Categories
Tag: miRNAseq
over-presented sequence in negative control
miRNAseq – over-presented sequence in negative control 0 Hello, everyone I have this sequence in the negative control of miRNA seq. TGGTAATACGACGTACTTAGTGT It did not map to any references (miRNA, tRNA, rRNA, piRNA, mRNA, hg19, bacteria). I use QIAseq miRNA Library and NextSeq 550. Any idea what it might be???…
Bioconductor – RTCGA.miRNASeq
DOI: 10.18129/B9.bioc.RTCGA.miRNASeq This package is for version 3.10 of Bioconductor; for the stable, up-to-date release version, see RTCGA.miRNASeq. miRNASeq datasets from The Cancer Genome Atlas Project Bioconductor version: 3.10 Package provides miRNASeq datasets from The Cancer Genome Atlas Project for all available cohorts types from gdac.broadinstitute.org/. Data format…
Statistical strategies for microRNAseq batch effect reduction – Guo
Original Article Yan Guo, Shilin Zhao, Pei-Fang Su, Chung-I Li, Fei Ye, Charles R. Flynn, Yu Shyr Abstract RNAseq technology is replacing microarray technology as the tool of choice for gene expression profiling. While providing much richer data than microarray, analysis of RNAseq data has been much more challenging. Among…
Different alignment results on mirnaseq data upon using Bowtie vs Bowtie2.
Different alignment results on mirnaseq data upon using Bowtie vs Bowtie2. 0 Hi, I aligned my mirna seq data against hsa.gff3 file using bowtie first. However, upon generating the read count file (using bedtools) and running deseq2 on it, very few mirnas were observed. Also the PCA plot showed too…
more than one sample in the same fasta file
more than one sample in the same fasta file 0 Hello A colleague asked me to align some miRNA-seq data for him. He handed only two files, an F and a R fasta files and said 6 different samples were there. So far, I have only dealt with rna-seq files…
Analyzing and slicing FASTQ file entries using Python
Analyzing and slicing FASTQ file entries using Python 1 I have the code pasted below for running on FASTQ file entries in order to compare specific parts and remove the redundancy of the same sequences (based on the miRNA + umi_seq combination). I save the entry IDs and then make…
miRNAseq analysis not shown adapter sequence and huge N’s content
miRNAseq analysis not shown adapter sequence and huge N’s content 0 Hi there, This is my third time doing miRNA sequencing analysis, so i do not have huge experience on this… So, i have 18 human semen samples, (also no experience in this type samples) i have been reading alot…