Tag: MLE
GoM DE: interpreting structure in sequence count data with differential expression analysis allowing for grades of membership | Genome Biology
Models for single-cell ATAC-seq data In single-cell ATAC-seq data, \(x_{ij}\) is the number of unique reads mapping to peak or region j in cell i. Although \(x_{ij}\) can take non-negative integer values, it is common to “binarize” the accessibility data (e.g., [19, 74, 133,134,135]), meaning that \(x_{ij} = 1\) when…
identify DEGs across all conditions and per specific conditions
Hi, I am analyzing a bulk-RNAseq and I want to analyse the dataset using Deseq2. I am very confused so apologies if it’s a stupid question. My dataset has 12 samples (3 per condition). the conditions are: treatment and control and 2 time points (0hr, 12hrs). So I wanted to…
DESeq2, results(dds, name = ) interpretation results
Hello together, hello Michael, I have an understanding problem using results(dds, …) I have RNAseq data and a grouping of two conditions with interaction of time with the defined reference levels, see code below. And run the code as below. coldata$Cond <- factor(coldata$Cond, levels = c(“A”,”B”)) coldata$Time <- factor(coldata$Time, levels…
ngsJulia: population genetic analysis of next-generation DNA sequencing data with Julia language
doi: 10.12688/f1000research.104368.2. eCollection 2022. Affiliations Expand Affiliations 1 Department of Life Sciences, Imperial College London, London, UK. 2 Institute of population genetics, University of Veterinary Medicine Vienna, Vienna, Austria. 3 Department of Ecology, Environment and Plant Sciences, Stockholm University, Stockholm, Sweden. 4 School of Biological and Behavioural Science, Queen Mary,…
Deseq2, enrichGO and ensembl ID
Deseq2, enrichGO and ensembl ID 1 @3cc02754 Last seen 5 hours ago United Kingdom Hi I used code initially in DESEQ2 dds=DESeqDataSet(se,design=~TRAIT) dds=DESeq(dds) res=results(dds) I currently have results from DESEq2 which looks like this: log2 fold change (MLE): TRAIT S vs N Wald test p-value: TRAIT S vs N DataFrame…
r – DEseq2 results, enrichGO and ENSEMBL ID not matching
I am trying to do DEG and then use enrichGO on the results. I used code initially in DESEQ2 dds=DESeqDataSet(se,design=~TRAIT) dds=DESeq(dds) res=results(dds) I currently have results from DESEq2 which looks like this: log2 fold change (MLE): TRAIT S vs N Wald test p-value: TRAIT S vs N DataFrame with 42800…
python – Mageck-Vispr problem to visualize results
I’m trying to run the tool vispr in able to visualize the results of the mageck-vispr run. I have installed everything as explained on the website within a conda environment. Unfortunately, when running the command vispr server results/ESC-mle.vispr.yaml I receive the following error Traceback (most recent call last): File “/sw/mambaforge/10/envs/mageck-vispr/bin/vispr”,…
What is a Machine Learning Engineer (MLE)?
DEFINITIONS: What is a Machine Learning Engineer (MLE)? DEFINITIONS: What is a Machine Learning Engineer (MLE)? Welcome to our “DEFINITIONS” category where we delve into the exciting world of technology and explore the meanings behind various technical terms. In this post, we will uncover the answer to the question: What…
MACHINE LEARNING ENGINEER – High Frequency Trading – Software Engineering – Java, Python, Tensorflow, PyTorch – Artificial Intelligence
MACHINE LEARNING ENGINEER – High Frequency Trading – Software Engineering – Java, Python, Tensorflow, PyTorch – Artificial Intelligence Machine Learning Engineer (Artificial Intelligence), High Frequency Trading @ Global Tier One Quantitative Trading House My client is a world renowned quant trading house, market maker and liquidity provider that trades…
so many zero p-values resulted from mageck mle
so many zero p-values resulted from mageck mle 1 I am using mle function of mageck to generate CRISPR screen results bu when I look at p-values there are so many zeros. This is a part of my gene summary file , what could be the problem? I appreciate any…
Close-kin mark-recapture informs critically endangered terrestrial mammal status
Sampling and tissue collection Christmas Island is a territory of Australia located in the Indian Ocean approximately 380 km south of Java, Indonesia, and 1500 km west of the Australian mainland. It is a small 135 km2 island composed of tertiary limestone overlying volcanic andesite and basalt and its topography consists of…
Liftedover vcf header/contig compatibility
I have a collaborator that has lifted over their hg19 files to hg38 using Crossmap. The first step in the workflow they need to run is a simple bcftools filter for variant quality. They are getting an unknown file type error. Are there any obvious problems with this header that…
DDP hangs when initializing – distributed
Hi everyone, I am following this tutorial Huggingface Knowledge Distillation and my process hangs when initializing DDP model this lineI add the following env variables NCCL_ASYNC_ERROR_HANDLING=1 NCCL_DEBUG=DEBUG TORCH_DISTRIBUTED_DEBUG=DETAIL for showing logs:Here is the full log: Traceback (most recent call last): File “main.py”, line 137, in <module> main() File “main.py”, line…
MAGeCK MLE’s sgRNA efficacies always end up at 1.0
Dear community, I have been using MAGeCK MLE for a couple of analyses previously and also recently. As I understand the method, the maximum likelihood estimation iteratively takes turns in improving the estimation of efficacies of individual sgRNAs and the beta values, which are the main readout metric provided by…
MAGECK MLE design matrix
MAGECK MLE design matrix 0 @ea5b2e2a Last seen 7 hours ago Finland Hi, which one of the following design matrices would be correct for a CRISPR screen with DMSO as control and 4 drugs carried out for 18 days? OR Thanks! -Monika mageck MAGeCKFlute • 19 views Login before adding…
Positive beta-scores of essential genes in drug-treated cells
Positive beta-scores of essential genes in drug-treated cells 0 @ea5b2e2a Last seen 14 hours ago Finland Hi, I ran both MAGECK RRA and MAGECK MLE on my CRISPRi screen data set where I have samples: DMSO control day 0 DMSO control day 18 (end of experiment) drug 1 day 18…
Bayesian network for biological data using bnlearn
Bayesian network for biological data using bnlearn 0 I have matrix of differentially expressed genes and clinical parameters that are discrete values (like Outcome, Severity, timepoint). I would like to make a Bayesian Network to understand which Biological parameters are best explained by which set of genes/ connecting with which…
lfcshrink error DESeq2
Hello! I’m having problems with lfcShrink in my DESeq2 workflow. I’m trying to do a differential expression analysis (with only one comparison term: “MULTIseq_ID_call2”) on my single-cell data. However when I do lfcShrink I get an error that I cannot interpret. Can you help me? dds <- DESeq(dds, test =…
Protocols to Study Host-Pathosystems | SpringerLink
Alkooranee JT, Liu S, Aledan TR, Yin Y, Li M (2015) First report of powdery mildew caused by erysiphe cruciferarum on brassica napus in China. Plant Dis 99(11):1651 CrossRef Google Scholar Al-Lami HFD, You MP, Barbetti MJ (2019a) Incidence, pathogenicity and diversity of Alternaria spp. associated with alternaria leaf spot…
Vancomycin-resistant E. faecium SJ2 strain carrying vanA
Introduction Enterococcus is a genus of Gram-positive, facultative anaerobe and oxidase-negative cocci classified as lactic acid bacteria and belonging to the Enterococcaceae family.1 Enterococci is a type of bacteria that is often found in the gastrointestinal tract of humans and other mammals.2,3 It comprises a ubiquitous group of bacteria that…
MAGeCK mle returns all genes as essential
I am working on using MAGeCK to define essential genes from a CRISPR screen on model MPNST cell lines using the Brunello library. Counts and normalization proceed perfectly fine, I am able to get a counts table that looks like so: sgRNA Gene ST8814_Final ST8814_Initial STS26T_Final STS26T_Initial NEIL1_49554_TGGAAGGGGGCACTTAGCGA NEIL1 1339…
Sections – CSE 446
1/5 Python, Probability Fundamentals Section notes, Solutions, Python intro (notebook runnable), Python intro (html), Python slide deck 1/12 MLE, Linear Algebra, Data Normalization/Standardization, and Linear Regression Section notes, Solutions 1/19 Bias-Variance, Train-Test Split Section notes, Solutions 1/26 Vector Calculus; Stein’s Paradox Section notes, Solutions 2/2 Demonstrative Code, Convexity, Gradient Descent…
Transcription factor binding sites are frequently under accelerated evolution in primates
Pooling-based phylogenetic inference of accelerated evolution In the current study, we introduce a novel software application, GroupAcc, which includes two pooling-based phylogenetic approaches with improved statistical power to infer weakly accelerated evolution. The key idea of GroupAcc is to group TFBSs by the bound transcription factor and then examine whether…
Issue with VCF format while using Pharmcat
Hello everybody, I am using pharmcat tool’s prerprocessor feature to preprocessmy vcf file using the command > python3 pharmcat_vcf_preprocessor.py -vcf sample.vcf But I think there is some issue with my vcf file as this command outputs an error > Reading samples from sample.vcf … Saving output to . > >…
tximeta accessing gene symbols after addIds()
Hi, I’m sure I’m missing something obvious, but is there an easy way to access the gene symbols after adding them with the addIds() function in tximeta? gse <- addIds(gse, “SYMBOL”, gene=TRUE) mcols(gse) DataFrame with 60240 rows and 3 columns gene_id <character> ENSG00000000003.15 ENSG00000000003.15 ENSG00000000005.6 ENSG00000000005.6 ENSG00000000419.12 ENSG00000000419.12 ENSG00000000457.14 ENSG00000000457.14…
Condition shown as ‘Untreated vs. Treated’ in output of results() in DESeq2
Condition shown as ‘Untreated vs. Treated’ in output of results() in DESeq2 1 @bffcbc5f Last seen 16 hours ago United States of America I am trying to find differentially expressed genes using DESeq2 on some RNA-seq data. In the pheno data, there is a column named ‘condition’ with factored values…
Knockdown of circRNA Paralemmin 2 Ameliorates Lipopolysaccharide-induced Murine Lung Epithelial Cell Injury by Sponging miR-330-5p to Reduce ROCK2 Expression: Immunological Investigations: Vol 0, No 0
ABSTRACT Previous data have reported the high expression of circRNA paralemmin 2 (circPALM2) in mice with acute lung injury (ALI). However, the role of circPALM2 in ALI pathogenesis remains unclear. The study aims to reveal the function of circPALM2 in ALI and the underlying mechanism. C57BL/6 J mice and murine lung…
Large DE LogFC range
Large DE LogFC range 1 @3d20f23f Last seen 1 hour ago Italy I’m working with DESeq2 to make a DE analysis between samples in two different conditions. During the analysis, I identified a batch effect due to the sequencing time modelled as a covariate in the design formula. From the…
Mle Application With Gekko In Python
The true power of the state space model is to allow the creation and estimation of custom models.This notebook shows various statespace models that subclass sm. That means your MAGeCK python module is installed in /home/john/.pyenv/versions/2.7.13/lib/python2.7/sitepackages.I use conda to install the latest version of. This twovolume set Diseases and Pathology…
Using DESeq2 to analyse multi-variate design resulting in testing the wrong parameter
Enter the body of text here Hi, I am analysing a RNA Seq dataset coming from 3 independent cell isolates (isolate1, isolate2, isolate3), each given 3 different treatments (control, drug1, drug2). We are testing drug 1 against control in the first instance: We also observed that there is some variation…
[Bug 1951032] Autopkgtest regression report (glibc/2.31-0ubuntu9.4)
All autopkgtests for the newly accepted glibc (2.31-0ubuntu9.4) for focal have finished running. The following regressions have been reported in tests triggered by the package: snapd-glib/1.58-0ubuntu0.20.04.0 (armhf) apt/2.0.6 (armhf) libmath-mpfr-perl/4.13-1 (armhf) art-nextgen-simulation-tools/20160605+dfsg-4 (armhf) ruby-nokogiri/1.10.7+dfsg1-2build1 (armhf) r-cran-rgdal/1.4-8-1build2 (armhf) arrayfire/3.3.2+dfsg1-4ubuntu4 (armhf) libpango-perl/1.227-3build1 (armhf) libimage-sane-perl/5-1 (s390x) ruby-bootsnap/1.4.6-1 (arm64) mle/1.4.3-1 (ppc64el, arm64) libsyntax-keyword-try-perl/0.11-1build1 (armhf)…
Sp.stats and PyMC3 logps different – Questions
Hi everyone, I am fitting a geometric distribution to the following data: [40000, 600, 1500, 30000, 12000, 25000, 65000, 1500, 40000, 10000000, 25000, 2000, 2000, 500, 800, 1500, 30000, 850, 25000, 1000, 15000, 40000, 9000, 3000, 12000, 1000, 1000, 1500, 10000, 25000, 7000, 35000, 30000, 25000, 750, 20000, 7000, 1500,…
Outliers on DESEq2 Results
I have an RNAseq dataset, where one of the genes I intend to analyze has hundreds of counts ranging from 10 to 12, with a few counts > 9000. I process this data in Deseq2 and get that the gene is differentially expressed across several samples of interest. What can…
Analysis of shRNA/CRISPR screens in 2021
I’ve used Mageck for CRISPR screens and it works great. A few things: It, by default, doesn’t allow mismatches between read and library but still I’ve always had good (>= ~80%) mapping rates; I’ve had better mapping results with paired-end reads (because if one read fails to align because of…
Handle inflated log2FC while using interaction term in DESeq2
Hi guys, I’m working with a 8 samples experiment (lower than 3x replicates, I know..) with a design like > colData(dds) DataFrame with 8 rows and 2 columns condition traitment <factor> <factor> 4200-JS-1 norm ctrl 4200-JS-2 norm ctrl 4200-JS-3 norm trt 4200-JS-4 norm trt 4200-JS-5 hyper ctrl 4200-JS-6 hyper ctrl…
Inquiry related to vcf file and formatting
Hello everyone, I am trying to run predixcan software. But its showing error as segmentation fault implying that there is something wrong with my vcf files. I am sharing the header of vcf file. ##fileformat=VCFv4.1 ##INFO=<ID=LDAF,Number=1,Type=Float,Description=”MLE Allele Frequency Accounting for LD”> ##INFO=<ID=AVGPOST,Number=1,Type=Float,Description=”Average posterior probability from MaCH/Thunder”> ##INFO=<ID=RSQ,Number=1,Type=Float,Description=”Genotype imputation quality from…