bw   57.00b   October 14 2022 at 00:06 BS1_Fer1_0-1.5.-.bw   57.00b   October 14 2022 at 00:06 BS1_Fer1_0-1.5.bam   56.00b   October 14 2022 at 00:06 BS1_Fer1_0-1.5.bw   55.00b   October 14 2022 at 00:06 BS1_Fer1_0-1.5.htseq-count   64.00b   October 14 2022 at 00:06 BS1_Fer1_12-14.+.bw   57.00b   October 14 2022 at 00:06 BS1_Fer1_12-14.-.bw   57.00b   October 14 2022 at 00:06 BS1_Fer1_12-14.bam…

BS1_Ets65A_CG32006_mCherry_0-1.5.+.bw   71.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_0-1.5.-.bw   71.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_0-1.5.bam   70.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_0-1.5.bw   69.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_0-1.5.htseq-count   78.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_12-14.+.bw   71.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_12-14.-.bw   71.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_12-14.bam…

BS1_Sox15_0-1.5.+.bw   50.00b   October 14 2022 at 00:06 BS1_Sox15_0-1.5.-.bw   50.00b   October 14 2022 at 00:06 BS1_Sox15_0-1.5.bam   49.00b   October 14 2022 at 00:06 BS1_Sox15_0-1.5.bw   48.00b   October 14 2022 at 00:06 BS1_Sox15_0-1.5.htseq-count   57.00b   October 14 2022 at 00:06 BS1_Sox15_10-12.+.bw   50.00b   October 14 2022 at 00:06 BS1_Sox15_10-12.-.bw   50.00b   October 14 2022 at 00:06 BS1_Sox15_10-12.bam…

Hi all, I’m trying to create a conda environment through a .yml file that has all the required dependencies for a certain project but I run into environment conflicts. I figured out the source of this conflict, which stems from two specific dependencies, but for some reason, creating an environment…

Ethics statement and animals All animals and experimental protocols used in this study were approved by the Beijing Institute of Animal Science, Chinese Academy of Agricultural Sciences (the scientific research department responsible for animal welfare issues) (No.: IASCAAS-AE20140615). In this study, experimental chickens (JXH) were selected on H/L, with the…

[E::idx_find_and_load] warning in htseq-count 0 I am running the htseq-count but get the [E::idx_find_and_load] warning. The bam files were sorted with name but without index. It is not required for index when running htseq-count, correct? *CODE: htseq-count -f bam \ -s no \ -t exon \ -m union \ -i…

Warning: Mate records missing HTSEQ 0 Hello everyone, At the end of the quantification with HTSEQ I get this warning, why is it? is it a serious problem? enrique@DE:~/analisis_maiz/quantificacion$ htseq-count -f bam ../alignements/SRR214880_sorted.bam -s no -i gene_id -r pos -t exon ../genome_anotacion/Zea_mays.Zm-B73-REFERENCE-NAM -5.0.55\ \(1\).gtf > SRR214880.txt Final: Warning: Mate records…

warning message after HTSeq 0 I have analyzed RNA-seq data with HTSeq. My command that I used is python -m HTSeq.scripts.count -f bam -r pos -s reverse -t ORF -i group -m union input.bam my.gff > output.txt Warning message is Warning: Mate records missing for 3752 records; first such record:…

Hi, I’ve been passed down some bam files from RNA-seq that I need to analyze. They were generated with pseudoalignments using Kallisto ( pachterlab.github.io/kallisto/about ) When I run htseq-count one specific bamfile crashes on a specific read: Error occured when processing input (record #149548485 in file 103805-016-011.kallisto.pseudoalignments.bam): Expected str, got…

Introduction Breast cancer is the most prevalent malignancy and the leading cause of cancer death in women worldwide.1 After its diagnosis, the most immediate challenge is to tailor treatment strategies and predict the prognosis; traditional clinicopathologic features, including estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2…

HTSeq error processing GFF file 0 Hello, I am trying to run HTSeq but it tells me that I have a problem in my GFF and GTF file, how can I fix this? enrique@L:~prueba_guess$ htseq-count -f bam SRR214880.bam -s no -i ID -r pos -t exon GCF_902167145.1_Zm-B73-REFERENCE-NAM-5.0_genomic.gff > SRR214880.txt 100000…

TCGAbiolinks HT-Seq count 0 Hi everyone! For legacy = F data, the workflow_type = HTSeq counts is still working? This is my code and it fails: query <- GDCquery(project = “TCGA-BRCA”, legacy = FALSE, data.category = “Transcriptome Profiling”, data.type = “Gene Expression Quantification”, workflow.type=”HTSeq – Counts”, sample.type = “Primary Tumor”)…

Animals As female mice/rats resist to HFD-induced obesity and NAFLD, male mice/rats were used to induce obesity and NAFLD model by HFD50. Male Wistar (~180 g body weight; 8 weeks old) rats were purchased from Shandong Laboratory Animal Center with the permission number of SCXK 2014–0007 and raised under thermoneutral housing…

Introduction Lymphoma, a cancer characterized by a malignant tumor of the immune system that originates in the lymph nodes or lymphoid tissue, is one of the most common cancers worldwide. According to GLOBOCAN, the incidence of non-Hodgkin lymphoma (NHL) in both males and females ranked top ten among all cancers…

Hi, I am analyzed some BULK mRNA-seq data that included UMIs during the sequencing. I don’t have much experience analyzing bulk RNA-seq, and it is my first time dealing with UMIs there. I have more experience in single-cell RNA-seq, and I thought that the concept of UMIs will translate directly…

Error using HTSEq_count 0 Hello, I am trying to use HTSeq_count but when I run the command I get the following error: > Traceback (most recent call last): File “/usr/local/bin/htseq-count”, line 5, in <module> HTSeq.scripts.count.main() File “/usr/local/lib/python3.7/site-packages/HTSeq/scripts/count.py”, line 473, in main args = _parse_sanitize_cmdline_arguments() File “/usr/local/lib/python3.7/site-packages/HTSeq/scripts/count.py”, line 465, in _parse_sanitize_cmdline_arguments…

I am using HTseq pipeline for DESeq2: Directory = “/Users/abhaykanodia/Desktop/smallRNA/” condition = c(“WT1”, “WT2”, “WT3”, “NTC1”, “NTC2”, “NTC3) sampleFiles= c(“AK1a_counts.txt”,”AK2a_counts.txt”,”AK3a_counts.txt”,” AK4a_counts.txt”,”AK5a_counts.txt”,”AK6a_counts.txt”) sampleName = c(“AK1”, “AK2”, “AK3”, “AK4”, “AK5”, “AK6”) sampleTable <- data.frame(sampleName = sampleName, fileName = sampleFiles, condition = condition) sampleTable The output is: sampleName fileName condition 1 AK1 AK1a_counts.txt…

Cell isolation, reprogramming and culture Approval was obtained for human cell and tissue sample collection and genetic reprogramming from the Institutional Review Board (protocols 19–252, 18–243, 21–060, 19–284 and 415-E/1776/4-2014, Ethics Committee of the province of Salzburg). Adult samples were collected in accordance with the Declaration of Helsinki after written…

smallRNA profiling using HTSeq error 1 Hello, I want to create a “count” file using HTseq. I have both BAM file and gtf file: htseq-count -f bam -s no -i AK1a_clean_Aligned.sortedByCoord.out.bam gencode.v42.chr_patch_hapl_scaff.annotation.gtf >> AK1a_counts.txt It still gives an error: htseq-count: error: the following arguments are required: featuresfilename Can someone please…

The incidence of lung adenocarcinoma (LUAD), the most common subtype of lung cancer, continues to make lung cancer the largest cause of cancer-related deaths worldwide. Long noncoding RNAs (lncRNAs) have been shown to have a significant role in both the onset and progression of lung cancer. In this study, we…

HISAT2 and HTSEQ command 0 @4fedfa78 Last seen 10 hours ago Japan Hello, For analysis of the data by rna-sequencing I selected HISAT2 and HTSeq-count for mapping and counting the genes levels, the libraryLayout is paired, I am using the below command for both but the results are not exact…

Hi everyone- I am trying to write a script to automate htseq-count on a large number of samples. The script runs but then throws the following error: “Please provide 2 arguments”. Does anyone see something obvious I am missing: #!/bin/bash for samples in *.sam do gtf = “Galaxy135-\[Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.29.gtf\].gtf” echo $sample …

Newest ‘htseq’ Questions – Bioinformatics Stack Exchange …

Dear Experts, I have RNAseq data from 6 different plant samples (2 control, 2 Sensitive, and 2 tolerance), and different location of one species. I am trying to see the effect of the different groups at different time points, but after going through all the posts and vignettes I am…

Dear all We are recently working with E.coli plasmid and tried to summarize the gene counts from our RNA-Seq samples. The short reads were mapped to E.coli plasmid using tophat which generated bam files accordingly. However, we were unable to obtain a gff3 version of our target plasmid genome, the…

. 2022 Apr;24(4):590-600. doi: 10.1038/s41556-022-00870-7. Epub 2022 Apr 12. Lucie Y Guo #  1   2 , Jing Bian #  3 , Alexander E Davis  4 , Pingting Liu  4 , Hannah R Kempton  3 , Xiaowei Zhang  3 , Augustine Chemparathy  3 , Baokun Gu  3 , Xueqiu Lin  3 , Draven A Rane  3 , Xiaoshu Xu  3 , Ryan M…

HTseq-Count: Long processing time 1 Hi everyone, I’m processing BAM files using htseq-count and it takes very long time to produce the counts for each file. It is about pair-end reads (around 50 million sequence each). It takes 75 minutes to count this pair; is that normal? Thanks. htseq-count –max-reads-in-buffer=24000000000…

Can I convert HTSeq count into RPKM or TPM value or standard unit of RNA-Seq 0 Now, I’m comparing RNA expressions that have RNA-Seq and HTSeq count How can I interpret it together with different unit or Can I convert HTSeq count equivalent RNA-Seq? or if you have other suggestions,…

HTSeq Counts no longer available 1 @vm-21340 Last seen 8 hours ago Brazil I’m working with breast cancer expression data from the TCGA-BRCA project. All my scripts were written to retrieve HTSeq counts from GDC, but they seem to have been removed from the GDC Data Portal. When using GDCquery,…

Background: The application of RNA-seq technology has become more extensive and the number of analysis procedures available has increased over the past years. Selecting an appropriate workflow has become an important issue for researchers in the field. Methods: In our study, six popular analytical procedures/pipeline were compared using four RNA-seq…

htseq-count error 1 Hi, htseq-count -f bam -s yes ~/htseq-trial/SRR13826419_Aligned.sortedByName.out.bam ~refgen/gencode.v39.primary_assembly.annotation.gtf > counts.txt I am trying to run htseq-count with command above but in the err file [E::idx_find_and_load] Could not retrieve index file for ‘~/htseq-trial/SRR13826419_Aligned.sortedByName.out.bam’ 100000 GFF lines processed. 200000 GFF lines processed. 300000 GFF lines processed. 400000 GFF lines…

Feature count is very low using htseq-count 0 Hello all, I performed bbmap on my RNA-seq paired sequence data using following cmd bbmap.sh in1=J2_R1.fastq in2=J2_R2.fastq out=output_J2.sam ref=im4.fasta nodisk The header of generated sam file is @HD VN:1.4 SO:unsorted @SQ SN:k141_1006 LN:2503 @SQ SN:k141_5512 LN:5393 @SQ SN:k141_4772 LN:4387 @SQ SN:k141_3267 LN:4531…

Hello! I am trying to annotate a miRNA-seq so that it gives me mature miRNAs where I already have 5p and 3p. For this, I have used the index mm10.fa and the miRBase mmu.gff3. I have aligned with HISAT2 and am trying to count with HTSeq, however I get 0…

RNA Seq HTSeq download GDC portal 0 Hi friends, I am trying to download ht-seq file form GDC portal but it gives me one file for each patinets. Can you please let me know how to download one file including all patients together for all 60000 genes? Is there any…

TCGA Data download in terms of ease of use ,RTCGA The bag should be better , And because it’s already downloaded data , The use is relatively stable . But also because of the downloaded data , There is no guarantee that the data is new .TCGAbiolinks The package is…

Using a Mac with M1 chip, I’m trying to install the following Bioconda packages: cutadapttrim-galoresamtoolsbedtools.htseq.bowtie2.deeptools.macs2 I’ve been able to install picard and fastqc with no issues, but all others turn out one of two error messages: PackagesNotFoundError: The following packages are not available from current channels: or Found conflicts! Looking…

RNA-Seq HTseq galaxy DE analysis 0 Hi friends I have htseq data from TCGA. it contains patients name in first row and genes in first column : 200 columns and 20000 rows. I dont want deseq2 in R. this needs to be done in galaxy. my question is how to…

Significance The plant-specific H3K27me1 methyltransferases ATXR5 and ATXR6 play integral roles connecting epigenetic silencing with genomic stability. However, how H3K27me1 relates to these processes is poorly understood. In this study, we performed a comprehensive transcriptome analysis of tissue- and ploidy-specific expression in a hypomorphic atxr5/6 mutant and revealed that the…

downloading RNA seq data 0 Hi friends I am using the following code to get the data from TCGA. I want to have only one allocate of each person then I will have unique patients ID. Is there any line of code that I should add to this to get…

How to label columns in HTSeq output 0 I’ve been working to process RNAseq data and I’ve used hisat2 to align my reads to the reference genome. When I take those output files and put them into HTSeq-count using the below code, I get a count matrix but the columns…

I found a little problem. When I set the “-t gene”, the reads is mark “__no_feature”. But when I set the “-t exon”, the reads is mark “ENSG00000276104”. The gene “ENSG00000276104” is a single exon gene. I don’t know why this happens. reads: “TGTCTGTGGCGGTGGGATCCCGCGGCCGTGTTTTCCTGGTGGCCCGGCCGTGCCTGAGGTTTCTCCCCGAGCCGCCGCCTCTGCGGGCTCCCGGGTGCCCTTGCCCTCGCGGTCCCCGGCCCTCGCCCGTCTGTGCCCTCTTCCCCGCCCGCCGATCCTCTTCTTCCCCCCGAGCGGCTCACCGGCTTCACGTCCGTTGGTGGCCCCGCCTGGGAC”. I had aligned to hg38 by…

Hello, I’m following the htseq-count tutorial for RNA-seq (counting the overlapping genes and exons) here htseq.readthedocs.io/en/master/tour.html. However, when I get to the point where I need to find the overlaps in the .sam file and .gtf file, I get an error. This is the code I ran originally that gave…

htseq-count Error ‘_StepVector_Iterator_obj’ object has no attribute ‘next’ 0 I am trying to run htseq-count (v. 0.13.5) on a sorted and indexed bam file. The command I entered looks like this: htseq-count -f bam -r pos -s yes -t CDS -i gene_id -m union filename_sorted.bam filename.gtf I get the following…

Hello, I’m following the htseq-count tutorial for RNA-seq (counting the overlapping genes and exons) here htseq.readthedocs.io/en/master/tour.html. However, when I get to the point where I need to find the overlaps in the .sam file and .gtf file, I get an error. This is the code I ran originally that gave…

About outliers and non -separated samples in PCA 0 Hi all, I have plotted PCA for my samples(Tumor and Normal) in some cancer types. I have used the HTSeq-counts data from TCGA. Then I’ve normalized them by DESeq2 and the total normalized counts are in cnt dataframe. Head of cnt:…

Summary: HTSeq 2.0 provides a more extensive API including a new representation for sparse genomic data, enhancements in htseq-count to suit single cell omics, a new script for data using cell and molecular barcodes, improved documentation, testing and deployment, bug fixes, and Python 3 support. Availability and implementation: HTSeq 2.0…

This seems to be frequently asked question, so here is a robust method to fully recapitulate the counts given by TCGA and port it to DESeq2. Why the long way? Tanya and I noticed via TCGA-Biolinks and Firehose did not generate the full count matrix. ~5-10% of genes were missing…

Error “start too small” when running htseq-count on a sorted .bam file 0 Hello, This is my first time aligning scRNA-seq reads to a reference genome to analyze differential gene expression. I am using htseq-count to obtain count files for my different samples and I am receiving the following error:…

Getting errors trying to run rmats 1 Hi, I am trying to use rmats for splice variation analysis through ssh using slurm after loading rmats module, these are commands that I tried and errors they produced rmats –s1 $PWD/control.txt –s2 $PWD/pdac.txt –gtf mm10/mm10.refGene.gtf Python programming language version 3.6.8 loaded. GNU…

arXivLabs is a framework that allows collaborators to develop and share new arXiv features directly on our website. Both individuals and organizations that work with arXivLabs have embraced and accepted our values of openness, community, excellence, and user data privacy. arXiv is committed to these values and only works with…

Tutorial:Extract Total Non-Overlapping Exon Length Per Gene With Bioconductor 3 Hi all, It took me a while to figure this out so I thought it might be useful to a few other people. When you have used htseq-count on each of your RNA-seq’ed samples and have combined all of your…

.sam file was generated by following code samtools sort -n Untreated-3/accepted_hits.bam > Untreated-3_sn.bam samtools view -o Untreated-3_sn.sam Untreated-3_sn.bam samtools sort Untreated-3/accepted_hits.bam > Untreated-3_s.bam samtools index Untreated-3_s.bam .gtf file was downloaded by: wget ftp.ensembl.org/pub/release-70/gtf/drosophila_melanogaster/Drosophila_melanogaster.BDGP5.70.gtf.gz gunzip Drosophila_melanogaster.BDGP5.70.gtf.gz when I use htseq-count: htseq-count -s no -a 10 Untreated-3_sn.sam Drosophila_melanogaster.BDGP5.70.gtf > Untreated-3.count an error…

HTSeq-count error: Exception type: ValueError, raised in libcalignmentfile.pyx:990 0 .sam file was generated by following code samtools sort -n Untreated-3/accepted_hits.bam > Untreated-3_sn.bam samtools view -o Untreated-3_sn.sam Untreated-3_sn.bam samtools sort Untreated-3/accepted_hits.bam > Untreated-3_s.bam samtools index Untreated-3_s.bam .gtf file was downloaded by: wget ftp.ensembl.org/pub/release-70/gtf/drosophila_melanogaster/Drosophila_melanogaster.BDGP5.70.gtf.gz gunzip Drosophila_melanogaster.BDGP5.70.gtf.gz when I use htseq-count: htseq-count -s…

How to define the gene length for RPKM calculation 4 Hi guys, I would like to calculate the RPKM of my RNA seq experiment. To do this, as from the formula, I need to know the gene length. My starting point are the row reads (single end) counts resulting from:…

How to use htseq-count with several samples ? 1 Does anyone know how to use htseq-count with several samples ? We can use htseq-count like : htseq-count sample1.sam reference.gtf > result.count.txt We can get sample1’s count data by above command. But, it is usual that we have more than two…

Hi all, I have raw counts of samples in a dataframe. The row names is Ensembl ID and I want to convert them to a gene symbol. So I’ve run the code below. query <- GDCquery(project = “TCGA-COAD” , data.category = “Transcriptome Profiling” , data.type = “Gene Expression Quantification”, workflow.type…

Bioinformatics Scientist Full Time Prof-Entry Bethesda, MD, US DAWSON is a Native Hawaiian Organization 8(a) small business that brings the Spirit of Aloha to our employees. As part of the DAWSON “Ohana”, you will be provided a best-in-class benefits program that strives to ensure our great people have peace of…

Finding counts of lncRNAs with htseq-count /featurecounts 0 Hi, I’m trying to find the counts of novel and known lncRNA transcripts in humans and I have a GTF file already of these transcripts. However, I’m unsure about the following: should the input GTF file for HTSeq count or featurecounts be…

How to convert HTSeq raw read counts to FPKMs? 0 Hi, I have a C.elegans RNAseq raw read counts which I generated from HTSeq. I want to convert them to FPKM values. I used “countToFPKM” to do that, but I am not able to get “Biomart.annotations.hg38.txt” file for C.elegans. Is…

Converting Ensembl gene id to Gene symbol 0 Hi all, As mentioned earlier in this post, I tried to convert the Ensembl gene ids to the Gene symbol. I didn’t receive any error by the code below but the nrow of ens_to_symbol_biomart is 55605 and the length of ens is…

doi: 10.1007/978-1-0716-1851-6_10. Affiliations Expand Affiliations 1 European Molecular Biology Laboratory (EMBL), Heidelberg, Germany. 2 European Molecular Biology Laboratory (EMBL), Heidelberg, Germany. schwarzl@embl.de. Item in Clipboard Sudeep Sahadevan et al. Methods Mol Biol. 2022. Show details Display options Display options Format AbstractPubMedPMID doi: 10.1007/978-1-0716-1851-6_10. Affiliations 1 European Molecular Biology Laboratory (EMBL), Heidelberg,…

Box plot for rna seq data 1 Hi friends I plotted this box-wisker for TCGA HTSeq data in R. I want to have harf of them as red and half as blue (control vs treatment groups). or is there any better way for boxplot? How can I do that? I…

Low assigned alignments 0 Basecalls performed using CASAVA version v1.8.2 Trimmed reads with fastx_quality_trimmer 0.0.13 with a quality treshhold of 18 and a length of 20 Aligned with Bowtie 2.1.0 and Tophat 2.0.10 using Gencode v19 junctions Samtools 0.1.19-44428cd to make a bam, sort, index Raw counts were generated using…

Company Description Dawson is a Staffing & Recruiting agency that was founded in 1946 and headquartered in Columbus, OH. They have the vision to help the small as well as large corporations and businesses to recruit the talent that can help them to provide the best customer service with exceptional…

Introduction Primary liver cancer, including hepatocellular carcinoma (HCC) and intrahepatic cholangiocarcinoma, is the sixth most commonly diagnosed cancer and the fourth leading cause of cancer-related deaths worldwide.1 High metastasis and recurrence rates, as well as limited treatment options, lead to the poor prognosis of advanced HCC.2 Among patients diagnosed with…

DEXSeq prepare annotation script throws “object has no attribute ‘next’” for Ensemble GTFs 0 @24764cda Last seen 23 hours ago United States Hi there, I am trying to run the dexseq_prepare_annotation.py script and the code keeps failing after parsing the first line of the gtf. Specifically, the code is failing…

Hello! First of all, thank you for the great package and the excellent documentation that supports it, much appreciated! Sadly, I could not find an answer to my problem, so I wanted to ask here. I have two different bulk RNA-seq datasets, one obtained from TCGA using the TCGAbiolinks package,…

HTSeq – Extracting exon level read coverage of a specific gene 1 Dear all, I am trying to quantify RNASeq reads at the “exon level” using HTSeq. To achieve a quantitative exon comparison. I am using ENCODE mouse data which is Illumina reads alligned to GENCODE M27 (GRCm39) using STAR…

DESeq2: All samples have 0 counts for all genes. check the counting script 1 @2f3f6904 Last seen 1 hour ago United Kingdom I am having problems importing my HTSeq count data- it tells me the counts are zero when this is clearly not the case when head outputs: >head(WTCHG_862660_71955267) GeneID…

Hi Everyone, I am working with a publicly available RNA-Seq dataset for which only the HTSeq-count data is accessible. I have done differential gene expression already (i.e. between sample analysis) however I am also hoping to obtain TPM count for within-sample analysis such as single-sample GSEA and for this I…

Using HTSeq-count for paired-end data but unsorted by SAMTOOLS 1 Hi there, as per thread title. If I am using HTSeq-count on paired-end mapped BAM files, but they are unsorted, and I use -s yes on the default option, is it advisable? htseq ngs • 99 views Paired-end .bam need…

How can I convert ensembl exon ID to gene symbol in a gene count dataframe? 1 I have an HTseq count file with a row containing exon ids and columns are exon counts. I need to convert them into gene IDs, given the fact that multiple exon ids may be…

How can I convert ensemble exon ID to gene symbol in a gene count dataframe? 0 I have an HTseq count file with a row containing exon ids and columns are exon counts. I need to convert them into gene IDs, given the fact that multiple exon ids may be…

GitHub – bioinformatics-ca/HTG_2021: CBW’s High Throughput Genomics Analysis 2021 Files Permalink Failed to load latest commit information. Type Name Latest commit message Commit time workshop content for HTseq 2021 About CBW’s High Throughput Genomics Analysis 2021 Resources You can’t perform that action at this time. You signed in with another…

I have a project where I have done RNA-seq (paired-end sequencing on Illumina HiSeq) of a worm at different days of development i.e. Ages 0-12. For each age, I have sequenced 3 replicate specimens. I’m new to DESeq2 and I was wondering if what I did below is correct. library(DESeq2)…

Running htseq-count to “grab” long non coding gene_id names 0 hi all, new to bioinformatics. so bare with me.. I am trying find long non coding RNA from RNA-seq data. As i checked the human gtf file there are 2 different types of long non coding RNA, “lnc_RNA” and “lncRNA”,…

hello I am currently trying to do RNA-seq using public data in brassica juncea. To use htseq-count for making count table, I have to convert gff file which downloaded in brassica database to gtf file. So I used gffread for converting gff file with below command gffread Bju.genome.gff -T -o…