Tag: logFC

Limma returned only positive logFC values 0 I want to obtain the upregulated and downregulated genes using limma. However, all the DEGs returned by my code have positive LogFC and none are downregulated (negative LogFC). This observation is consistent across multiple distinct dataframes. Is there something wrong with my code?…

Screening for pivotal genes in diabetic peripheral neuropathy In screening the DEGs, a total of 6 DPN samples and 6 control samples were included in the GEO dataset GSE95849, and this dataset was normalised. A principal component analysis (PCA) of GSE95849 was conducted to demonstrate clustering using scatter plots. Each…

In this tutorial, I’ll try to provide a brief overview of the capabilities of our enrichment analysis R package pathfindR. The tool is in CRAN and its introductory vignette can be found here. We also have a detailed wiki. pathfindR is designed to improve enrichment analysis by firstly identifying active…

Differential expression analysis We downloaded GSE125361 (n = 48) microarray data from the Gene Expression Omnibus (GEO) database, which included 45 myeloma samples and 3 controls, for expression analysis of IL5RA in cancer16. Additionally, we analyzed the expression of IL5RA in smoldering myeloma (SMM) patients who progressed to active MM (n = 10) and…

Plotting heat map with significance based on multiple columns 1 Hello Everyone, I have a data frame with columns having different sample information. It looks like this: Pathways s1_adjPval s1logFC s2_adjPval s2_logFC s3_adjPval s3_logFC X1 0.001 0.6 0.25 -0.6 0.002 0.34 I want to plot the graph in such a…

Overview of sample sequencing We compared the transcriptomes of BZ-resistant (17LER) and wild-type (17WTS) T. cruzi populations. cDNA libraries were constructed, sequenced and analysed for identifying the DE transcripts associated with resistance to BZ. The following parameters were evaluated using the read-quality analysis: (i) quantity of the sequenced reads; (ii)…

Comparative transcriptomics 0 Hi all, How can I compare different transcriptomics of different RNA-Seq data results? Each study is unique and comparing LogFC values directly doesn’t seem quite right to me. Is there a tool for compare them or does anyone recommend me a way to compare them ? rna-seq…

Hello! When performing differential expression analysis with RNA-Seq data using DeSeq2, and after data normalisation, there is the option to extract a count table with the transformed abundance levels using the variance stabilisation transformation (vst) method. Line of code vst counts extraction: vst_dds <- vst(res) The DeSeq2 manual itself indicates…

Hi everybody, I am struggling trying to calculate log2FC manually with an RNA-seq experiment that has no replicates. I know this question has been posted but hadn’t been able to transfer the answers to my data. So I have 3 conditions, let’s say HpA, SpA and Empty. I would like…

Identify necroptosis-related lncRNAs in SKCM There are 386 necroptosis-related lncRNAs identified from the data of TCGA and GTEx, as the standard is the coefficients > 0.4 and P < 0.001. After that, flowing the differential expression analysis, 87 necroptosis-related lncRNAs were found to display significantly differential expression with the screen value as |logFC…

Transformation of Log2FC to average logFC 1 Hey, I am actually trying to transform Log2FC to the average_logFC using R does any know to do it ? Thank you avg_logFC transformation log2FC to • 70 views • link updated 37 minutes ago by LChart 2.5k • written 2 hours ago…

Hey all, I am trying to run this script in R but due to some reason I am getting the following error, I don’t know what I am missing. Any help would be appreciated. library(“tidyverse”) library(“ggrepel”) library(“dplyr”) df |> dplyr::mutate( label=ifelse( avg_log2FC >= nth(avg_log2FC, 10, desc(avg_log2FC)) | avg_logFC <= nth(avg_log2FC,…

p-fold plot 1 I want to construct this plot, and I have already performed the DESeq analysis. This is how the data looks: Gene p_val avg_logFC pct.1 pct.2 p_val_adj HLA-B 1.69E-152 0.719935845 0.993 0.988 2.38E-148 VAMP5 2.73E-97 1.137804386 0.87 0.527 3.85E-93 PSME2 6.25E-88 0.820693535 0.965 0.88 8.80E-84 STAT1 1.03E-83 0.890453249…

Error in colorRamp2(c(quantile(mean)[1], quantile(mean)[4], c(“white”, : argument “colors” is missing, with no default 0 col_AveExpr <- colorRamp2(c(quantile(mean)[1], quantile(mean)[4], c(“white”, “black”))) Error in colorRamp2(c(quantile(mean)[1], quantile(mean)[4], c(“white”, : argument “colors” is missing, with no default I am trying to make heatmap from sigs.df using complex heatmap, while making color code for average…

Hi everyone, Apologies if this has been asked before and for the length of this post, but there seems to be a variety of answers out there for different types of studies, so I wasn’t sure if my approach was correct. I have 3 RNA-seq studies where I have performed…

Introduction Among all common noncutaneous malignancies, bladder carcinoma (BC) is the fourth prevalent one in all patients from the United States, and a subset of BC can progress to a severe muscle invasive form, leading to distal metastasis to other organs, including liver, lung, bone and mediastinum (1). BC with…

Hi guys, I’m relatively new to any type of analytics work and Rstudio. However, when inputting my TCGA data and doing all of the basic steps, my volcano plot and log2foldchange values seem to all be the opposite of what was expected. I understand perhaps this could just be the…

suprisingly high logFC using limma 1 Dear guys, Do you have any experience when using limma for one batch of proteomics data, the log2FC is surprisingly high (1500-3000), but when checking the expression matrix, the value among the samples are pretty similar. The design is ~0+ treatment, which seems quite…

Figure 1. Identification and validation of hsa_circ_0008234 in colon cancer Notes: (A): The highest five increased and decreased circRNAs between the normal and colon cancer tissue obtained from the GSE172229. (B): Volcano plot of the differentially expressed circRNAs with the threshold of |logFC| > 1 and p < 0.05. (C):…

Hi, I am trying to calculate statistics for my proteomic data using LIMMA package so I can create some volcano plots. I have normalized log2 transformed intensities with imputed NA values for 2 samples each with 3 biological replicates so 6 columns (+1 annotations). When using LIMMA for some reason…

Hello, I am new to bioinformatic analyses and I am trying to analyse the TCGA dataset to plot a survival curve based on the expression of a gene of interest (say TP53). I have written the following code to analyse the TCGA data, but I am unable to proceed further…

Hello, I’m currently trying to analyze an RNA-seq data set of about 10500 samples (including biological replicates) and initially noticed some strange outputs in my differential expression output file. I am using the CIRIquant pipeline with the built-in differential expression function which uses the edgeR module to calculate DE circular…

Yan Sha,1,&ast; An-qi Mao,1,&ast; Yuan-jie Liu,2 Jie-pin Li,2 Ya-ting Gong,3 Dong Xiao,1 Jun Huang,1 Yan-wei Gao,1 Mu-yao Wu,3 Hui Shen1 1Departments of Dermatology, Zhangjiagang TCM Hospital Affiliated to Nanjing University of Chinese Medicine, Zhangjiagang, People’s Republic of China; 2Department of Oncology, Affiliated Hospital of Nanjing University of Chinese Medicine, Jiangsu…

Summary of a Single-cell Guided Pipeline to Aid Repurposing of Drugs Using scRNA-seq data, ASGARD repurposes drugs for disease by fully accounting for the cellular heterogeneity of patients (Fig. 1, Formula 1 in “Methods” section). In ASGARD, every cell cluster in the diseased sample is paired to that in the normal…

log_fc primer ID_1 category Avg_logfc primer_1 42 test_1 1.88444044 primer_2 43 test_1 0.8730141 primer_3 44 test_1 1.10542821 primer_4 45 test_1 0.79234524 primer_1 11 test_2 0.33098178 primer_2 12 test_2 0.66117247 primer_3 13 test_2 0.62520437 primer_4 14 test_2 0.21972443 primer_1 94 test_3 -0.96924447 primer_2 95 test_3 1.4806643 primer_3 96 test_3 1.83216384 primer_4…

logFC is negative, need help to get it done 0 I had normalized count matrix with few negative values or I should say log transformed normalized matrix. I performed the following analysis in limma (the code is below). I got the results , I am getting all logfC value in…

Third quartile normalized logFC data to find differentially express gene using limma 0 I have normalized count matrix which is normalized using conditional quantile normalization and having negative value, I understand that these are normalized logFC values. When I am directly using into limma with following command. It is showing…

Front Genet. 2022; 13: 964840. , 1 , 1 , 1 , 2 , 2 , 2 , 2 , 2 , 3 ,* and 4 ,* Yun Zhu 1 Department of Dermatology, The People’s Hospital of Yuxi City, Yuxi, China Weimin Yan 1 Department of Dermatology, The People’s Hospital…

What are Differentially Expressed Genes ?!! 0 Hi, Believe me, I know what I am going to ask would sound stupid and repetitive. I did read through many of the articles available but still is confused. So, let’s say I am doing an RNA-seq DEG analysis with a dataset of…

Data collection and processing The RNA-sequencing data, clinical information and simple nucleotide variation of LUAD patients were retrieved from TCGA database (portal.gdc.cancer.gov/, accessed April 8, 2022). Nineteen cuproptosis-related genes (CRG) were mainly collected from previous study, including LIPT1, GLS, NFE2L2, NLRP3, LIAS, ATP7B, ATP7A, SLC31A1, FDX1, LIPT2, DLD, DLAT, PDHA1,…

DiffBind analysis report gives me two different outputs depending on when I apply a filtering threshold [eg: P-value=0.05, (abs)FC=1.1] 1 Why is there a difference between the report outputs I get after dba.report, with a threshold set to P-value = 0.05 and fold=0.13750352375 [to get (abs)logFC=1.1], compared to when I…

Fibroblast identification through single-cell RNA-sequencing analysis of whole-tissue homogenates derived from human NSCLC tumor samples. a Schematic illustrating sample processing and analysis methodology used to generate the target lung drop-seq (TLDS) dataset, comprised of human control (n = 6) and NSCLC (n = 12) samples. The Figure was partly generated using Servier Medical Art,…

Recommendations needed for a tool for comparative gene set enrichment analyses via a webserver 1 dear All, I’d like to compare 6 gene expression datasets (multiple conditions / time-points) in terms of joint patterns in the enrichments of the differentially expressed genes. The DEG lists I have prepared (logFC,padj). GO…

GOplots::GOChord with heatmaps? 0 @adrijakalvisa-22810 Last seen 16 hours ago Denmark Hi all, is there a way to add a gene expression heatmap option to GOplots::GOChord plot? Or multiple heatmaps at once? An example Chord plot: Fig 6 in PMID: 33674625. Here is what I tried: library(GOplot) data(EC) circ <-…

Dear Community, I am trying to show pathway expression in 6 clusters that I identified in disease and control and would like to compare the corresponding clusters. I followed this post 438466 and used Pratik ‘s solution. Which gives me a plot only for the disease. However, I would like…

limma issue (possibly a Galaxy issue) 0 I just wanted to alert the community to an issue I discovered while using limma on the Galaxy webserver. The issue arises when conducting differential expression between contrasts. The process is described on the galaxy server as follows: “Names of two groups to…

Hugely different results between edgeR and DESeq2 0 I am working on a 18-patients dataset. I am trying to calculate DE genes with both EdgeR and DESeq2 for further analyses. Its a 2-factor design (Status, Fraction). I want to calculate DE genes of different Fractions using the Status as covariate….

Estimating Fold-Changes of Lowly Expressed Genes 1 @vm-21340 Last seen 6 hours ago Brazil I am doing a DGE analysis using RNAseq data to compare three conditions. I am using a standard pipeline (Create DGEList > Filter very lowly expressed genes > TMM normalize > DGE). Since there is a…

One-tailed test edgeR possible? 2 @2357cabb Last seen 19 hours ago Germany Is it possible to conduct a one-tailed differential expression analysis test using edgeR? I might have missed something in the documentation, but I cannot find anything definite. I mean by this conducting a test where I only look…

Software Figure preparation: CorelDRAW x8 (Corel); Bioinformatic analyses: R v 4.0.3 (R Foundation for Statistical Computing). Computational resources Analyses were run on a desktop computer with an Intel Core i9-10900L CPU (3.70 GHz, 10 cores, 20 threads) with 120 GB RAM running Windows 10 Pro (v21H2). Data preprocessing scRNA-seq data sets…

Hi, I have found that my selected gene, probe I.D 201667_at is differentially expressed between WDLPS and DDLPS tumour tissue samples after performing microarray DEG analysis. Instead of just a p value in a table format: Probe I.D “201667_at” logFC 10.8205874181535 AveExpr 10.6925705768407 t 82.8808890739766 P.Value 3.10189446528995e-88 adj.P Val 3.10189446528995e-88…

Same results in Limma Toptable as in DESEQ2 results 1 Dear all, I am trying to generate exactly the same results in Limma for my result table as I did in DESEQ2 (Differential Expression Analysis). With the toptable function I am not getting lfcSE and basemean. Can anyone help me…

Introduction Stroke is one of the leading causes of death and disability worldwide, which causes substantial economic and social burdens.1 Ischemic stroke is caused by insufficient blood and oxygen supply to the brain,2 accounting for about 85% of the casualties of stroke patients.3 The concept of treatment for ischemic injury…

Hi, Im aiming to use aggregated single cell data to perform a pseudobulk analysis to assess differential expression between those with sarcopenia and those without, termed “status_binary” with the levels “yes” and “no”. # DESeq2 —————————————————————— dds <- DESeqDataSetFromMatrix(y$counts, colData = y$samples, design = ~Sex+age_scaled+status_binary) # Transform counts for data…

Hi All I plot the heat map for my logCPM successfully but using Ensemble geneIDs. I need the heatmap to have the gene symbols, I can convert the ensemble gene IDs to gene IDs fine, but don’t know how to reflect this on the heatmap. My code for the heatmap…

1Department of Orthopedics, The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, People’s Republic of China; 2Department of Pediatrics, The Shanxi Medical University, Taiyuan, Shanxi, People’s Republic of China Correspondence: Jun Qian, Department of Orthopedics, The First Affiliated Hospital of Anhui Medical University, 218 Jixi Road, Hefei, 230022, Anhui,…

Cluster Profiler output not the same as Enrichr output 0 @angkoo-23537 Last seen 18 hours ago United Kingdom Hi there, I have am getting different outputs after running enrichGO on cluster profiler when I put the same genes into enrichR (by Maayan Lab) website. Example here using Biological Process 2021…

Is there a way to mark up specific genes in MA-plot? 1 Dear, everyone, I have this table, and created MAplot using the following steps. In this plot, I would like to mark up only the genes that I specify:for example, I would like to display the gene name in…

Introduction Thyroid carcinoma (THCA) is the most common type of endocrine malignancy and its incidence is increasing.1 Based on its histopathological characteristics, thyroid carcinoma can be classified into multiple subtypes, such as papillary thyroid carcinoma (PTC), follicular thyroid carcinoma, and anaplastic thyroid carcinoma.2 PTC is the most common subtype of…

Large DE LogFC range 1 @3d20f23f Last seen 1 hour ago Italy I’m working with DESeq2 to make a DE analysis between samples in two different conditions. During the analysis, I identified a batch effect due to the sequencing time modelled as a covariate in the design formula. From the…

Introduction Kidney cancer is one of the most commonly diagnosed tumors around the globe.1 According to the statistics from the World Health Organization, annually, there are more than 140,000 RCC-related deaths.2 ccRCC is the most typical subtype of kidney cancer and contributes to the majority of kidney cancer-related deaths.3,4 Until…

sigh of log2FC values in DESeq2 0 @194b0276 Last seen 10 hours ago United States Can someone explain to me how is the sign of log2FoldChange is set in the results of DEseq2? I was pretty sure that it is calculated as log2(Counts_treatment/Count_reference), where reference is determined alphabetically (unless specified…

Hi, I saw on one of the Seurat data visualization tutorials that if you have a dataset you generated from an experiment, you can split a dataset into the control and the treatment. For example, if you have the following dataset where the metadata is clearly split into groups, you…

I was trying to plot the gene chord diagram, but I got an error” Error in colSums(mat) : ‘x’ must be numeric”. I prepared the file myself, I submitted the target genes on Metascape, all these genes were enriched and picked from 6 signal pathways clusters. And then I downloaded…

Introduction Renal cell carcinoma (RCC) accounts for approximately 2–3% of all malignant tumors, and its prevalence is rising. Metastatic RCC accounts for 25–30% of all RCC cases, and has an exceedingly poor prognosis.1 In 2020, among approximately 430,000 newly discovered cases of RCC, 179,000 died.2 Clear cell renal cell carcinoma…

Hi All, So i an currently attempting to use Enhanced volcano to visualise a set of RNA-seq data, but when I run the below script, I get back the error message below. Does anyone know what the problem is – I can’t see anything wrong in the code. Error in…

I am analyzing a dataset that is looking into the effects of age on cancer using patient samples within one cancer type. In short, we are interested in finding genes involved in tumorigenesis that are altered by age. Each patient is classified as young or old, and had tumor tissue…

**Also posted this on Biostars** Hi everyone! I’m fairly new to bioinformatics (self-taught for my MSc) and I’m trying to replicate a study using publicly available transcriptomic data (GSE107934). I’m struggling to get the same results as the authors. I’m following the study’s methods and using DESeq2 to conduct the…

Hi Biostars! I’m fairly new to bioinformatics (self-taught for my MSc) and I’m trying to replicate a study using publicly available transcriptomic data (GSE107934). I’m struggling to get the same results as the authors. I’m following the study’s methods and using DESeq2 to conduct the differential expression analysis. Most of…

RefSeq/other ID to Gene ID conversion 1 I have a list like: ID adj.P.Val P.Value logFC SEQUENCE ASHGA5P025665 2.06e-12 1.35e-16 -6.333.437 CAAGAACAAGACTGGATCACTCCATGTCAGTGGAAACATGTCCACCAACTTCATCATTGT ASHGA5P016911 1.59e-11 2.08e-15 -7.366.312 TTTCTGAAAGGCTCTGCTTTGACCTGAAGTATTTTATCTATCCTCAGTCTCAGGACACTG This is corresponding a list of genes and I need to obtain the official gene name. I tried DAVID tool and similars, but…

R: A function to perform gene-level test using a sgRNA-level… measure_gene_stats {CB2} R Documentation A function to perform gene-level test using a sgRNA-level statistics. Description A function to perform gene-level test using a sgRNA-level statistics. Usage measure_gene_stats(sgrna_stat, logFC_level = “sgRNA”) Arguments sgrna_stat A data frame created by ‘measure_sgrna_stats’ logFC_level The…

Correlation Network with Cytoscape 0 I performed differential expression analysis of two different diseases and I have a list of DE human genes. I also have the logfc and p values .I want to visualise these in Cytoscape (as a correlation network between the 2 diseases). Are the logfc and…

Do I have to separate my interest genes from my count matrix and then perform differential expression analysis for them? 0 Hi all, I am trying to study the differential expression of my interest genes in colon cancer. First, I’ve downloaded the RNA-Seq raw counts from TCGA and have built…

KEGG passway analysis after Seurat analysis 0 Hello, everyone. I am so sorry for this amateur question. I have a scRNA-seq data and want to compare and visualize the expression levels across genes on a cluster by using clusterprofiler package (passway analysis), but I think the average expression levels of…

Do we need to filter out the 0 counts sgRNA in CRISPR analysis? 0 Hi, I’m doing CRISPR analysis and there is a question, when we perform CRISPR analysis, is there a step to remove low count sgRNAs from control and/or treatment samples? The reason of this question is that,…

GOChord plot problem when using the chor_dat function to create a matrix 0 Hello All, I am trying to create a GOChord plot for circular visualization of the results of gene- annotation enrichment analysis. I created all the data frames myself and cross-checked the types of every column in each…

Statistics and reproducibility For multiplex fluorescent in situ hybridization (FISH) and immunofluorescence staining experiments, each ISH probe combination was repeated with similar results on at least two separate individuals per species, and on at least two sections per individual. The experiments were not randomized and the investigators were not blinded…

Statistical technique for mutation to gene expression link 0 I grouped the samples into p53 wildtype and p53 mutated – for approximately 1000 individuals. I have gene expression data (logFC) of each individual present in both mutated and non-mutated groups. Now my aim is to identify the genes that are…

Comparing two RNA-seq data sets mouse and human 0 Hi I have a question. We have two RNA-Seq data sets one from mouse and one from human for our gene modification, and we wanted to know how similar they are from each other. I know i can convert the mouse…

How to work out Z score for heatmaps for RNA seq dataset 2 I am trying to generate some heatmaps for my RNA seq dataset but struggling to work out how to calculate the z score. Can anyone give me any pointers on how to calculate please. I have; Gene_DE.txt…

Introduction Ischemic stroke (IS) is caused by the sudden loss of blood circulation to an area of the brain that causes injury to neurological function and represents a major cause of global disability and mortality.1 IS is known to be a heterogeneous and multifactorial disease. Genetic factors, particularly those involving…

Why there are same name with different value in my microarray result? 0 I have done one color agilent microarray. I am processing my data, but my data showed one miRNA present in more than one place with different value. Could someone please tell me what is the reason for…

Since the weekend I’ve been getting an “NAs introduced by coercion” error message when i run the pathfindR package. An example of some of my data is Gene.symbol <- c(“ACAA2”, “ACADVL”, “ACAT1”, “ACOT9”, “ACOX1”, “ADH5”, “AKR1A1”) logFC <- c(“3.3”, “3.9”, “1.5”, “1.7”, “2.4”, “1.9”, “1.7”) adj.P.Val <- c(“0.02”, “0.03”, “0.02”,…

Cutoff value for shrunken logFC 0 Hello Is there any rule of thumb for filtering shrunken logFC, similar to |logFC|>1.5 for raw results? Or perhaps one should find the cutoff purely based on the distribution of shrunken logFC? I think some standardized value is needed though, e.g. from the perspective…

relationship between DE-genes and DE-trascripts in deseq2 1 Hello everybody, I ran a DE –RNAseq project by star-stringtie2- deseq2 pipline. The prepDE.py was used for generation of transcript matrix and gene matrix. Deseq2 were performed at both gene and transcript levels. At the gene level, 838 DE-genes were identified with…

James W. MacDonald 57k 1 week, 5 days ago United States Answer: Biomart’s getBM returns no genes for an existing GO-term in grch38, and less the Michael Love 33k 1 week, 6 days ago United States Answer: Normalizing 5′ Nascent RNA-seq data to identify differentially expressed transcr Kevin Blighe 3.3k 2 weeks, 2 days ago Republic…

Sorry for lateness, I wanted to do something similar. This is what I did for reference: Using a Seurat generated gene list for input into ClusterProfiler to see the GO or KEGG terms per cluster. I’ll keep the meat and potatoes of the Seurat vignette in this tutorial: library(dplyr) library(Seurat)…

Use Spike-Ins or TMM-normalization 1 Hi all, Sorry for all my questions lately, but as a novice which has to figure out how to analyse QuantSeq data, this forum has been a great and indispensible help for me. I’m doing a human transcriptomics analysis where we have QuantSeq data for…

Hi, We have run a pilot RNA-Seq study with one sample per condition, this is just a test run. I understand there is no valid statistical test in this case, however just curious to obtain differential expression through edgeR package in R assuming dispersion = 0.4 for the human data….

How to convert log2 scale RNA-Seq expression data to linear scale data 0 Hi, We have run a pilot RNA-Seq study and I used edgeR package to obtain differential expression results. The results output a gene column along with the logCPM, logFC and p-value column. I have a question regarding…

Upon request, a quick tutorial for processing the Agilent micro-RNA (miRNA) microarray data of GSE28955. The raw TXT files are contained in: ftp.ncbi.nlm.nih.gov/geo/series/GSE28nnn/GSE28955/suppl/GSE28955_RAW.tar Download this TAR file Unpack it [the TAR file] Unzip the txt.gz files Store these [txt files] in a directory raw/ Then, create a tab-delimited file, targets.txt,…

Hi, I assume you have to find differential expression between two cell lines (Cx and Dx groups). Since you need logFC and Pvalue, this R code can work. And you can use obtained matrix (mysample) to calculate FDR of your interest. mysample <- read.table(“./mymatrix.csv”, sep=”,”, header=TRUE) for(i in 2:nrow(mysample)) {…

Power calculation for microarray data 0 I have an initial sample of 228 patients from a microarray study. Recently I have obtained a new set of labels specifying different condition types for only 69 out of the 228 patients. I wanted to run a DEG analysis on this set of…

Hi everyone I wanted to analyze TCGA-BRCA data for identifying DEGs in different TNM stages (I to IV) between Normal and Tumor. How to change the following code to get the DEGs based on the staging? CancerProject <- “TCGA-BRCA” DataDirectory <- paste0(“../GDC/”,gsub(“-“,”_”,CancerProject)) FileNameData <- paste0(DataDirectory, “_”,”HTSeq_Counts”,”.rda”) query <- GDCquery(project =…

%% error in Rstudio 1 dc.markers %>% group_by(cluster) %>% top_n(2, wt = avg_logFC) the above code is giving error even after using dplyr and matrix libraries in seurat analysis in rstudio error : Error: Problem with filter() input ..1. i Input ..1 is top_n_rank(2, avg_logFC). x object ‘avg_logFC’ not found…