Categories
Tag: MD
LP pseudo-atom is not supported
Hi, I want to perform MMPBSA for complex file Command: gmx_MMPBSA -O -i mmpbsa.in -cs md_100.tpr -ct md_center.xtc -ci index.ndx -cg 1 13 -cp topol.top -o FINAL_RESULTS_MMPBSA.dat -eo FINAL_RESULTS_MMPBSA.csv Error: [INFO ] Starting gmx_MMPBSA v1.6.2 [INFO ] Command-line gmx_MMPBSA -O -i mmpbsa.in -cs md_100.tpr -ct md_center.xtc -ci index.ndx -cg 1…
Importance of a detailed anomaly scan after a cfDNA test indicating fetal trisomy 21, 18 or 13
Kagan KO, Sonek J, Kozlowski P (2022) Antenatal screening for chromosomal abnormalities. Arch Gynecol Obstet 305(4):825–835 Article CAS PubMed PubMed Central Google Scholar Rose NC, Barrie ES, Malinowski J, Jenkins GP, McClain MR, LaGrave D et al (2022) Systematic evidence-based review: the application of noninvasive prenatal screening using cell-free DNA…
Axi-Cel Delivers Long-Lasting Responses in High-Risk Large B-cell Lymphoma
Lymphoma | Image Credit: © David A Litman – www.stock.adobe.com.jpg Durable responses were seen when axicabtagene ciloleucel (axi-cel; Yescarta) was administered as a first-line therapy for patients with high-risk large B-cell lymphoma (LBCL), according to findings from the phase 2 ZUMA-12 trial (NCT03761056), which were presented at the 2023 American…
Whole mitochondrial and chloroplast genome sequencing of Tunisian date palm cultivars: diversity and evolutionary relationships | BMC Genomics
Johnson DV, Al-Khayri JM, Jain SM. Introduction: Date Production Status and Prospects in Africa and the Americas. In: Al-Khayri J, Jain S, Johnson D, editors. Date Palm Genetic Resources and Utilization: Volume 1: Africa and the Americas. Springer Netherlands, Dordrecht; 2015. p. 1–18. doi.org/10.1007/978-94-017-9694-1_1 Gros-Balthazard M, Hazzouri KM, Flowers JM. Genomic…
Clinical Challenges: CAR-T or Bispecifics in Relapsed/Refractory DLBCL
T-cell engaging therapeutic approaches have significantly changed the treatment paradigm for relapsed or refractory diffuse large B-cell lymphoma (DLBCL) in recent years. “They are, by a wide margin, the most impactful new therapies for all B-cell lymphomas, but especially DLBCL, in the last 40 years, if not ever,” said Joshua…
Specifying time length of protein simulation – User discussions
cjbraz December 13, 2023, 7:56pm 1 GROMACS version: 2023.2GROMACS modification: Yes (GMX_OPENMP_MAX_THREADS = 128)Here post your question Hello, the below linked post is a little older version than my version of GROMACS but I would like to get an answer to this post’s question. Running the linked production script only…
First-Line LTRA Plus CHOP Produces 100% Complete Response Rate in DLBCL
Upfront targeted therapy may reduce the need for chemotherapy in patients with diffuse large B-cell lymphoma (DLBCL), according to research presented at the ASH Annual Meeting 2023. Researchers found that first-line treatment with lenalidomide, tafasitamab, rituximab, and acalabrutinib (LTRA) seemed to reduce the need for cyclophosphamide, doxorubicin, vincristine, and prednisone…
Augmedix Partners with Google Cloud to Bring Medically-Tuned AI Technology to Ambient Documentation
Augmedix Inc The general availability launch of MedLM will further advance Augmedix’s ambient medical documentation product performance SAN FRANCISCO, Dec. 13, 2023 (GLOBE NEWSWIRE) — Augmedix (Nasdaq: AUGX), a healthcare technology company that delivers industry-leading, ambient medical documentation and data solutions, announced today that it has been piloting Google Cloud’s…
How to write total potential energy to dump file? – LAMMPS Beginners
I use dump mydmp all custom 1000 dump.md.lammpstrj id type x y z fx fy fz To get a dump file that looks like ITEM: TIMESTEP 0 ITEM: NUMBER OF ATOMS 1150 ITEM: BOX BOUNDS pp pp pp -2.0000000000000000e+01 2.0000000000000000e+01 -2.0000000000000000e+01 2.0000000000000000e+01 -2.0000000000000000e+01 2.0000000000000000e+01 ITEM: ATOMS id type x y…
Wall simulations with GPU – User discussions
stephan December 13, 2023, 4:46am 1 GROMACS version: 2022.3GROMACS modification: No Dear all, I want to run a simulation with two repulsive walls to keep the system finite in z while having non-periodic boundary conditions in that dimension.Everything works fine except when offloading bonding interactions to the GPU. I think…
Tafasitamab Quadruplet Determined Safe, Feasible in Newly Diagnosed DLBCL
Lymphoma cells: © Dr_Microbe – stock.adobe.com A targeted combination regimen of lenalidomide (Revlimid), tafasitamab-cxix (Monjuvi), rituximab (Rituxan), and acalabrutinib (LTRA) seemed to be safe and effective in the first line as treatment for patients with newly diagnosed diffuse large B-cell lymphoma (DLBCL), with the addition of cyclophosphamide, doxorubicin, vincristine, and…
Tafasitamab Quadruplet Appears Safe, Feasible in Newly Diagnosed DLBCL
This study inspired investigators to ask whether better outcomes could be achieved via targeted therapies. To do this, investigators chose to examine acalabrutinib—which demonstrated more selectivity and appeared more safe/efficacious with rituximab and CHOP (R-CHOP)—and tafasitamab—which has been successfully combined with lenalidomide and yields high ORRs and CR rates in…
Complete Interim Response, SCT Beats CAR T
Patients with relapsed diffuse large B cell lymphoma (DLBCL) who achieve a complete remission from interim chemotherapy while awaiting secondary chimeric antigen receptor (CAR) T cell therapy show significantly better outcomes if they then receive conventional autologous stem cell transplantation (auto-HCT), compared with CAR T therapy. “In patients with relapsed…
Tafasitamab Quadruplet Shows Efficacy in Newly Diagnosed DLBCL
Jason Westin, MD, MS, FACP The use of tafasitamab-cxix (Monjuvi), lenalidomide (Revlimid), rituximab (Rituxan), and acalabrutinib (Calquence; LTRA) in the first-line setting induced high responses in patients with newly diagnosed diffuse large B-cell lymphoma (DLBCL), with responders deriving benefit from subsequent treatment with cyclophosphamide, doxorubicin, vincristine, and prednisolone (CHOP), according…
Multicenter Study at Sylvester, Other Academic Centers Shows CAR-T Cell Therapy Safe, Effective Even for High-Risk Patients
“CAR-T has caused a paradigm shift in the treatment of patients with diffuse large B-cell lymphoma,” said Jay Y. Spiegel, MD, hematologist-oncologist at Sylvester Comprehensive Cancer Center and the study’s lead presenter at ASH. “Our findings support the vast potential of this therapy, even for high-risk patients, but highlight the…
OPS Molecular Pathology Bioinformatics Specialist job with University of Florida
OPS Molecular Pathology Bioinformatics Specialist Job No: 529638Work Type: Temp Part-TimeLocation: Main Campus (Gainesville, FL)Categories: Biology/Life Science, Information Technology, Grant or Research AdministrationDepartment: 29081100 – MD-PATH – UF PATH LABS Job Description Classification Title: OPS Molecular Pathology Bioinformatics Specialist Job Description: Overview: The Molecular Pathology Laboratory at the University of…
Reproxalap in Patients with Seasonal Allergic Conjunctivitis
Introduction Reproxalap, a novel chemical entity in late-stage clinical development for the treatment of ocular inflammation, chemically sequesters a class of small molecules known as reactive aldehyde species (RASP). Via covalent binding to amine and thiol residues, RASP modulate the structure and function of proteins in an analog manner1 depending…
Measurable Residual Disease-Guided Therapy Promising in CLL
SAN DIEGO — In untreated chronic lymphocytic leukemia (CLL), patients who received ibrutinib plus venetoclax for a duration determined by disease characteristics rather than a fixed schedule had significantly better progression-free and overall survival compared with conventional chemoimmunotherapy, a new phase 3 analysis shows. The targeted therapy combination was also…
ADC Therapeutics Announces Initial Results from
Combination demonstrated clinically meaningful benefit in r/r FL patients with 96% overall response rate and 85% complete response rate LAUSANNE, Switzerland, Dec. 12, 2023 (GLOBE NEWSWIRE) — ADC Therapeutics SA (NYSE: ADCT) today announced initial results from an investigator-initiated Phase 2 clinical trial evaluating ZYNLONTA® (loncastuximab tesirine-lpyl) in combination with…
CAR-T Cell Therapy is Safe, Effective in DLBCL, Including High-Risk Patients
Study results demonstrate that CAR-T cell therapy—a type of immunotherapy that genetically reengineers T cells to help the immune system find and kill cancerous cells—is a safe and effective treatment for diffuse large B-cell lymphoma (DLBCL). In addition, this therapy was found safe in patients who are considered high risk…
Collaborative study shows CAR-T cell therapy safe, effective even for high-risk patients
Credit: Pixabay/CC0 Public Domain CAR-T cell therapy is a safe and effective treatment for diffuse large B-cell lymphoma (DLBCL), even for patients regarded as high risk due to comorbidities. That’s the conclusion of a five-year analysis of results from the U.S. Lymphoma CAR-T Cell Consortium, a group of 17 academic…
Elrexfio can treat relapsed and refractory multiple myeloma in EU
The European Commission has granted conditional marketing authorization to Elrexfio (elranatamab) to treat adults with multiple myeloma who received at least prior three lines of therapy and whose cancer has worsened since their last therapy. The indication covers patients on all 27 countries of the European Union, as well as…
Developments in genetic sequencing for sarcomas
December 12, 2023 4 min watch Add topic to email alerts Receive an email when new articles are posted on Please provide your email address to receive an email when new articles are posted on . “ data-action=”subscribe”> Subscribe We were unable to process…
Bluebird Bio gets gene therapy approval but no business boost
The dual approvals have linked the two drugs, inviting comparisons while positioning the gene-editing drug, called Casgevy, to come out on top, analysts said. Casgevy, developed by Boston-based Vertex Pharmaceuticals and its Swiss partner CRISPR Therapeutics, costs nearly $1 million less than Lyfgenia and has a better safety profile. Bluebird,…
Tome Biosciences Launches with Over $200 Million in Funding to Advance Programmable Genomic Integration Platform
Tome Biosciences Launches with Over $200 Million in Funding to Advance Programmable Genomic Integration Platform Technology, in-licensed from the Massachusetts Institute of Technology (MIT), capable of inserting DNA sequences of any size into any programmed genomic location Potential to create curative cell and integrative gene therapies Backed by leading biotech…
CRISPR Therapeutics (NASDAQ:CRSP) Downgraded to “Underperform” at TD Cowen
TD Cowen lowered shares of CRISPR Therapeutics (NASDAQ:CRSP – Free Report) from a market perform rating to an underperform rating in a research note released on Monday, Marketbeat Ratings reports. They currently have $30.00 price objective on the stock. Other research analysts also recently issued reports about the stock. StockNews.com…
Exploring glycosylation patterns in oral cancer
Oral squamous cell carcinoma, or OSCC, a cancer that affects the mouth, is an aggressive disease with a dishearteningly low survival rate. Doctors usually estimate an OSCC prognosis based on the size of the tumor at diagnosis and whether the cancer has spread to lymph nodes and other areas. This…
Transition of allele-specific DNA hydroxymethylation at regulatory loci is associated with phenotypic variation in monozygotic twins discordant for psychiatric disorders | BMC Medicine
Lichtenstein P, Yip BH, Bjork C, Pawitan Y, Cannon TD, Sullivan PF, Hultman CM. Common genetic determinants of schizophrenia and bipolar disorder in Swedish families: a population-based study. Lancet. 2009;373(9659):234–9. Article PubMed Google Scholar Maurano MT, Humbert R, Rynes E, Thurman RE, Haugen E, Wang H, Reynolds AP, Sandstrom R,…
Circulating Tumor DNA Monitors Hodgkin Lymphoma Prognosis
A Stanford Medicine-led, international study of hundreds of samples from patients with Hodgkin lymphoma has shown that levels of tumor DNA circulating in their blood can identify who is responding well to treatment and others who are likely to experience a disease recurrence — potentially letting some patients who are…
Hodgkin lymphoma prognosis, biology tracked with circulating tumor DNA | News Center
A Stanford Medicine-led, international study of hundreds of samples from patients with Hodgkin lymphoma has shown that levels of tumor DNA circulating in their blood can identify who is responding well to treatment and others who are likely to experience a disease recurrence — potentially letting some patients who are predicted…
Odronextamab Shows “Encouraging” Activity in Relapsed/Refractory DLBCL
Odronextamab has demonstrated efficacy in patients with relapsed or refractory diffuse large B-cell lymphoma (DLBCL), according to research presented at the ASH Annual Meeting 2023. Final results from the ELM-2 trial confirmed the “encouraging” clinical activity of odronextamab in these heavily pretreated patients, said study presenter Sabarish Ayyappan, MD, of…
Trem-cel a CRISPR/Cas9-Edited Allograft Devoid of CD33 Shows Rapid Engraftment in High-Risk Acute Myeloid Leukemia
Trem-cel, a CRISPR/Cas9 gene-edited allograft, demonstrated rapid primary engraftment among patients with high-risk acute myeloid leukemia (AML), according to results of a study that were presented at the ASH Annual Meeting 2023. Trem-cel (VOR33) uses CRISPR/Cas9 technology to delete CD33 in allograft tissue. It was developed to protect normal hematopoietic…
Racial, ethnic disparities in mortality risk shown among younger patients with DLBCL
December 11, 2023 3 min read Add topic to email alerts Receive an email when new articles are posted on Please provide your email address to receive an email when new articles are posted on . ” data-action=subscribe> Subscribe We were unable to process your request. Please try again later….
Novartis reports success in phase 3 trial of drug for rare kidney disease
Pharmaceutical maker and biotechnology company Novartis is reporting positive topline results from a phase 3 trial of a drug to treat a rare kidney disease. Patients with the kidney disease, C3 glomerulopathy, who were taking 200 mg of iptacopan — also called Fabhalta — twice daily for six months were…
American Telemedicine Association announces new Clinician Council
© Jackie Niam – stock.adobe.com Physicians will help a national group guide American health care policy for virtual care. The American Telemedicine Association (ATA) announced a new Clinician Council “to address barriers to the broad adoption of telehealth and virtual care delivery, including emerging platforms that support technology-enabled health care.” The…
Relapsed DLBCL: With Complete Interim Response, SCT Outperforms CAR T
Patients with relapsed diffuse large B cell lymphoma (DLBCL) who achieve a complete remission from interim chemotherapy while awaiting secondary chimeric antigen receptor (CAR) T cell therapy show significantly better outcomes if they then receive conventional autologous stem cell transplantation (auto-HCT), compared with CAR T therapy. “In patients with relapsed…
Liquid Biopsy Uses ctDNA to Predict Recurrence of Hodgkin Lymphoma
A Stanford Medicine-led, international study of hundreds of samples from patients with classic Hodgkin lymphoma (cHL) has shown that levels of tumor DNA circulating in the blood can identify those individuals who are responding well to treatment and those who are likely to experience a disease recurrence. The study results suggest…
How to restrain to some specified waters for OPC model – User discussions
Shin December 11, 2023, 1:24am 1 GROMACS version:2021.6GROMACS modification: NoHere post your questionDear Gromacs usersI have the same problem as inHow to treat specific water molecules as ligand?. I’m setting .top file for MD simulation with OPC model for water.I want to use positional constraints on the three waters(name: FIX)…
Results Show Strong Responses for Brentuximab Vedotin Plus Nivolumab Combo in Patients With cHL
Pairing brentuximab vedotin with nivolumab in a 4-drug regimen yielded highly positive responses in patients with various stages of classical Hodgkin lymphoma (cHL), according to data from 2 abstracts presented Sunday. Results showed 100% of patients with early-stage disease remained progression-free at 12 months,1 while 88% of those with advanced…
Genetic architecture of cardiac dynamic flow volumes
Virani, S. S. et al. Heart disease and stroke statistics-2021 update: a report from the American Heart Association. Circulation 143, e254–e743 (2021). Article PubMed Google Scholar Nauffal, V. et al. Genetics of myocardial interstitial fibrosis in the human heart and association with disease. Nat. Genet. 55, 777–786 (2023). Article CAS …
STWOA Success | News, Sports, Jobs
Southwestern’s Tavio Hoose works on top of St. Francis’ Zachary Caldwell during the 190-pound final at the Southern Tier Wrestling Officials Association Tournament on Saturday at Jamestown Community College’s Physical Education Complex. Hoose won 8-1. Photo courtesy of Shelly Phillips The Southern Tier Wrestling Officials Association Kickoff Classic featured plenty…
Is Lifelong LDL-C Lowering Within Reach?
This transcript has been edited for clarity. Michelle L. O’Donoghue, MD, MPH: Hi. This is Dr Michelle O’Donoghue, reporting for Medscape. I’m here at the American Heart Association meeting, and one of the interesting stories that we’re going to be talking about is that of gene editing. Joining me to…
Calculate Jukes-Cantor, Kimura, Tamura-Nei etc distances from BAM files
Calculate Jukes-Cantor, Kimura, Tamura-Nei etc distances from BAM files 0 Hi, Does anyone know if there’s an existing tool to calculate genetic distances between query and subject sequences in BAMs/SAMs? I’m reasonably sure it’s possible to identify transitions and transversions using data from the MD flag and the sequence, and…
Study Links Gene Network To Diabetes 2
In a collaborative effort co-led by teams from Vanderbilt University Medical Center (VUMC) and the University of Michigan, a comprehensive study that integrates multiple analytic approaches has linked a regulatory gene network and functional defects in insulin-producing pancreatic beta cells to Type 2 diabetes. The study, published in the journal…
Next-generation sequencing emerges as innovative tool to detect orthopedic infections
December 11, 2023 6 min read Add topic to email alerts Receive an email when new articles are posted on Please provide your email address to receive an email when new articles are posted on . “ data-action=”subscribe”> Subscribe We were unable to process…
Is Genome Editing the Next Step in Immunotherapy Innovation? Experts Think So
Just a few years ago, chimeric antigen receptor (CAR) T-cell therapy was brand new, offering a novel solution for populations of patients who were short on options and typically faced grim prognoses. But this weekend at the American Society of Hematology Annual Meeting and Exposition, a presentation saw experts in…
The first news, views & information website of TRIPURA.
HEPATITIS B ELIMINATION IN TRIPURA, NORTH EAST INDIA: THE HISTORIC TRIPURA MODEL Dr Pradip Bhaumik.MD, Ph. D. December 11, 2023, 10:13:12 Professor, Agartala Govt Medical College and Founder President. Hepatitis Foundation Of Tripura. INTRODUCTION: Liver is seat soul. For thousands of year Liver is known to be one of the…
Matthew Porteus Launches Kamau with Positive Nula-Cell Patient Zero Results
By Jonathan D. Grinstein, PhD What a difference a year makes. Almost 12 months ago, the hopes of Stanford University physician-scientist Matthew Porteus, MD, PhD, to implement a genome editing therapy for sickle cell disease (SCD) seemed all but lost. On January 5, 2023, the company he co-founded, Graphite Bio,…
Zanubrutinib Showcases Sustained PFS Benefit Vs Ibrutinib in R/R CLL/SLL
Jennifer R. Brown, MD, PhD Zanubrutinib (Brukinsa) continued to demonstrate improved progression-free survival (PFS) benefit over ibrutinib (Imbruvica) in the treatment of patients with relapsed/refractory chronic lymphocytic leukemia (CLL) and small lymphocytic lymphoma (SLL), according to extended follow-up data from the phase 3 ALPINE trial (NCT03734016) presented at the 2023…
Azafaros’ Phase 2 RAINBOW study, evaluating nizubaglustat in GM2 and NPC patients, is now fully enrolled
Azafaros’ Phase 2 RAINBOW study, evaluating nizubaglustat in GM2 and NPC patients, is now fully enrolled Azafaros’ Phase 2 RAINBOW study, evaluating nizubaglustat in GM2 and NPC patients, is now fully enrolled Topline data from the study, expected for mid-2024, will support two pivotal Phase 3 trials in GM1 and…
Bristol-Myers Squibb (BMY) Reports Primary Efficacy and Safety Analysis of the Phase 3 COMMANDS Trial of Reblozyl
Bristol Myers Squibb (NYSE: BMY) announced updated results from the primary analysis of the Phase 3 COMMANDS trial, comparing Reblozyl® (luspatercept-aamt) versus epoetin alfa for the treatment of anemia in erythropoiesis stimulating agent (ESA)-naïve patients with lower-risk myelodysplastic syndromes (MDS) (Oral Presentation #193) who may require red blood cell (RBC)…
The Helicobacter pylori Genome Project: insights into H. pylori population structure from analysis of a worldwide collection of complete genomes
Department of Chemistry and Molecular Biology, University of Gothenburg, Gothenburg, Sweden Kaisa Thorell Facultad de Ciencias Químicas, Universidad Autónoma de Chihuahua, Chihuahua, Chihuahua, México Zilia Y. Muñoz-Ramírez Cancer Genomics Research Laboratory, Frederick National Laboratory for Cancer Research, Frederick, MD, USA Difei Wang, Yunhu Wan, Belynda Hicks, Bin Zhu, Meredith Yeager, Amy Hutchinson, Kedest Teshome, Kristie Jones & Wen Luo…
Valemetostat Provides “Clinically Meaningful Benefit” in Relapsed/Refractory PTCL
Valemetostat has demonstrated activity in patients with relapsed or refractory peripheral T-cell lymphoma (PTCL), according to research presented at the ASH Annual Meeting 2023. “Valemetostat demonstrated high rates of response and durable responses in patients with relapsed/refractory peripheral T-cell lymphoma,” said study presenter Steven M. Horwitz, MD, of Memorial Sloan…
Odronextamab Continues to Appear Safe, Effective in Patients With R/R DLBCL
Treatment with odronextamab (REGN1979) led to an objective response rate (ORR) of 52%, with encouraging progression-free (PFS) and overall survival (OS) among complete responders in a cohort of patients with relapsed/refractory diffuse large B-cell lymphoma (DLBCL), according to a final analysis of the phase 2 ELM-2 trial (NCT03888105) presented at…
Real-World Data Show Oral Decitabine/Cedazuridine Regimen Is Comparable With IV/SC HMAs in MDS
“It’s hoped that [longer persistence with oral DEC-C] would translate to better outcomes because those patients are able to stay on a treatment that takes time to work,” said Amer Zeidan, MD, in a presentation during the meeting. Retrospective, real-world results showed that oral decitabine and cedazuridine (DEC-C) and standard…
Genetic and clinical characteristics of PROM1-related retinal degeneration in Korean
The present study elucidated a high proportion of autosomal dominant variants PROM1 p.R373C in Korean PROM1-associated retinal degeneration, in Korean cases of PROM1-associated retinal degeneration, along with a substantial degree of interfamilial and intrafamilial phenotypic variability in PROM1 p.R373C-associated retinal degeneration. This high phenotypic variability underscores the intricate nature of…
Pilot study uses circulating tumor DNA to reliably predict relapse in patients with diffuse large B-cell lymphoma (DLBCL)
MAESTRO-Pool, a means of detecting circulating tumor DNA (ctDNA), could be sensitive and selective enough to help guide treatment decisions. Dana-Farber Cancer Institute investigators, in collaboration with researchers from the Broad Institute, demonstrated in a retrospective clinical study that a novel test for ctDNA was more sensitive and more specific…
FGFR2 point mutation in 2 cases of pleomorphic adenoma progressing to myoepithelial carcinoma
1. Carlson ER, Schlieve T. Salivary gland malignancies. Oral Maxillofac Surg Clin North Am 2019; 31: 125-144. 2. Seethala RR. Salivary gland tumors: current concepts and controversies. Surg Pathol Clin 2017; 10: 155-176. 3. Bradley PJ, McGurk M. Incidence of salivary gland neoplasms in a defined UK population….
What the most accurate potential to use for the simulation of gas diffusion in PE? – LAMMPS General Discussion
Bo_Lin6 December 10, 2023, 1:04pm 1 Dear LAMMPS users, I’m a new beginner using LAMMPS for molecular dynamic simulation. I am currently working on modeling the sorption and diffusion between polyethylene and methane using LAMMPS. I obtained a polyethylene system from this source: Atomistic Deformation of Amorphous Polyethylene – EVOCDI…
Adding Navitoclax to Ruxolitinib Doubles Spleen Volume Reductions for Myelofibrosis
Up-front treatment with the combination of navitoclax and ruxolitinib (Jakafi) significantly reduced spleen volume by 35% or more at week 24 (SVR35W24) compared with ruxolitinib plus placebo for patients with myelofibrosis; however, a significant difference was not observed in total symptom score (TSS) version 4.0 between the arms, according to…
Marstacimab May Reduce Bleeding in Hemophilia A and B
Compared with previous on-demand (OD) or routine prophylaxis (RP) therapy, once weekly subcutaneous marstacimab appears to be safe and effective for reducing bleeding events in patients with severe hemophilia A (HA) or moderately severe to severe hemophilia B (HB) without inhibitors beyond 12 months, according to a phase 3 study….
Khan Discusses Third-Line Novel Treatment Approaches for R/R DLBCL
Cyrus M. Khan, MD (MODERATOR) Hematologist Division of Hematology and Cellular Therapy West Penn Hospital of Allegheny Health Network Pittsburgh, PA EVENT REGION Pennsylvania PARTICIPANT LIST Haixia Qin, MD, PhD | Simi Rai, MD | Naeem Latif, MD | Alexander Barsouk, MD | Gurprataap Sanhu, MD | Hayman Salib, MD…
Phase 2 of Halo Tiles COE Opening & Launch of Phase 3
Wexford GAA open Phase 2 of Halo Tiles Wexford GAA Centre of Excellence and launch Phase 3 developments in association with Wexford Camogie and Wexford LGFA At the official opening of Phase 2 of Halo Tiles Wexford GAA Centre of Excellence were: Linda Kenny (Chair Leinster Camogie), Derek Kent (Chair…
Comparison between two MD – User discussions
lilian December 10, 2023, 6:27am 1 GROMACS version: 2020GROMACS modification: No Hi gmx users,I did two simulations. 1) polymer(x)-drug and 2) polymer(y)-drug. In these two simulations, the polymers are different but the drugs are the same.According to the structure and shape of the polymers, the size of the box is…
Sanofi multiple myeloma drug Sarclisa phase 3 trial meets primary endpoint of progression-free survival
Paris: Sanofi has announced that the Phase 3 IMROZ trial evaluating the investigational use of Sarclisa (isatuximab) in combination with standard-of-care bortezomib, lenalidomide and dexamethasone (VRd) met its primary endpoint at a planned interim analysis for efficacy, demonstrating statistically significant improvement in progression-free survival (PFS) compared with VRd alone in…
Huge Etotal difference between TIP4p implicit VS explicit methods from the manual script – LAMMPS Beginners
Have you read the manual: Yes. I used the scripts from Lammps manualMD simulation experience: Yes, several years, with Gromacs, Amber and OpenMMLammps experience: No. Started recentlyLammps version: 20230208Lammps execution command: mpirun -np xxx lmp -in in.tip4pCan you provide your input scripts and results: Yes. Please check this: Input scripts…
Diversity in minimal periodic distance in different 200-ns MD simulations – User discussions
GROMACS version: 2022.4GROMACS modification: Yes/No noHere post your questionDear GROMACS users I have completed a protein (WT & mutant) simulation for 200 ns in triplicates using Amber99sb force filed and TIP3P water model. I have used both cubic and dodecahedron boxes with a distance of 1.0 nm from the box…
Lower Relapse Rates Suggest Limited Value for Prophylaxis in DLBCL
SAN ANTONIO—Up to 40% of patients with diffuse large B-cell lymphoma (DLBCL) relapse or progress following first-line chemoimmunotherapy. Given the high rate of relapse, identifying the characteristics and outcomes associated with veterans with DLBCL who relapse could enable better monitoring or quicker intervention and potentially extend survival. In an effort…
Older DLBCL Patients Overestimate Chance for Cure, Survey Says
A new survey shows that older adults with aggressive non-Hodgkin lymphoma tend to overestimate their chance for a cure, highlighting a need for better patient education. Results were presented at the 65th ASH Annual Meeting and Exposition by Netana Markovitz, MD, of Beth Israel Deaconess Medical Center in Boston, and…
Kamau Therapeutics Emerges from Stealth With Clinical-Stage Novel Gene Correction Technology Targeting Life-Threatening Genetic Diseases | DNA RNA and Cells
Kamau Therapeutics Emerges from Stealth With Clinical-Stage Novel Gene Correction Technology Targeting Life-Threatening Genetic Diseases Details Category: DNA RNA and Cells Published on Saturday, 09 December 2023 13:02 Hits: 162 Clinical data on lead program, nula-cel, demonstrating curative outcome in first treated patient with sickle cell disease (SCD) to…
Scenic Biotech Announces Positive Preclinical Data for its QPCTL Inhibitor SC-2882 as Potential New Therapeutic Approach for Diffuse Large B-Cell Lymphoma
SC-2882 shows anti-lymphoma and anti-immunosuppression effect in a mouse model for diffuse large B-Cell lymphoma Data presented today, December 9, at the 65th ASH Annual Meeting & Exposition in San Diego, CA, by Leandro Cerchietti, MD, Richard A. Stratton Associate Professor in Hematology and Oncology at Weill Cornell Medicine, New…
Improvements in Stem Cell Transplants for AML With CRISPR
Guenther Koehne, MD, PhD, deputy director and chief of blood and marrow Transplant, hematologic oncology and benign hematology, Baptist Health Medical Group, discusses a phase 1/2 study (NCT04849910) where he served as the principal investigator. The abstract is being presented at this year’s American Society of Hematology 2023 Annual Meeting….
A naturally occurring polyacetylene isolated from carrots promotes health and delays signatures of aging
Cell culture conditions Unless otherwise stated, cells were cultured with DMEM (Sigma Aldrich; #D6429) and 4.5 g/l glucose, phenol red, 10% FBS, and 1% penicillin/streptomycin with pH 7.4 and were incubated at 37 °C, 5% CO2, and 95% relative humidity. Wild-type HepG2 (#300198), HEK293 (#300192), and MCF-7 (#300273) were derived from CLS…
Theranostics Market Size Share Value Insights and Forecast 2023-2030
The global theranostics market is expected to exhibit a CAGR of 11.3% during the forecast period (2023-2030). Theranostics, a portmanteau of therapy and diagnostics, refers to an emerging field in medicine that combines diagnostics and targeted therapy. Theranostics Market Overview Global Theranostics Market Poised for Remarkable Growth, Projected to Reach…
Postdoctoral Associate- Bioinformatics/Genomics job with Baylor College of Medicine
Summary A postdoctoral position is immediately available in the Gallo laboratory to study, plan, direct and conduct specialized and advanced bioinformatics and genomics research in neuro-oncology. This position will be responsible to conduct computational studies aimed at discovering new principles underlying brain tumor biology. The successful candidate will have opportunities…
US FDA approves two gene therapies to treat patients with sickle cell disease
WASHINGTON: The US Food and Drug Administration approved two gene therapies for the treatment of sickle cell disease (SCD) in patients aged 12 years and above. Casgevy, a cell-based gene therapy, is approved for the treatment of sickle celldisease in patients 12 years of age and older with recurrent vaso-occlusive…
DE Jobs – Elevance Health Business Information SQL / RStudio Developer in MIAMI, Florida, United States
WARNING: Please beware of phishing scams that solicit interviews or promote work-at-home opportunities, some of which may pose as legitimate companies. Elevance Health requires a completed online application for consideration of employment for any position. We will never ask you for a credit card, send you a check, or ask…
CIGAR and query sequence lengths differ
I am developing a program that softclips reads. When I run samtools view the_new_bam_created_with_my_softclipped_read.bam I get this error message MN01972:51:000H5KYKL:1:11101:10749:1220 0 chr2 208248363 60 24S77M25S * 0 0 CAAAATCACATTATTGCCAACATGACTTACTTGATCCCCATAAGCATGACGACCTATGATGATAGGTTTTACCCATCCACTCACAAGCCGGGGGATATTTTTGCAGATAATGGCTTCTCTGAAGAC AFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF[E::bam_read1] CIGAR and query sequence lengths differ for MN01972:51:000H5KYKL:1:11101:10753:13456 FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFAFFFFFFFFFFFFFFFFFFFFF MD:Z:126 RG:Z:230824_MN01972_0051_A000H5KYKL_RACP1_4poolv7anddirect_A NM:i:0 UQ:i:0 AS:i:126 MN01972:51:000H5KYKL:1:11101:10753:13456 0 chr2 208248339 60 111M2D13M…
Holiday Merriment and Sharing the Microbiome
Kirsten D/peopleimages.com/Adobe Stock The holidays are upon us, with many opportunities to visit with extended family members, renew old friendships, and spread cheer to neighbors and workmates. It is a wonderful time of year for human gatherings, providing a chance to share updated activities from the past year, exchange ideas,…
rstudio projects examples, rstudio project download, r projects examples, rstudio project template, rstudio project github, rstudio projects for beginners, r projects for beginners, delete rstudio project
RStudio projects are a convenient way to organize your R code and data analysis work. Here are some examples of RStudio projects and how to work with them: 1. Creating an RStudio Project: To create an RStudio project, follow these steps: Open RStudio. Go to “File” > “New Project…” Choose…
Refurbished DNA Sequencing Platforms Market Insights, Market Players and Forecast Till 2030
{“payload”:{“allShortcutsEnabled”:false,”fileTree”:{“”:{“items”:[{“name”:”1-1-carbonyldiimidazole-market.md”,”path”:”1-1-carbonyldiimidazole-market.md”,”contentType”:”file”},{“name”:”1-o-tolyl-biguanide-market.md”,”path”:”1-o-tolyl-biguanide-market.md”,”contentType”:”file”},{“name”:”1080p-projector-market.md”,”path”:”1080p-projector-market.md”,”contentType”:”file”},{“name”:”12-propanediol-diacetate-market.md”,”path”:”12-propanediol-diacetate-market.md”,”contentType”:”file”},{“name”:”2-naphthaleneboronic-acid-market.md”,”path”:”2-naphthaleneboronic-acid-market.md”,”contentType”:”file”},{“name”:”3-dimethylaminopiperidine-cas-50534-49-1-market.md”,”path”:”3-dimethylaminopiperidine-cas-50534-49-1-market.md”,”contentType”:”file”},{“name”:”3-dimethylaminopropylchloride-hydrochloride-cas-5407-04-5-market.md”,”path”:”3-dimethylaminopropylchloride-hydrochloride-cas-5407-04-5-market.md”,”contentType”:”file”},{“name”:”34-dichlorotoluene-market.md”,”path”:”34-dichlorotoluene-market.md”,”contentType”:”file”},{“name”:”4-butylresorcinol-market.md”,”path”:”4-butylresorcinol-market.md”,”contentType”:”file”},{“name”:”6-hydroxy-2-naphthoic-acid-market.md”,”path”:”6-hydroxy-2-naphthoic-acid-market.md”,”contentType”:”file”},{“name”:”ac-dc-cable-assembly-market.md”,”path”:”ac-dc-cable-assembly-market.md”,”contentType”:”file”},{“name”:”active-metal-brazed-amb-substrates-market.md”,”path”:”active-metal-brazed-amb-substrates-market.md”,”contentType”:”file”},{“name”:”aero-engine-fan-blade-market.md”,”path”:”aero-engine-fan-blade-market.md”,”contentType”:”file”},{“name”:”aerospace-hydraulic-motors-market.md”,”path”:”aerospace-hydraulic-motors-market.md”,”contentType”:”file”},{“name”:”agricultural-work-clothes-market.md”,”path”:”agricultural-work-clothes-market.md”,”contentType”:”file”},{“name”:”aircraft-cooling-turbines-market.md”,”path”:”aircraft-cooling-turbines-market.md”,”contentType”:”file”},{“name”:”alloy-saw-blades-market.md”,”path”:”alloy-saw-blades-market.md”,”contentType”:”file”},{“name”:”aluminum-base-pcbs-market.md”,”path”:”aluminum-base-pcbs-market.md”,”contentType”:”file”},{“name”:”anti-counterfeit-beverages-packaging-market.md”,”path”:”anti-counterfeit-beverages-packaging-market.md”,”contentType”:”file”},{“name”:”anti-odor-filters-market.md”,”path”:”anti-odor-filters-market.md”,”contentType”:”file”},{“name”:”anti-pollution-skin-care-market.md”,”path”:”anti-pollution-skin-care-market.md”,”contentType”:”file”},{“name”:”anti-radiation-maternity-clothes-market.md”,”path”:”anti-radiation-maternity-clothes-market.md”,”contentType”:”file”},{“name”:”arthroscopy-fluid-management-systems-market.md”,”path”:”arthroscopy-fluid-management-systems-market.md”,”contentType”:”file”},{“name”:”asphalt-additives-and-modifiers-market.md”,”path”:”asphalt-additives-and-modifiers-market.md”,”contentType”:”file”},{“name”:”asphalt-milling-device-market.md”,”path”:”asphalt-milling-device-market.md”,”contentType”:”file”},{“name”:”atorvastatin-calcium-api-market.md”,”path”:”atorvastatin-calcium-api-market.md”,”contentType”:”file”},{“name”:”automated-heavy-duty-truck-market.md”,”path”:”automated-heavy-duty-truck-market.md”,”contentType”:”file”},{“name”:”automated-material-handling-equipment-amhe-market.md”,”path”:”automated-material-handling-equipment-amhe-market.md”,”contentType”:”file”},{“name”:”automated-ophthalmic-perimeters-market.md”,”path”:”automated-ophthalmic-perimeters-market.md”,”contentType”:”file”},{“name”:”automotive-butyl-adhesives-market.md”,”path”:”automotive-butyl-adhesives-market.md”,”contentType”:”file”},{“name”:”automotive-cmos-image-sensors-cis-market.md”,”path”:”automotive-cmos-image-sensors-cis-market.md”,”contentType”:”file”},{“name”:”automotive-fakra-connectors-market.md”,”path”:”automotive-fakra-connectors-market.md”,”contentType”:”file”},{“name”:”automotive-molded-rubber-parts-market.md”,”path”:”automotive-molded-rubber-parts-market.md”,”contentType”:”file”},{“name”:”automotive-roller-bearings-market.md”,”path”:”automotive-roller-bearings-market.md”,”contentType”:”file”},{“name”:”automotive-vacuum-cleaner-market.md”,”path”:”automotive-vacuum-cleaner-market.md”,”contentType”:”file”},{“name”:”bamboo-chairs-market.md”,”path”:”bamboo-chairs-market.md”,”contentType”:”file”},{“name”:”barium-metatitanate-barium-titanate-ceramics-market.md”,”path”:”barium-metatitanate-barium-titanate-ceramics-market.md”,”contentType”:”file”},{“name”:”battery-copper-foil-market.md”,”path”:”battery-copper-foil-market.md”,”contentType”:”file”},{“name”:”bearing-locating-rings-market.md”,”path”:”bearing-locating-rings-market.md”,”contentType”:”file”},{“name”:”bellow-mechanical-seals-market.md”,”path”:”bellow-mechanical-seals-market.md”,”contentType”:”file”},{“name”:”biochemical-diagnostic-reagent-market.md”,”path”:”biochemical-diagnostic-reagent-market.md”,”contentType”:”file”},{“name”:”biodetectors-market.md”,”path”:”biodetectors-market.md”,”contentType”:”file”},{“name”:”bm-series-film-evaporator-market.md”,”path”:”bm-series-film-evaporator-market.md”,”contentType”:”file”},{“name”:”calcium-gluconate-chewable-tablet-market.md”,”path”:”calcium-gluconate-chewable-tablet-market.md”,”contentType”:”file”},{“name”:”campus-recruitment-process-outsourcing-market.md”,”path”:”campus-recruitment-process-outsourcing-market.md”,”contentType”:”file”},{“name”:”cancer-vaccines-drug-pipeline-market.md”,”path”:”cancer-vaccines-drug-pipeline-market.md”,”contentType”:”file”},{“name”:”cardio-respiratory-stress-test-equipment-market.md”,”path”:”cardio-respiratory-stress-test-equipment-market.md”,”contentType”:”file”},{“name”:”catalytic-muffler-market.md”,”path”:”catalytic-muffler-market.md”,”contentType”:”file”},{“name”:”cell-culture-supporting-equipment-market.md”,”path”:”cell-culture-supporting-equipment-market.md”,”contentType”:”file”},{“name”:”cervix-spatulas-market.md”,”path”:”cervix-spatulas-market.md”,”contentType”:”file”},{“name”:”charging-interface-control-unit-market.md”,”path”:”charging-interface-control-unit-market.md”,”contentType”:”file”},{“name”:”chlorodifluoroacetic-acid-market.md”,”path”:”chlorodifluoroacetic-acid-market.md”,”contentType”:”file”},{“name”:”choroidal-neovascularization-drug-market.md”,”path”:”choroidal-neovascularization-drug-market.md”,”contentType”:”file”},{“name”:”clothing-steamer-market.md”,”path”:”clothing-steamer-market.md”,”contentType”:”file”},{“name”:”coated-fabrics-defense-market.md”,”path”:”coated-fabrics-defense-market.md”,”contentType”:”file”},{“name”:”coloured-smart-glass-market.md”,”path”:”coloured-smart-glass-market.md”,”contentType”:”file”},{“name”:”commercial-multi-deck-refrigerated-display-cases-market.md”,”path”:”commercial-multi-deck-refrigerated-display-cases-market.md”,”contentType”:”file”},{“name”:”commercial-vehicle-motor-oil-market.md”,”path”:”commercial-vehicle-motor-oil-market.md”,”contentType”:”file”},{“name”:”companion-animal-external-parasiticide-market.md”,”path”:”companion-animal-external-parasiticide-market.md”,”contentType”:”file”},{“name”:”condiment-and-sauce-flexible-packaging-market.md”,”path”:”condiment-and-sauce-flexible-packaging-market.md”,”contentType”:”file”},{“name”:”consumer-food-delivery-market.md”,”path”:”consumer-food-delivery-market.md”,”contentType”:”file”},{“name”:”consumer-grade-ssds-market.md”,”path”:”consumer-grade-ssds-market.md”,”contentType”:”file”},{“name”:”contact-center-infrastructure-cci-software-market.md”,”path”:”contact-center-infrastructure-cci-software-market.md”,”contentType”:”file”},{“name”:”cooling-coils-market.md”,”path”:”cooling-coils-market.md”,”contentType”:”file”},{“name”:”cordierite-dpf-market.md”,”path”:”cordierite-dpf-market.md”,”contentType”:”file”},{“name”:”cosmetic-and-toiletry-chemicals-market.md”,”path”:”cosmetic-and-toiletry-chemicals-market.md”,”contentType”:”file”},{“name”:”crosslinked-polyvinylpolypyrrolidone-pvpp-market.md”,”path”:”crosslinked-polyvinylpolypyrrolidone-pvpp-market.md”,”contentType”:”file”},{“name”:”data-center-accelerator-card-market.md”,”path”:”data-center-accelerator-card-market.md”,”contentType”:”file”},{“name”:”deep-ultraviolet-duv-lithography-systems-market.md”,”path”:”deep-ultraviolet-duv-lithography-systems-market.md”,”contentType”:”file”},{“name”:”diesel-vehicle-exhaust-fluid-market.md”,”path”:”diesel-vehicle-exhaust-fluid-market.md”,”contentType”:”file”},{“name”:”diethylene-glycol-acetate-n-butyl-ether-market.md”,”path”:”diethylene-glycol-acetate-n-butyl-ether-market.md”,”contentType”:”file”},{“name”:”digital-subscriber-line-dsl-chipsets-market.md”,”path”:”digital-subscriber-line-dsl-chipsets-market.md”,”contentType”:”file”},{“name”:”din-rail-dc-ups-market.md”,”path”:”din-rail-dc-ups-market.md”,”contentType”:”file”},{“name”:”disposable-bagasse-plates-market.md”,”path”:”disposable-bagasse-plates-market.md”,”contentType”:”file”},{“name”:”drilling-machine-drilling-center-market.md”,”path”:”drilling-machine-drilling-center-market.md”,”contentType”:”file”},{“name”:”duck-feed-market.md”,”path”:”duck-feed-market.md”,”contentType”:”file”},{“name”:”dupuytren-contracture-drug-market.md”,”path”:”dupuytren-contracture-drug-market.md”,”contentType”:”file”},{“name”:”e-books-market.md”,”path”:”e-books-market.md”,”contentType”:”file”},{“name”:”e-liquid-e-juice-market.md”,”path”:”e-liquid-e-juice-market.md”,”contentType”:”file”},{“name”:”e-series-glycol-ethers-market.md”,”path”:”e-series-glycol-ethers-market.md”,”contentType”:”file”},{“name”:”electric-sliding-door-market.md”,”path”:”electric-sliding-door-market.md”,”contentType”:”file”},{“name”:”electrical-spa-table-market.md”,”path”:”electrical-spa-table-market.md”,”contentType”:”file”},{“name”:”electronic-grade-phosphoric-acid-market.md”,”path”:”electronic-grade-phosphoric-acid-market.md”,”contentType”:”file”},{“name”:”emergency-response-driving-simulator-market.md”,”path”:”emergency-response-driving-simulator-market.md”,”contentType”:”file”},{“name”:”enclosure-electric-heaters-market.md”,”path”:”enclosure-electric-heaters-market.md”,”contentType”:”file”},{“name”:”ensartinib-market.md”,”path”:”ensartinib-market.md”,”contentType”:”file”},{“name”:”enterprise-memory-market.md”,”path”:”enterprise-memory-market.md”,”contentType”:”file”},{“name”:”excavator-pump-valve-market.md”,”path”:”excavator-pump-valve-market.md”,”contentType”:”file”},{“name”:”extra-thick-steel-plate-market.md”,”path”:”extra-thick-steel-plate-market.md”,”contentType”:”file”},{“name”:”eye-drops-and-eye-ointments-market.md”,”path”:”eye-drops-and-eye-ointments-market.md”,”contentType”:”file”},{“name”:”fastener-type-scaffolding-market.md”,”path”:”fastener-type-scaffolding-market.md”,”contentType”:”file”},{“name”:”fetal-bovine-serum-for-life-sciences-market.md”,”path”:”fetal-bovine-serum-for-life-sciences-market.md”,”contentType”:”file”},{“name”:”fiber-optic-gyros-fogs-market.md”,”path”:”fiber-optic-gyros-fogs-market.md”,”contentType”:”file”},{“name”:”fiber-reinforced-polymer-frp-panels-and-sheets-market.md”,”path”:”fiber-reinforced-polymer-frp-panels-and-sheets-market.md”,”contentType”:”file”},{“name”:”fire-retardant-floor-market.md”,”path”:”fire-retardant-floor-market.md”,”contentType”:”file”},{“name”:”fish-feed-sticks-market.md”,”path”:”fish-feed-sticks-market.md”,”contentType”:”file”},{“name”:”fishmeal-feed-market.md”,”path”:”fishmeal-feed-market.md”,”contentType”:”file”},{“name”:”flow-cytometry-instruments-market.md”,”path”:”flow-cytometry-instruments-market.md”,”contentType”:”file”},{“name”:”fluorine-containing-electronic-chemicals-market.md”,”path”:”fluorine-containing-electronic-chemicals-market.md”,”contentType”:”file”},{“name”:”food-tracking-technologies-market.md”,”path”:”food-tracking-technologies-market.md”,”contentType”:”file”},{“name”:”forklift-pedestrian-warning-system-market.md”,”path”:”forklift-pedestrian-warning-system-market.md”,”contentType”:”file”},{“name”:”frd-module-market.md”,”path”:”frd-module-market.md”,”contentType”:”file”},{“name”:”frozenn-chayote-market.md”,”path”:”frozenn-chayote-market.md”,”contentType”:”file”},{“name”:”fruit-cup-market.md”,”path”:”fruit-cup-market.md”,”contentType”:”file”},{“name”:”gamified-lms-for-elearning-market.md”,”path”:”gamified-lms-for-elearning-market.md”,”contentType”:”file”},{“name”:”gas-delivery-systems-market.md”,”path”:”gas-delivery-systems-market.md”,”contentType”:”file”},{“name”:”genistein-market.md”,”path”:”genistein-market.md”,”contentType”:”file”},{“name”:”glass-light-guide-plate-market.md”,”path”:”glass-light-guide-plate-market.md”,”contentType”:”file”},{“name”:”glass-top-display-freezers-market.md”,”path”:”glass-top-display-freezers-market.md”,”contentType”:”file”},{“name”:”glycine-food-grade-market.md”,”path”:”glycine-food-grade-market.md”,”contentType”:”file”},{“name”:”grape-harvesters-market.md”,”path”:”grape-harvesters-market.md”,”contentType”:”file”},{“name”:”graphene-based-materials-for-water-purification-market.md”,”path”:”graphene-based-materials-for-water-purification-market.md”,”contentType”:”file”},{“name”:”graphics-card-fans-market.md”,”path”:”graphics-card-fans-market.md”,”contentType”:”file”},{“name”:”graphite-synthetic-furnace-market.md”,”path”:”graphite-synthetic-furnace-market.md”,”contentType”:”file”},{“name”:”gravity-conveyors-market.md”,”path”:”gravity-conveyors-market.md”,”contentType”:”file”},{“name”:”guitar-pedals-market.md”,”path”:”guitar-pedals-market.md”,”contentType”:”file”},{“name”:”handylift-tape-market.md”,”path”:”handylift-tape-market.md”,”contentType”:”file”},{“name”:”hd-conveyor-belts-market.md”,”path”:”hd-conveyor-belts-market.md”,”contentType”:”file”},{“name”:”high-frequency-electrosurgical-equipments-market.md”,”path”:”high-frequency-electrosurgical-equipments-market.md”,”contentType”:”file”},{“name”:”high-performance-computing-server-market.md”,”path”:”high-performance-computing-server-market.md”,”contentType”:”file”},{“name”:”high-purity-magnesium-oxide-powder-market.md”,”path”:”high-purity-magnesium-oxide-powder-market.md”,”contentType”:”file”},{“name”:”high-speed-rail-market.md”,”path”:”high-speed-rail-market.md”,”contentType”:”file”},{“name”:”high-voltage-motor-water-cooling-box-market.md”,”path”:”high-voltage-motor-water-cooling-box-market.md”,”contentType”:”file”},{“name”:”homodialysis-machine-market.md”,”path”:”homodialysis-machine-market.md”,”contentType”:”file”},{“name”:”hospital-braces-and-support-casting-and-splints-market.md”,”path”:”hospital-braces-and-support-casting-and-splints-market.md”,”contentType”:”file”},{“name”:”hydraulic-mulch-additives-market.md”,”path”:”hydraulic-mulch-additives-market.md”,”contentType”:”file”},{“name”:”hydraulic-sand-fracturing-equipment-market.md”,”path”:”hydraulic-sand-fracturing-equipment-market.md”,”contentType”:”file”},{“name”:”hypochlorous-acid-water-generator-market.md”,”path”:”hypochlorous-acid-water-generator-market.md”,”contentType”:”file”},{“name”:”ice-cream-ingredients-market.md”,”path”:”ice-cream-ingredients-market.md”,”contentType”:”file”},{“name”:”identity-theft-fraud-protection-market.md”,”path”:”identity-theft-fraud-protection-market.md”,”contentType”:”file”},{“name”:”in-car-air-treatment-system-market.md”,”path”:”in-car-air-treatment-system-market.md”,”contentType”:”file”},{“name”:”in-flight-entertainment-device-market.md”,”path”:”in-flight-entertainment-device-market.md”,”contentType”:”file”},{“name”:”in-home-energy-displays-market.md”,”path”:”in-home-energy-displays-market.md”,”contentType”:”file”},{“name”:”inactivated-poultry-vaccine-market.md”,”path”:”inactivated-poultry-vaccine-market.md”,”contentType”:”file”},{“name”:”inclination-directional-well-drilling-market.md”,”path”:”inclination-directional-well-drilling-market.md”,”contentType”:”file”},{“name”:”industrial-automatic-surface-grinder-market.md”,”path”:”industrial-automatic-surface-grinder-market.md”,”contentType”:”file”},{“name”:”industrial-bases-and-rails-market.md”,”path”:”industrial-bases-and-rails-market.md”,”contentType”:”file”},{“name”:”industrial-protective-clothing-textile-market.md”,”path”:”industrial-protective-clothing-textile-market.md”,”contentType”:”file”},{“name”:”industrial-pump-control-cabinet-market.md”,”path”:”industrial-pump-control-cabinet-market.md”,”contentType”:”file”},{“name”:”industrial-swivel-casters-market.md”,”path”:”industrial-swivel-casters-market.md”,”contentType”:”file”},{“name”:”industry-centrifugal-separator-market.md”,”path”:”industry-centrifugal-separator-market.md”,”contentType”:”file”},{“name”:”instrumentation-cable-market.md”,”path”:”instrumentation-cable-market.md”,”contentType”:”file”},{“name”:”integrated-refrigerators-market.md”,”path”:”integrated-refrigerators-market.md”,”contentType”:”file”},{“name”:”intravascular-ultrasound-system-ivus-market.md”,”path”:”intravascular-ultrasound-system-ivus-market.md”,”contentType”:”file”},{“name”:”iot-motion-light-sensors-market.md”,”path”:”iot-motion-light-sensors-market.md”,”contentType”:”file”},{“name”:”isolation-and-control-valve-market.md”,”path”:”isolation-and-control-valve-market.md”,”contentType”:”file”},{“name”:”jelly-glue-market.md”,”path”:”jelly-glue-market.md”,”contentType”:”file”},{“name”:”l-camphorsulfonic-acid-market.md”,”path”:”l-camphorsulfonic-acid-market.md”,”contentType”:”file”},{“name”:”lactose-free-milk-market.md”,”path”:”lactose-free-milk-market.md”,”contentType”:”file”},{“name”:”laser-deposition-welding-ldw-3d-printers-market.md”,”path”:”laser-deposition-welding-ldw-3d-printers-market.md”,”contentType”:”file”},{“name”:”lcd-multi-format-monitors-market.md”,”path”:”lcd-multi-format-monitors-market.md”,”contentType”:”file”},{“name”:”ldpe-resins-for-extrusion-coating-market.md”,”path”:”ldpe-resins-for-extrusion-coating-market.md”,”contentType”:”file”},{“name”:”liquid-filled-transformer-market.md”,”path”:”liquid-filled-transformer-market.md”,”contentType”:”file”},{“name”:”low-cost-airline-market.md”,”path”:”low-cost-airline-market.md”,”contentType”:”file”},{“name”:”mainline-rail-signalling-systems-market.md”,”path”:”mainline-rail-signalling-systems-market.md”,”contentType”:”file”},{“name”:”medical-alcohol-cottons-market.md”,”path”:”medical-alcohol-cottons-market.md”,”contentType”:”file”},{“name”:”medical-incinerators-market.md”,”path”:”medical-incinerators-market.md”,”contentType”:”file”},{“name”:”metal-organic-frameworks-materials-market.md”,”path”:”metal-organic-frameworks-materials-market.md”,”contentType”:”file”},{“name”:”metal-oxide-surge-arrester-moa-market.md”,”path”:”metal-oxide-surge-arrester-moa-market.md”,”contentType”:”file”},{“name”:”methionyl-lysyl-bradykinin-market.md”,”path”:”methionyl-lysyl-bradykinin-market.md”,”contentType”:”file”},{“name”:”methyl-octabromoether-market.md”,”path”:”methyl-octabromoether-market.md”,”contentType”:”file”},{“name”:”microbial-algae-products-market.md”,”path”:”microbial-algae-products-market.md”,”contentType”:”file”},{“name”:”military-grade-uninterruptible-power-supply-market.md”,”path”:”military-grade-uninterruptible-power-supply-market.md”,”contentType”:”file”},{“name”:”mitochondrial-membrane-potential-fluorescent-probes-market.md”,”path”:”mitochondrial-membrane-potential-fluorescent-probes-market.md”,”contentType”:”file”},{“name”:”mobile-waste-shredders-market.md”,”path”:”mobile-waste-shredders-market.md”,”contentType”:”file”},{“name”:”moisture-detection-stickers-market.md”,”path”:”moisture-detection-stickers-market.md”,”contentType”:”file”},{“name”:”motorcycle-traction-control-system-market.md”,”path”:”motorcycle-traction-control-system-market.md”,”contentType”:”file”},{“name”:”multi-channel-optical-power-meter-market.md”,”path”:”multi-channel-optical-power-meter-market.md”,”contentType”:”file”},{“name”:”multi-modal-biometrics-in-healthcare-market.md”,”path”:”multi-modal-biometrics-in-healthcare-market.md”,”contentType”:”file”},{“name”:”nano-material-coating-market.md”,”path”:”nano-material-coating-market.md”,”contentType”:”file”},{“name”:”natural-vanilla-bean-vanillin-market.md”,”path”:”natural-vanilla-bean-vanillin-market.md”,”contentType”:”file”},{“name”:”needleless-mesotherapy-devices-market.md”,”path”:”needleless-mesotherapy-devices-market.md”,”contentType”:”file”},{“name”:”niobium-tin-superconductor-market.md”,”path”:”niobium-tin-superconductor-market.md”,”contentType”:”file”},{“name”:”nn-bis-3-aminopropylethylenediamine-market.md”,”path”:”nn-bis-3-aminopropylethylenediamine-market.md”,”contentType”:”file”},{“name”:”non-agriculture-smart-irrigation-controller-market.md”,”path”:”non-agriculture-smart-irrigation-controller-market.md”,”contentType”:”file”},{“name”:”non-slip-bath-mats-market.md”,”path”:”non-slip-bath-mats-market.md”,”contentType”:”file”},{“name”:”non-woven-filter-fabrics-market.md”,”path”:”non-woven-filter-fabrics-market.md”,”contentType”:”file”},{“name”:”nonsteroidal-anti-inflammatory-drug-market.md”,”path”:”nonsteroidal-anti-inflammatory-drug-market.md”,”contentType”:”file”},{“name”:”nox-automotive-sensors-market.md”,”path”:”nox-automotive-sensors-market.md”,”contentType”:”file”},{“name”:”odn-solution-market.md”,”path”:”odn-solution-market.md”,”contentType”:”file”},{“name”:”oil-colour-brushes-market.md”,”path”:”oil-colour-brushes-market.md”,”contentType”:”file”},{“name”:”online-cod-analyzers-market.md”,”path”:”online-cod-analyzers-market.md”,”contentType”:”file”},{“name”:”operating-table-fixation-straps-market.md”,”path”:”operating-table-fixation-straps-market.md”,”contentType”:”file”},{“name”:”optical-transparent-ceramic-materials-market.md”,”path”:”optical-transparent-ceramic-materials-market.md”,”contentType”:”file”},{“name”:”organic-2-milk-market.md”,”path”:”organic-2-milk-market.md”,”contentType”:”file”},{“name”:”outdoor-cooking-market.md”,”path”:”outdoor-cooking-market.md”,”contentType”:”file”},{“name”:”outsourced-call-centers-outsourced-contact-centers-market.md”,”path”:”outsourced-call-centers-outsourced-contact-centers-market.md”,”contentType”:”file”},{“name”:”over-the-counter-mouthwashe-market.md”,”path”:”over-the-counter-mouthwashe-market.md”,”contentType”:”file”},{“name”:”padded-divider-market.md”,”path”:”padded-divider-market.md”,”contentType”:”file”},{“name”:”parmigiano-reggiano-cheese-market.md”,”path”:”parmigiano-reggiano-cheese-market.md”,”contentType”:”file”},{“name”:”passenger-three-wheeler-vehicle-market.md”,”path”:”passenger-three-wheeler-vehicle-market.md”,”contentType”:”file”},{“name”:”permanent-noise-monitoring-system-market.md”,”path”:”permanent-noise-monitoring-system-market.md”,”contentType”:”file”},{“name”:”pharmaceutical-microbial-air-samplers-market.md”,”path”:”pharmaceutical-microbial-air-samplers-market.md”,”contentType”:”file”},{“name”:”phenolphthalein-market.md”,”path”:”phenolphthalein-market.md”,”contentType”:”file”},{“name”:”plant-pesticide-market.md”,”path”:”plant-pesticide-market.md”,”contentType”:”file”},{“name”:”pm-25-protective-face-mask-market.md”,”path”:”pm-25-protective-face-mask-market.md”,”contentType”:”file”},{“name”:”pm10-pm25-portable-particulate-monitor-market.md”,”path”:”pm10-pm25-portable-particulate-monitor-market.md”,”contentType”:”file”},{“name”:”point-of-care-or-rapid-testing-kit-market.md”,”path”:”point-of-care-or-rapid-testing-kit-market.md”,”contentType”:”file”},{“name”:”polyisobutene-pib-market.md”,”path”:”polyisobutene-pib-market.md”,”contentType”:”file”},{“name”:”polypropylene-lip-gloss-tube-market.md”,”path”:”polypropylene-lip-gloss-tube-market.md”,”contentType”:”file”},{“name”:”powered-air-purifying-respirator-papr-headgears-market.md”,”path”:”powered-air-purifying-respirator-papr-headgears-market.md”,”contentType”:”file”},{“name”:”ppg-12-peg-65-lanolin-oil-market.md”,”path”:”ppg-12-peg-65-lanolin-oil-market.md”,”contentType”:”file”},{“name”:”precision-machine-tools-market.md”,”path”:”precision-machine-tools-market.md”,”contentType”:”file”},{“name”:”pressure-ulcer-detection-device-market.md”,”path”:”pressure-ulcer-detection-device-market.md”,”contentType”:”file”},{“name”:”protective-covers-for-boats-market.md”,”path”:”protective-covers-for-boats-market.md”,”contentType”:”file”},{“name”:”punching-and-laser-cutting-machine-market.md”,”path”:”punching-and-laser-cutting-machine-market.md”,”contentType”:”file”},{“name”:”pvdc-active-food-packaging-market.md”,”path”:”pvdc-active-food-packaging-market.md”,”contentType”:”file”},{“name”:”quick-dry-adhesives-market.md”,”path”:”quick-dry-adhesives-market.md”,”contentType”:”file”},{“name”:”refurbished-dna-sequencing-platforms-market.md”,”path”:”refurbished-dna-sequencing-platforms-market.md”,”contentType”:”file”},{“name”:”remittance-money-transfer-software-market.md”,”path”:”remittance-money-transfer-software-market.md”,”contentType”:”file”},{“name”:”residential-heat-recovery-ventilation-unit-market.md”,”path”:”residential-heat-recovery-ventilation-unit-market.md”,”contentType”:”file”},{“name”:”rheological-modifier-market.md”,”path”:”rheological-modifier-market.md”,”contentType”:”file”},{“name”:”robotic-combat-vehicle-rcv-market.md”,”path”:”robotic-combat-vehicle-rcv-market.md”,”contentType”:”file”},{“name”:”robotic-system-integrators-market.md”,”path”:”robotic-system-integrators-market.md”,”contentType”:”file”},{“name”:”robotics-in-nursing-market.md”,”path”:”robotics-in-nursing-market.md”,”contentType”:”file”},{“name”:”roller-skates-market.md”,”path”:”roller-skates-market.md”,”contentType”:”file”},{“name”:”roof-acoustic-curbs-board-market.md”,”path”:”roof-acoustic-curbs-board-market.md”,”contentType”:”file”},{“name”:”room-temperature-yogurt-market.md”,”path”:”room-temperature-yogurt-market.md”,”contentType”:”file”},{“name”:”rotating-electrical-connectors-market.md”,”path”:”rotating-electrical-connectors-market.md”,”contentType”:”file”},{“name”:”rubber-anti-scorcher-market.md”,”path”:”rubber-anti-scorcher-market.md”,”contentType”:”file”},{“name”:”sars-cov-2-antigen-test-kit-market.md”,”path”:”sars-cov-2-antigen-test-kit-market.md”,”contentType”:”file”},{“name”:”sealing-strapping-packaging-tapes-market.md”,”path”:”sealing-strapping-packaging-tapes-market.md”,”contentType”:”file”},{“name”:”security-threat-intelligence-products-and-services-market.md”,”path”:”security-threat-intelligence-products-and-services-market.md”,”contentType”:”file”},{“name”:”semi-processed-food-market.md”,”path”:”semi-processed-food-market.md”,”contentType”:”file”},{“name”:”separate-biochemical-analyzer-market.md”,”path”:”separate-biochemical-analyzer-market.md”,”contentType”:”file”},{“name”:”sewage-truck-market.md”,”path”:”sewage-truck-market.md”,”contentType”:”file”},{“name”:”shaft-locking-devices-market.md”,”path”:”shaft-locking-devices-market.md”,”contentType”:”file”},{“name”:”silicon-carbide-conductive-wafers-market.md”,”path”:”silicon-carbide-conductive-wafers-market.md”,”contentType”:”file”},{“name”:”silicon-oxygen-negative-electrode-material-market.md”,”path”:”silicon-oxygen-negative-electrode-material-market.md”,”contentType”:”file”},{“name”:”silicone-scar-gels-and-sheets-market.md”,”path”:”silicone-scar-gels-and-sheets-market.md”,”contentType”:”file”},{“name”:”single-use-sensors-for-bioprocessing-market.md”,”path”:”single-use-sensors-for-bioprocessing-market.md”,”contentType”:”file”},{“name”:”sleep-induction-device-market.md”,”path”:”sleep-induction-device-market.md”,”contentType”:”file”},{“name”:”smart-intelligent-pole-market.md”,”path”:”smart-intelligent-pole-market.md”,”contentType”:”file”},{“name”:”smart-pet-collar-tracker-market.md”,”path”:”smart-pet-collar-tracker-market.md”,”contentType”:”file”},{“name”:”social-advertising-social-media-market.md”,”path”:”social-advertising-social-media-market.md”,”contentType”:”file”},{“name”:”solar-cell-screen-printing-equipment-market.md”,”path”:”solar-cell-screen-printing-equipment-market.md”,”contentType”:”file”},{“name”:”solar-panel-materials-market.md”,”path”:”solar-panel-materials-market.md”,”contentType”:”file”},{“name”:”solar-phone-chargers-market.md”,”path”:”solar-phone-chargers-market.md”,”contentType”:”file”},{“name”:”solid-state-power-amplifiers-sspa-market.md”,”path”:”solid-state-power-amplifiers-sspa-market.md”,”contentType”:”file”},{“name”:”soybean-germ-protein-market.md”,”path”:”soybean-germ-protein-market.md”,”contentType”:”file”},{“name”:”spherical-colloidal-silica-market.md”,”path”:”spherical-colloidal-silica-market.md”,”contentType”:”file”},{“name”:”step-up-switching-controllers-market.md”,”path”:”step-up-switching-controllers-market.md”,”contentType”:”file”},{“name”:”straight-cut-gears-market.md”,”path”:”straight-cut-gears-market.md”,”contentType”:”file”},{“name”:”structural-pervious-pavement-market.md”,”path”:”structural-pervious-pavement-market.md”,”contentType”:”file”},{“name”:”sunflower-oilseed-processing-market.md”,”path”:”sunflower-oilseed-processing-market.md”,”contentType”:”file”},{“name”:”synchronous-traction-motor-market.md”,”path”:”synchronous-traction-motor-market.md”,”contentType”:”file”},{“name”:”teflubenzuron-market.md”,”path”:”teflubenzuron-market.md”,”contentType”:”file”},{“name”:”thermal-transfer-receipt-printer-market.md”,”path”:”thermal-transfer-receipt-printer-market.md”,”contentType”:”file”},{“name”:”thermostatic-radiator-valves-trvs-market.md”,”path”:”thermostatic-radiator-valves-trvs-market.md”,”contentType”:”file”},{“name”:”thin-film-precursors-market.md”,”path”:”thin-film-precursors-market.md”,”contentType”:”file”},{“name”:”three-roller-gates-market.md”,”path”:”three-roller-gates-market.md”,”contentType”:”file”},{“name”:”tongue-scrapers-market.md”,”path”:”tongue-scrapers-market.md”,”contentType”:”file”},{“name”:”touchless-bathroom-sink-faucets-market.md”,”path”:”touchless-bathroom-sink-faucets-market.md”,”contentType”:”file”},{“name”:”transport-refrigeration-units-market.md”,”path”:”transport-refrigeration-units-market.md”,”contentType”:”file”},{“name”:”tunable-narrow-linewidth-lasers-market.md”,”path”:”tunable-narrow-linewidth-lasers-market.md”,”contentType”:”file”},{“name”:”unmanned-driving-technology-in-mining-area-market.md”,”path”:”unmanned-driving-technology-in-mining-area-market.md”,”contentType”:”file”},{“name”:”vertical-roller-mill-for-cement-market.md”,”path”:”vertical-roller-mill-for-cement-market.md”,”contentType”:”file”},{“name”:”wall-mounted-charging-pile-market.md”,”path”:”wall-mounted-charging-pile-market.md”,”contentType”:”file”},{“name”:”wall-panellings-market.md”,”path”:”wall-panellings-market.md”,”contentType”:”file”},{“name”:”website-accessibility-plugin-tools-market.md”,”path”:”website-accessibility-plugin-tools-market.md”,”contentType”:”file”},{“name”:”white-portland-cements-market.md”,”path”:”white-portland-cements-market.md”,”contentType”:”file”},{“name”:”wire-cut-edm-machines-market.md”,”path”:”wire-cut-edm-machines-market.md”,”contentType”:”file”},{“name”:”wireless-sensor-network-wsn-market.md”,”path”:”wireless-sensor-network-wsn-market.md”,”contentType”:”file”},{“name”:”workholding-market.md”,”path”:”workholding-market.md”,”contentType”:”file”},{“name”:”world-forestry-and-agricultural-tractor-market.md”,”path”:”world-forestry-and-agricultural-tractor-market.md”,”contentType”:”file”},{“name”:”x-arm-type-window-regulator-market.md”,”path”:”x-arm-type-window-regulator-market.md”,”contentType”:”file”},{“name”:”xerostomia-dry-mouth-therapeutics-market.md”,”path”:”xerostomia-dry-mouth-therapeutics-market.md”,”contentType”:”file”}],”totalCount”:267}},”fileTreeProcessingTime”:9.237427,”foldersToFetch”:[],”reducedMotionEnabled”:null,”repo”:{“id”:726736347,”defaultBranch”:”main”,”name”:”Market-Research-Report-List-1″,”ownerLogin”:”rahu1502″,”currentUserCanPush”:false,”isFork”:false,”isEmpty”:false,”createdAt”:”2023-12-03T08:32:46.000Z”,”ownerAvatar”:”https://avatars.githubusercontent.com/u/151752379?v=4″,”public”:true,”private”:false,”isOrgOwned”:false},”symbolsExpanded”:false,”treeExpanded”:true,”refInfo”:{“name”:”main”,”listCacheKey”:”v0:1701592367.0″,”canEdit”:false,”refType”:”branch”,”currentOid”:”8f77dc6c3388ea838a3e69f6eb488f46a00603df”},”path”:”refurbished-dna-sequencing-platforms-market.md”,”currentUser”:null,”blob”:{“rawLines”:null,”stylingDirectives”:null,”csv”:null,”csvError”:null,”dependabotInfo”:{“showConfigurationBanner”:false,”configFilePath”:null,”networkDependabotPath”:”/rahu1502/Market-Research-Report-List-1/network/updates”,”dismissConfigurationNoticePath”:”/settings/dismiss-notice/dependabot_configuration_notice”,”configurationNoticeDismissed”:null,”repoAlertsPath”:”/rahu1502/Market-Research-Report-List-1/security/dependabot”,”repoSecurityAndAnalysisPath”:”/rahu1502/Market-Research-Report-List-1/settings/security_analysis”,”repoOwnerIsOrg”:false,”currentUserCanAdminRepo”:false},”displayName”:”refurbished-dna-sequencing-platforms-market.md”,”displayUrl”:”https://github.com/rahu1502/Market-Research-Report-List-1/blob/main/refurbished-dna-sequencing-platforms-market.md?raw=true”,”headerInfo”:{“blobSize”:”12.5 KB”,”deleteInfo”:{“deleteTooltip”:”You must be signed in to make or propose changes”},”editInfo”:{“editTooltip”:”You must be signed in to make or propose changes”},”ghDesktopPath”:”desktop.github.com”,”gitLfsPath”:null,”onBranch”:true,”shortPath”:”72ab543″,”siteNavLoginPath”:”/login?return_to=https%3A%2F%2Fgithub.com%2Frahu1502%2FMarket-Research-Report-List-1%2Fblob%2Fmain%2Frefurbished-dna-sequencing-platforms-market.md”,”isCSV”:false,”isRichtext”:true,”toc”:[{“level”:1,”text”:”Refurbished DNA Sequencing Platforms Market Insights, Market Players and Forecast Till 2030″,”anchor”:”refurbished-dna-sequencing-platforms-market-insights-market-players-and-forecast-till-2030″,”htmlText”:”Refurbished DNA Sequencing Platforms Market Insights, Market Players and Forecast Till 2030″}],”lineInfo”:{“truncatedLoc”:”74″,”truncatedSloc”:”74″},”mode”:”file”},”image”:false,”isCodeownersFile”:null,”isPlain”:false,”isValidLegacyIssueTemplate”:false,”issueTemplateHelpUrl”:”docs.github.com/articles/about-issue-and-pull-request-templates”,”issueTemplate”:null,”discussionTemplate”:null,”language”:”Markdown”,”languageID”:222,”large”:false,”loggedIn”:false,”newDiscussionPath”:”/rahu1502/Market-Research-Report-List-1/discussions/new”,”newIssuePath”:”/rahu1502/Market-Research-Report-List-1/issues/new”,”planSupportInfo”:{“repoIsFork”:null,”repoOwnedByCurrentUser”:null,”requestFullPath”:”/rahu1502/Market-Research-Report-List-1/blob/main/refurbished-dna-sequencing-platforms-market.md”,”showFreeOrgGatedFeatureMessage”:null,”showPlanSupportBanner”:null,”upgradeDataAttributes”:null,”upgradePath”:null},”publishBannersInfo”:{“dismissActionNoticePath”:”/settings/dismiss-notice/publish_action_from_dockerfile”,”dismissStackNoticePath”:”/settings/dismiss-notice/publish_stack_from_file”,”releasePath”:”/rahu1502/Market-Research-Report-List-1/releases/new?marketplace=true”,”showPublishActionBanner”:false,”showPublishStackBanner”:false},”rawBlobUrl”:”github.com/rahu1502/Market-Research-Report-List-1/raw/main/refurbished-dna-sequencing-platforms-market.md”,”renderImageOrRaw”:false,”richText”:” Refurbished DNA Sequencing Platforms Market Analysis and Latest…
Gromacs 2023.3 on Apple M3 chip – User discussions
GROMACS version: 2023.3GROMACS modification: No Hi folks I know that there have been several threads on running Gromacs with Apple M1 and M1 or M2 chips (e.g. Error compiling Gromacs 2023’s checks on Mac M2), but I recently got a MacBook Pro with the M3 chip, so I was interested…
No Significant Differences at 5 Year Follow-Up Between Palbociclib-Based Treatment Regimens
Results from the PARSIFAL-LONG study investigating endocrine-sensitive hormone receptor-positive/HER2-negative (HR+/HER2-) advanced breast cancer demonstrated the efficacy of 2 combined option therapies, palbociclib (Ibrance; Pfizer) plus letrozole (Femara; Novartis) and palbociclib plus fulvestrant (Faslodex; Hikma), as first-line treatments for metastatic breast cancer. The study found no significant differences in progression-free survival…
Effects of diabetes mellitus and glycemic traits on cardiovascular morpho-functional phenotypes | Cardiovascular Diabetology
American Diabetes A. Economic costs of Diabetes in the U.S. in 2017. Diabetes Care. 2018;41(5):917–28. Article Google Scholar Linssen PBC, Veugen MGJ, Henry RMA, van der Kallen CJH, Kroon AA, Schram MT, Brunner-La Rocca HP, Stehouwer CDA. Associations of (pre)Diabetes with right ventricular and atrial structure and function: the Maastricht…
Type 2 Diabetes Risk Correlates with Gene Signatures of Beta Cell Dysfunction
A joint effort involving research teams from Vanderbilt University Medical Center (VUMC) and the University of Michigan has linked the activities of a regulatory gene network and functional defects in insulin-producing pancreatic beta cells to type 2 diabetes. Details of the study are published in a Nature paper titled, “Genetic…
Gene Therapy: Unlocking Innovations in Cancer Treatment, Detection, and Drug Development
The history of using genes as a tool to treat humans goes back nearly five decades, marking a pivotal moment in medical science. In 1972, the concept of gene therapy was first considered as a form of treatment. This groundbreaking idea was introduced in a paper titled “Gene therapy for…
Postdoctoral Position in Genomics – Tcheandjieu Lab, US
Postdoctoral Position in Genomics: The Tcheandjieu Lab at the Gladstone Institutes/UCSF is inviting applications for a Postdoctoral position in Genomics. This role offers an exciting opportunity to work on diverse biobanks, utilizing genomic and multi-omic approaches to enhance our understanding of cardiovascular diseases. Located in the heart of Silicon Valley,…
Phase 3 KEYLYNK-008 Trial of Pembrolizumab Plus Olaparib in Metastatic Squamous NSCLC to Stop for Futility
The phase 3 KEYLYNK-008 trial (NCT03976362) evaluating pembrolizumab (Keytruda) plus olaparib (Lynparza) in patients with metastatic squamous non–small cell lung cancer (NSCLC) will be discontinued for futility, according to an announcement from Merck.1 The decision was based on a recommendation issued by an independent data monitoring committee (IDMC) after reviewing…
Sanofi – Sarclisa Phase 3 trial met primary endpoint of progression free survival in patients with newly diagnosed multiple myeloma not eligible for transplant -December 08, 2023 at 09:18 am EST
PARIS – The Phase 3 IMROZ trial evaluating the investigational use of Sarclisa (isatuximab) in combination with standard-of-care bortezomib, lenalidomide and dexamethasone (VRd) met its primary endpoint at a planned interim analysis for efficacy, demonstrating statistically significant improvement in progression-free survival (PFS) compared with VRd alone in transplant-ineligible patients with…
mothur
mothur is an open source software package for bioinformatics data processing.[8] The package is frequently used in the analysis of DNA from uncultured microbes. mothur is capable of processing data generated from several DNA sequencing methods including 454 pyrosequencing, Illumina HiSeq and MiSeq, Sanger, PacBio, and IonTorrent.[9] The first release…
How to group atoms as molecules in reax – LAMMPS General Discussion
Using Aug 2023 version of Lammps This is a rather basic issue. I am following the paper by Kim to model , water, ethahol and phosphoric acid adsorbed to TiO2 using their ff.Reactive MD-force field: Kim, S.-Y., van Duin, A. C. T., and Kubicki, J. D., 2012, Molecular dynamics simulations…
FDA Accepts NDA for Vonoprazan (Voquenza) in Non-Erosive GERD
The US Food and Drug Administration (FDA) has accepted Phathom Pharmaceuticals’ New Drug Application (NDA) for vonoprazan (Voquenza) as a daily treatment of heartburn associated with Non-Erosive gastroesophageal reflux disease (GERD) in adults. Announced on December 6, 2023, the FDA has assigned the application a standard 10-month review with a…
FDA OKs gene therapies from Vertex, Bluebird Bio for sickle cell disease
In a historic move, the Food and Drug Administration approved two gene therapies to treat sickle cell disease (SCD) Friday morning. The FDA approved Vertex Pharmaceuticals and CRISPR Therapeutics’ Casgevy, which utilizes CRISPR/Cas9 technology, as well as Bluebird Bio’s Lyfgenia, a cell-based gene therapy that uses a lentiviral vector for…
FDA Approves Gene Therapies Casgevy, Lyfgenia for Sickle Cell Disease
The Food and Drug Administration (FDA) has approved Casgevy and Lyfgenia, the first cell-based gene therapies for the treatment of sickle cell disease (SCD) in patients 12 years of age and older. Casgevy (exagamglogene autoemcel; Vertex Pharmaceuticals) is an autologous, ex vivo CRISPR/Cas9 gene-edited therapy indicated for patients with SCD…
Milestone Gene Therapies for Sickle Cell Disease Greenlit by FDA
The FDA approved two cell-based gene therapies, exagamglogene autotemcel (Casgevy) and lovotibeglogene autotemcel (Lyfgenia), for sickle cell disease (SCD), the agency announced. Marking the first FDA-approved therapy utilizing CRISPR/Cas9 technology, Casgevy is approved for the treatment of sickle cell disease in patients 12 years of age and older with recurrent…
Analyses Probe into Co-Mutation Activity of Sotorasib in KRAS-Mutant NSCLC
Devika Das, MD Associate Professor UAB Medicine Birmingham, AL LINK TO PART 1 Targeted Oncology: What data support the use of sotorasib (Lumakras) in patients with non–small cell lung cancer (NSCLC) and a KRAS G12C mutation? DEVIKA DAS, MD: The CodeBreaK 100 study [NCT03600883] was a registrational phase 2 study….
How to properly mock a (Pysam) read
I am creating a custom softclipping tool due to a limitation found in Ampliconclip Issue softclipping reads when they belong and don’t belong to a common amplicon. I am progressing ok in my development and I am developing tests. I found some limitations when I try to mock a Pysam…
GROMACS MD Simulation – proteomics
I received this error when using the GROMACS initial setup tool WARNING: No ICDs were found. Either, Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or Make your system-wide implementation visible by installing ocl-icd-system conda package. jennaj December 7, 2023, 9:27pm 2 Hi @Vibha_Rao That is…
Some issue about itsxpress2 plugin in QIIME2-202309 – Community Plugin Support
ZhangSR (June) December 7, 2023, 6:36am 1 Hi~ When I updated the ITSxpress within QIIME2-202309 following the updated tutorial here github.com/USDA-ARS-GBRU/itsxpress-tutorial/blob/master/ITSxpress-tutorial.md, there were some confusions. I updated the itsxpress by conda install -c bioconda itsxpress and then qiime dev refresh-cache under the QIIME2 environment I failed to call itsxpress by…
Acadia trial testing carbetocin nasal spray for hyperphagia in PWS
Acadia Pharmaceuticals has launched a Phase 3 clinical trial testing the safety and efficacy of ACP-101, an experimental carbetocin nasal spray, for the treatment of hyperphagia, or insatiable hunger, in people with Prader-Willi syndrome (PWS). The pivotal trial, dubbed COMPASS PWS, is expected to enroll up to 170 children and…