Tag: miRNAseq

over-presented sequence in negative control

miRNAseq – over-presented sequence in negative control 0 Hello, everyone I have this sequence in the negative control of miRNA seq. TGGTAATACGACGTACTTAGTGT It did not map to any references (miRNA, tRNA, rRNA, piRNA, mRNA, hg19, bacteria). I use QIAseq miRNA Library and NextSeq 550. Any idea what it might be???…

Continue Reading over-presented sequence in negative control

Bioconductor – RTCGA.miRNASeq

DOI: 10.18129/B9.bioc.RTCGA.miRNASeq     This package is for version 3.10 of Bioconductor; for the stable, up-to-date release version, see RTCGA.miRNASeq. miRNASeq datasets from The Cancer Genome Atlas Project Bioconductor version: 3.10 Package provides miRNASeq datasets from The Cancer Genome Atlas Project for all available cohorts types from gdac.broadinstitute.org/. Data format…

Continue Reading Bioconductor – RTCGA.miRNASeq

Statistical strategies for microRNAseq batch effect reduction – Guo

Original Article Yan Guo, Shilin Zhao, Pei-Fang Su, Chung-I Li, Fei Ye, Charles R. Flynn, Yu Shyr Abstract RNAseq technology is replacing microarray technology as the tool of choice for gene expression profiling. While providing much richer data than microarray, analysis of RNAseq data has been much more challenging. Among…

Continue Reading Statistical strategies for microRNAseq batch effect reduction – Guo

Different alignment results on mirnaseq data upon using Bowtie vs Bowtie2.

Different alignment results on mirnaseq data upon using Bowtie vs Bowtie2. 0 Hi, I aligned my mirna seq data against hsa.gff3 file using bowtie first. However, upon generating the read count file (using bedtools) and running deseq2 on it, very few mirnas were observed. Also the PCA plot showed too…

Continue Reading Different alignment results on mirnaseq data upon using Bowtie vs Bowtie2.

more than one sample in the same fasta file

more than one sample in the same fasta file 0 Hello A colleague asked me to align some miRNA-seq data for him. He handed only two files, an F and a R fasta files and said 6 different samples were there. So far, I have only dealt with rna-seq files…

Continue Reading more than one sample in the same fasta file

Analyzing and slicing FASTQ file entries using Python

Analyzing and slicing FASTQ file entries using Python 1 I have the code pasted below for running on FASTQ file entries in order to compare specific parts and remove the redundancy of the same sequences (based on the miRNA + umi_seq combination). I save the entry IDs and then make…

Continue Reading Analyzing and slicing FASTQ file entries using Python

miRNAseq analysis not shown adapter sequence and huge N’s content

miRNAseq analysis not shown adapter sequence and huge N’s content 0 Hi there, This is my third time doing miRNA sequencing analysis, so i do not have huge experience on this… So, i have 18 human semen samples, (also no experience in this type samples) i have been reading alot…

Continue Reading miRNAseq analysis not shown adapter sequence and huge N’s content