Tag: logFC

Large DE LogFC range

Large DE LogFC range 1 @3d20f23f Last seen 1 hour ago Italy I’m working with DESeq2 to make a DE analysis between samples in two different conditions. During the analysis, I identified a batch effect due to the sequencing time modelled as a covariate in the design formula. From the…

Continue Reading Large DE LogFC range

Immune-related Prognostic Genes of ccRCC

Introduction Kidney cancer is one of the most commonly diagnosed tumors around the globe.1 According to the statistics from the World Health Organization, annually, there are more than 140,000 RCC-related deaths.2 ccRCC is the most typical subtype of kidney cancer and contributes to the majority of kidney cancer-related deaths.3,4 Until…

Continue Reading Immune-related Prognostic Genes of ccRCC

sigh of log2FC values in DESeq2

sigh of log2FC values in DESeq2 0 @194b0276 Last seen 10 hours ago United States Can someone explain to me how is the sign of log2FoldChange is set in the results of DEseq2? I was pretty sure that it is calculated as log2(Counts_treatment/Count_reference), where reference is determined alphabetically (unless specified…

Continue Reading sigh of log2FC values in DESeq2

Telling apart control and treatment groups in Seurat Visualizations

Hi, I saw on one of the Seurat data visualization tutorials that if you have a dataset you generated from an experiment, you can split a dataset into the control and the treatment. For example, if you have the following dataset where the metadata is clearly split into groups, you…

Continue Reading Telling apart control and treatment groups in Seurat Visualizations

r – Error in colSums(mat) : ‘x’ must be numeric GOchord plot

I was trying to plot the gene chord diagram, but I got an error” Error in colSums(mat) : ‘x’ must be numeric”. I prepared the file myself, I submitted the target genes on Metascape, all these genes were enriched and picked from 6 signal pathways clusters. And then I downloaded…

Continue Reading r – Error in colSums(mat) : ‘x’ must be numeric GOchord plot

Establishment of sunitinib-resistant CDX model of ccRCC

Introduction Renal cell carcinoma (RCC) accounts for approximately 2–3% of all malignant tumors, and its prevalence is rising. Metastatic RCC accounts for 25–30% of all RCC cases, and has an exceedingly poor prognosis.1 In 2020, among approximately 430,000 newly discovered cases of RCC, 179,000 died.2 Clear cell renal cell carcinoma…

Continue Reading Establishment of sunitinib-resistant CDX model of ccRCC

Error in Enhanced Volcano : unused arguments

Hi All, So i an currently attempting to use Enhanced volcano to visualise a set of RNA-seq data, but when I run the below script, I get back the error message below. Does anyone know what the problem is – I can’t see anything wrong in the code. Error in…

Continue Reading Error in Enhanced Volcano : unused arguments

Paired sample design in DESeq2

I am analyzing a dataset that is looking into the effects of age on cancer using patient samples within one cancer type. In short, we are interested in finding genes involved in tumorigenesis that are altered by age. Each patient is classified as young or old, and had tumor tissue…

Continue Reading Paired sample design in DESeq2

Help with replicating results of differential expression analysis in DESeq2 : bioinformatics

**Also posted this on Biostars** Hi everyone! I’m fairly new to bioinformatics (self-taught for my MSc) and I’m trying to replicate a study using publicly available transcriptomic data (GSE107934). I’m struggling to get the same results as the authors. I’m following the study’s methods and using DESeq2 to conduct the…

Continue Reading Help with replicating results of differential expression analysis in DESeq2 : bioinformatics

Differential expression analysis – issue with replicating results

Hi Biostars! I’m fairly new to bioinformatics (self-taught for my MSc) and I’m trying to replicate a study using publicly available transcriptomic data (GSE107934). I’m struggling to get the same results as the authors. I’m following the study’s methods and using DESeq2 to conduct the differential expression analysis. Most of…

Continue Reading Differential expression analysis – issue with replicating results

RefSeq/other ID to Gene ID conversion

RefSeq/other ID to Gene ID conversion 1 I have a list like: ID adj.P.Val P.Value logFC SEQUENCE ASHGA5P025665 2.06e-12 1.35e-16 -6.333.437 CAAGAACAAGACTGGATCACTCCATGTCAGTGGAAACATGTCCACCAACTTCATCATTGT ASHGA5P016911 1.59e-11 2.08e-15 -7.366.312 TTTCTGAAAGGCTCTGCTTTGACCTGAAGTATTTTATCTATCCTCAGTCTCAGGACACTG This is corresponding a list of genes and I need to obtain the official gene name. I tried DAVID tool and similars, but…

Continue Reading RefSeq/other ID to Gene ID conversion

A function to perform gene-level test using a sgRNA-level…

R: A function to perform gene-level test using a sgRNA-level… measure_gene_stats {CB2} R Documentation A function to perform gene-level test using a sgRNA-level statistics. Description A function to perform gene-level test using a sgRNA-level statistics. Usage measure_gene_stats(sgrna_stat, logFC_level = “sgRNA”) Arguments sgrna_stat A data frame created by ‘measure_sgrna_stats’ logFC_level The…

Continue Reading A function to perform gene-level test using a sgRNA-level…

Correlation Network with Cytoscape

Correlation Network with Cytoscape 0 I performed differential expression analysis of two different diseases and I have a list of DE human genes. I also have the logfc and p values .I want to visualise these in Cytoscape (as a correlation network between the 2 diseases). Are the logfc and…

Continue Reading Correlation Network with Cytoscape

Do I have to separate my interest genes from my count matrix and then perform differential expression analysis for them?

Do I have to separate my interest genes from my count matrix and then perform differential expression analysis for them? 0 Hi all, I am trying to study the differential expression of my interest genes in colon cancer. First, I’ve downloaded the RNA-Seq raw counts from TCGA and have built…

Continue Reading Do I have to separate my interest genes from my count matrix and then perform differential expression analysis for them?

KEGG passway analysis after Seurat analysis

KEGG passway analysis after Seurat analysis 0 Hello, everyone. I am so sorry for this amateur question. I have a scRNA-seq data and want to compare and visualize the expression levels across genes on a cluster by using clusterprofiler package (passway analysis), but I think the average expression levels of…

Continue Reading KEGG passway analysis after Seurat analysis

Do we need to filter out the 0 counts sgRNA in CRISPR analysis?

Do we need to filter out the 0 counts sgRNA in CRISPR analysis? 0 Hi, I’m doing CRISPR analysis and there is a question, when we perform CRISPR analysis, is there a step to remove low count sgRNAs from control and/or treatment samples? The reason of this question is that,…

Continue Reading Do we need to filter out the 0 counts sgRNA in CRISPR analysis?

GOChord plot problem when using the chor_dat function to create a matrix

GOChord plot problem when using the chor_dat function to create a matrix 0 Hello All, I am trying to create a GOChord plot for circular visualization of the results of gene- annotation enrichment analysis. I created all the data frames myself and cross-checked the types of every column in each…

Continue Reading GOChord plot problem when using the chor_dat function to create a matrix

Comparative cellular analysis of motor cortex in human, marmoset and mouse

Statistics and reproducibility For multiplex fluorescent in situ hybridization (FISH) and immunofluorescence staining experiments, each ISH probe combination was repeated with similar results on at least two separate individuals per species, and on at least two sections per individual. The experiments were not randomized and the investigators were not blinded…

Continue Reading Comparative cellular analysis of motor cortex in human, marmoset and mouse

Statistical technique for mutation to gene expression link

Statistical technique for mutation to gene expression link 0 I grouped the samples into p53 wildtype and p53 mutated – for approximately 1000 individuals. I have gene expression data (logFC) of each individual present in both mutated and non-mutated groups. Now my aim is to identify the genes that are…

Continue Reading Statistical technique for mutation to gene expression link

Comparing two RNA-seq data sets mouse and human

Comparing two RNA-seq data sets mouse and human 0 Hi I have a question. We have two RNA-Seq data sets one from mouse and one from human for our gene modification, and we wanted to know how similar they are from each other. I know i can convert the mouse…

Continue Reading Comparing two RNA-seq data sets mouse and human

How to work out Z score for heatmaps for RNA seq dataset

How to work out Z score for heatmaps for RNA seq dataset 2 I am trying to generate some heatmaps for my RNA seq dataset but struggling to work out how to calculate the z score. Can anyone give me any pointers on how to calculate please. I have; Gene_DE.txt…

Continue Reading How to work out Z score for heatmaps for RNA seq dataset

rs2507799 was found to be linked with increased risk for IS

Introduction Ischemic stroke (IS) is caused by the sudden loss of blood circulation to an area of the brain that causes injury to neurological function and represents a major cause of global disability and mortality.1 IS is known to be a heterogeneous and multifactorial disease. Genetic factors, particularly those involving…

Continue Reading rs2507799 was found to be linked with increased risk for IS

Why there are same name with different value in my microarray result?

Why there are same name with different value in my microarray result? 0 I have done one color agilent microarray. I am processing my data, but my data showed one miRNA present in more than one place with different value. Could someone please tell me what is the reason for…

Continue Reading Why there are same name with different value in my microarray result?

Introducing NA by coercion error message when running pathfindR

Since the weekend I’ve been getting an “NAs introduced by coercion” error message when i run the pathfindR package. An example of some of my data is Gene.symbol <- c(“ACAA2”, “ACADVL”, “ACAT1”, “ACOT9”, “ACOX1”, “ADH5”, “AKR1A1”) logFC <- c(“3.3”, “3.9”, “1.5”, “1.7”, “2.4”, “1.9”, “1.7”) adj.P.Val <- c(“0.02”, “0.03”, “0.02”,…

Continue Reading Introducing NA by coercion error message when running pathfindR

Cutoff value for shrunken logFC

Cutoff value for shrunken logFC 0 Hello Is there any rule of thumb for filtering shrunken logFC, similar to |logFC|>1.5 for raw results? Or perhaps one should find the cutoff purely based on the distribution of shrunken logFC? I think some standardized value is needed though, e.g. from the perspective…

Continue Reading Cutoff value for shrunken logFC

relationship between DE-genes and DE-trascripts in deseq2

relationship between DE-genes and DE-trascripts in deseq2 1 Hello everybody, I ran a DE –RNAseq project by star-stringtie2- deseq2 pipline. The prepDE.py was used for generation of transcript matrix and gene matrix. Deseq2 were performed at both gene and transcript levels. At the gene level, 838 DE-genes were identified with…

Continue Reading relationship between DE-genes and DE-trascripts in deseq2

Bioconductor Forum

James W. MacDonald 57k 1 week, 5 days ago United States Answer: Biomart’s getBM returns no genes for an existing GO-term in grch38, and less the Michael Love 33k 1 week, 6 days ago United States Answer: Normalizing 5′ Nascent RNA-seq data to identify differentially expressed transcr Kevin Blighe 3.3k 2 weeks, 2 days ago Republic…

Continue Reading Bioconductor Forum

How to transform the deg gene list from seurat to a gene list input to clusterProfiler compareCluster ?

Sorry for lateness, I wanted to do something similar. This is what I did for reference: Using a Seurat generated gene list for input into ClusterProfiler to see the GO or KEGG terms per cluster. I’ll keep the meat and potatoes of the Seurat vignette in this tutorial: library(dplyr) library(Seurat)…

Continue Reading How to transform the deg gene list from seurat to a gene list input to clusterProfiler compareCluster ?

Use Spike-Ins or TMM-normalization

Use Spike-Ins or TMM-normalization 1 Hi all, Sorry for all my questions lately, but as a novice which has to figure out how to analyse QuantSeq data, this forum has been a great and indispensible help for me. I’m doing a human transcriptomics analysis where we have QuantSeq data for…

Continue Reading Use Spike-Ins or TMM-normalization

Calculate fold change in edgeR with one sample per condition

Hi, We have run a pilot RNA-Seq study with one sample per condition, this is just a test run. I understand there is no valid statistical test in this case, however just curious to obtain differential expression through edgeR package in R assuming dispersion = 0.4 for the human data….

Continue Reading Calculate fold change in edgeR with one sample per condition

How to convert log2 scale RNA-Seq expression data to linear scale data

How to convert log2 scale RNA-Seq expression data to linear scale data 0 Hi, We have run a pilot RNA-Seq study and I used edgeR package to obtain differential expression results. The results output a gene column along with the logCPM, logFC and p-value column. I have a question regarding…

Continue Reading How to convert log2 scale RNA-Seq expression data to linear scale data

Agilent-016436 Human miRNA Microarray 1.0

Upon request, a quick tutorial for processing the Agilent micro-RNA (miRNA) microarray data of GSE28955. The raw TXT files are contained in: ftp.ncbi.nlm.nih.gov/geo/series/GSE28nnn/GSE28955/suppl/GSE28955_RAW.tar Download this TAR file Unpack it [the TAR file] Unzip the txt.gz files Store these [txt files] in a directory raw/ Then, create a tab-delimited file, targets.txt,…

Continue Reading Agilent-016436 Human miRNA Microarray 1.0

TPM to logFC and pvalues

Hi, I assume you have to find differential expression between two cell lines (Cx and Dx groups). Since you need logFC and Pvalue, this R code can work. And you can use obtained matrix (mysample) to calculate FDR of your interest. mysample <- read.table(“./mymatrix.csv”, sep=”,”, header=TRUE) for(i in 2:nrow(mysample)) {…

Continue Reading TPM to logFC and pvalues

Power calculation for microarray data

Power calculation for microarray data 0 I have an initial sample of 228 patients from a microarray study. Recently I have obtained a new set of labels specifying different condition types for only 69 out of the 228 patients. I wanted to run a DEG analysis on this set of…

Continue Reading Power calculation for microarray data

Differential expression analysis of TCGA data based on tumor staging

Hi everyone I wanted to analyze TCGA-BRCA data for identifying DEGs in different TNM stages (I to IV) between Normal and Tumor. How to change the following code to get the DEGs based on the staging? CancerProject <- “TCGA-BRCA” DataDirectory <- paste0(“../GDC/”,gsub(“-“,”_”,CancerProject)) FileNameData <- paste0(DataDirectory, “_”,”HTSeq_Counts”,”.rda”) query <- GDCquery(project =…

Continue Reading Differential expression analysis of TCGA data based on tumor staging

%% error in Rstudio

%% error in Rstudio 1 dc.markers %>% group_by(cluster) %>% top_n(2, wt = avg_logFC) the above code is giving error even after using dplyr and matrix libraries in seurat analysis in rstudio error : Error: Problem with filter() input ..1. i Input ..1 is top_n_rank(2, avg_logFC). x object ‘avg_logFC’ not found…

Continue Reading %% error in Rstudio