Tag: NA

ggplot2 – remove NA’s from only one Variable in scatter plot with 2 variables over time in R / ggplot

I want to plot 2 variables over a time period with ggplot. One of the variables contains NAs. I want to drop the NAs from the plot without losing the value for the other variable. Right now, ggplot plots all NAs in a line at the top of the y-axis….

Continue Reading ggplot2 – remove NA’s from only one Variable in scatter plot with 2 variables over time in R / ggplot

Acquisition of antibodies to Plasmodium falciparum and Plasmodium vivax antigens in pregnant women living in a low malaria transmission area of Brazil | Malaria Journal

WHO. World Malaria Report. Geneva: World Health Organization; 2019. Google Scholar  Rogerson SJ, Hviid L, Duffy PE, Leke RF, Taylor DW. Malaria in pregnancy: pathogenesis and immunity. Lancet Infect Dis. 2007;7:105–17. Article  CAS  PubMed  Google Scholar  Salanti A, Dahlback M, Turner L, Nielsen MA, Barfod L, Magistrado P, et al….

Continue Reading Acquisition of antibodies to Plasmodium falciparum and Plasmodium vivax antigens in pregnant women living in a low malaria transmission area of Brazil | Malaria Journal

Comment: Unable to convert "NULL" to either zero or NA

Fair enough, I just glanced over your screenshot, because that magrittr pipe is intimidatingly long, and you had already ascertained that *this is because some values in these columns are “NULL”. All the other times with other data frames the empty values are always “NA” and I can use na.rm=T…

Continue Reading Comment: Unable to convert "NULL" to either zero or NA

Dementia with Lewy bodies post-mortem brains reveal differentially methylated CpG sites with biomarker potential

Weisman, D. & McKeith, I. Dementia with Lewy Bodies. Semin. Neurol. 27, 042–047 (2007). Article  Google Scholar  Foguem, C. & Manckoundia, P. Lewy Body Disease: Clinical and Pathological “Overlap Syndrome” Between Synucleinopathies (Parkinson Disease) and Tauopathies (Alzheimer Disease). Curr. Neurol. Neurosci. Rep. 2018 18:5 18, 1–9 (2018). CAS  Google Scholar …

Continue Reading Dementia with Lewy bodies post-mortem brains reveal differentially methylated CpG sites with biomarker potential

No module named ‘upstream_ontologist.tests’ (and more)

Source: lintian-brush Version: 0.134 Severity: serious User: debian…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of lintian-brush the autopkgtest of lintian-brush fails in testing when that autopkgtest is run with the binary packages of lintian-brush from unstable. It passes when run with only packages from testing. In tabular form:…

Continue Reading No module named ‘upstream_ontologist.tests’ (and more)

ggplot2 – Issues with layout in R Markdown

I’m taking over a project from another more experienced user of Rmd, the code ran for her but now that I’m trying, the following code is throwing this error: #Output the plot using plotly a<- plotly::ggplotly(cstr_volume_graph) %>% layout(legend = list( #this layout bit is to change position of legend, although…

Continue Reading ggplot2 – Issues with layout in R Markdown

Simulated global warming affects endophytic bacterial and fungal communities of Antarctic pearlwort leaves and some bacterial isolates support plant growth at low temperatures

Sample collection Colobanthus quitensis samples were collected at King George Island near the Henryk Arctowski Polish Antarctic Station, Maritime Antarctica (62°14’ S, 58°48’ W) during the summer season (February 2018). Samples were collected inside the Antarctic Specially Protected Area (ASPA) 128 using permits provided by The Chilean Antarctic Institute (INACH)…

Continue Reading Simulated global warming affects endophytic bacterial and fungal communities of Antarctic pearlwort leaves and some bacterial isolates support plant growth at low temperatures

r – How do I do a ggplot and use different bars for different years

I have data that includes the number of countries in each region per year in a data set. I have used the below code to plot a bar chart but I would like it to plot the numbers for each year but not sure how. region_year <- data_na_removed%>% group_by(Region, Year)%>%…

Continue Reading r – How do I do a ggplot and use different bars for different years

Nociceptor neurons affect cancer immunosurveillance

Secondary use of biopsies as research specimens The ten melanoma samples used in this study were collected by Sanford Health and classified by a board-certified pathologist. Their secondary use as research specimens (fully de-identified formalin-fixed, paraffin-embedded (FFPE) blocks) was approved under Sanford Health IRB protocol 640 (titled ‘Understanding and improving…

Continue Reading Nociceptor neurons affect cancer immunosurveillance

Novel equi merozoite antigen (ema-1) gene heterogeneity in a geographically isolated Theileria equi population in Croatia | Parasites & Vectors

Richter S. Vrste haemosporidia u konja i goveda NR Hrvatskoj. Thesis: Veterinary faculty university of zagreb; 1954. Google Scholar  Rothschild CM. Equine piroplasmosis. J Equine Vet Sci. 2013;33:497–508. Article  Google Scholar  Ueti MW, Palmer GH, Scoles GA, Kappmeyer LS, Knowles DP. Persistently infected horses are reservoirs for intrastadial tick-borne transmission…

Continue Reading Novel equi merozoite antigen (ema-1) gene heterogeneity in a geographically isolated Theileria equi population in Croatia | Parasites & Vectors

Divide the data , count, and then also output the id – General

This is not elegant. library(tidyr) library(dplyr) c1<-c(16.6,1.0,10.1,8.6,8.0,17.0,2.4,7.6,5.7,11.6,3.6,2.8,6.3,1.5,2.7,16.7,6.7,5.3,12.5) c2<-1:19 c3<-data.frame(c2,c1) colnames(c3)<-c(“id”,”col”) c3 <- mutate(c3,Group=cut(col,breaks = seq(1,19,3),right = FALSE)) c3 #> id col Group #> 1 1 16.6 [16,19) #> 2 2 1.0 [1,4) #> 3 3 10.1 [10,13) #> 4 4 8.6 [7,10) #> 5 5 8.0 [7,10) #> 6 6…

Continue Reading Divide the data , count, and then also output the id – General

Cas9 targeted nanopore sequencing with enhanced variant calling improves CYP2D6-CYP2D7 hybrid allele genotyping

Please use this url to cite or link to this publication: hdl.handle.net/1854/LU-8771189 MLA Rubben, Kaat, et al. “Cas9 Targeted Nanopore Sequencing with Enhanced Variant Calling Improves CYP2D6-CYP2D7 Hybrid Allele Genotyping.” PLOS Genetics, edited by Guanzheng Luo, 2022, doi:10.1371/journal.pgen.1010176. APA Rubben, K., Tilleman, L., Deserranno, K., Tytgat, O., Deforce, D., &…

Continue Reading Cas9 targeted nanopore sequencing with enhanced variant calling improves CYP2D6-CYP2D7 hybrid allele genotyping

Sensing electroporation during pulsed electric fields

Mostrar registro completo Título: Sensing electroporation during pulsed electric fields Autor: Pintarelli, Guilherme Brasil Resumo: Os campos elétricos pulsados (PEF) podem melhorar ou ser uma alternativa a métodos tradicionais nas áreas de medicina e biotecnologia. Os PEF provocam abertura de poros na membrana celular (eletroporação). A eletroporação pode ser utilizada…

Continue Reading Sensing electroporation during pulsed electric fields

Antarctic aldehyde dehydrogenase from Flavobacterium PL002 as a potent catalyst for acetaldehyde determination in wine

Sequence analysis of S2-ALDH BLAST screening of the Flavobacterium PL002 genome sequence42 led to identification of a coding region homologous to aldehyde dehydrogenase gene (1365 bp) coding for the hypothetical enzyme S2-ALDH of 454 amino acids, with calculated MW 49,062 (Supplementary Fig. 1S). Phylogenetic analysis of the S2-ALDH amino acid sequence in…

Continue Reading Antarctic aldehyde dehydrogenase from Flavobacterium PL002 as a potent catalyst for acetaldehyde determination in wine

Contrasting levels of hybridization across the two contact zones between two hedgehog species revealed by genome-wide SNP data

Ai H, Fang X, Yang B, Huang Z, Chen H, Mao L et al. (2015) Adaptation and possible ancient interspecies introgression in pigs identified by whole-genome sequencing. Nat Genet 47:217–225 CAS  PubMed  Article  Google Scholar  Alexander DH, Lange K (2011) Enhancements to the ADMIXTURE algorithm for individual ancestry estimation. BMC…

Continue Reading Contrasting levels of hybridization across the two contact zones between two hedgehog species revealed by genome-wide SNP data

Protein-protein Simulation RMSD, energy scoring, etc – User discussions

mike October 14, 2022, 1:29am #1 GROMACS version: 2022.3GROMACS modification: Yes/NoHere post your question I am performing a protein-protein MD simulation, however I am running into an issue such as listed below, where it says “Protein” I can’t distinguish between the two proteins being docked. How would I create an…

Continue Reading Protein-protein Simulation RMSD, energy scoring, etc – User discussions

Removing metadata rows containing NA values in GRanges

Removing metadata rows containing NA values in GRanges 1 @3a63554b Last seen 20 hours ago Singapore I’m looking for promoters for protein coding transcripts in GRanges, and I end up with lots of NA values in my protein_id metadata column. Is there a way to remove the rows corresponding to…

Continue Reading Removing metadata rows containing NA values in GRanges

Emerging role of STING signalling in CNS injury: inflammation, autophagy, necroptosis, ferroptosis and pyroptosis | Journal of Neuroinflammation

Langlois JA, Rutland-Brown W, Wald MM. The epidemiology and impact of traumatic brain injury: a brief overview. J Head Trauma Rehabil. 2006;21:375–8. doi.org/10.1097/00001199-200609000-00001. Article  PubMed  Google Scholar  Cao HQ, Dong ED. An update on spinal cord injury research. Neurosci Bull. 2013;29:94–102. doi.org/10.1007/s12264-012-1277-8. Article  PubMed  Google Scholar  O’Donnell MJ, Xavier D,…

Continue Reading Emerging role of STING signalling in CNS injury: inflammation, autophagy, necroptosis, ferroptosis and pyroptosis | Journal of Neuroinflammation

File homo_ref.faa does not exist

I got fasta output by using the following codes in R. And I need to read my fasta file (homo_ref.faa) that I obtained using these codes as “ makeblastdb -in homo_ref.faa -dbtype prot ” via terminal. But I get “BLAST options error: File homo_ref.faa does not exist“. How would you…

Continue Reading File homo_ref.faa does not exist

ggplot2 – Issue in creating polygon in ggplot in R

Why does my polygon look like two triangles instead of a box? Can some help explain how I can turn the polygon into a box? data <- structure(list(AREA = c(“a”, “a”, “b”, “b”), Lat = c(43.68389835, 43.68389835, 44.3395883, 44.3395883), Long = c(-88.22909367, -88.99888743, -88.22909367, -88.99888743)), row.names = c(NA, -4L), spec…

Continue Reading ggplot2 – Issue in creating polygon in ggplot in R

Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

Author List Haga K, Lemp NA, Logg CR, Nagashima J, Faure-Kumar E, Gomez GG, Kruse CA, Mendez R, Stripecke R, Kasahara N, Kasahara NA, Cicciarelli JC Publication ID (Profile URL) researcherprofiles.org/profile/27465210 Publication Title Haga K, Lemp NA, Logg CR, Nagashima J, Faure-Kumar E, Gomez GG, Kruse CA, Mendez R, Stripecke…

Continue Reading Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

r – Adding values as text in raster images – ggplot2

I am plotting values in SpeedClass as rasterfile. I want to add text to the each tile to show the AvgSpeed from column 3. enter image description here Here is my code so far: AllDataSBAvgSpeed <- aggregate(AllDataSB$speed ~ AllDataSB$milepost + AllDataSB$Time, data = AllDataSB, mean) colnames(AllDataSBAvgSpeed)[1] <- “milepost” colnames(AllDataSBAvgSpeed)[2] <-…

Continue Reading r – Adding values as text in raster images – ggplot2

Bioinformatics Analysis of the Key Genes and Pathways in Multiple Myel

Introduction Multiple myeloma is a B-cell malignancy characterized by the malignant proliferation of clonal plasma cells in bone marrow,1 It is the second most common hematological malignancy after lymphoma.2 The age-standardised rate (ASR) of multiple myeloma incidence was 1·78 (95% UI 1·69-1·87) per 100 000 people globally and mortality was…

Continue Reading Bioinformatics Analysis of the Key Genes and Pathways in Multiple Myel

plm – Error with indexing pdata.frame in r using pgmm()

I am a student and struggling with a specific problem regarding the pgmm() function of the plm package in R. I have a pdata.frame for which I want to use the pgmm function for a dynamic panel model. However, the following error occurs: Error in pdata.frame(data, index): variable NA does…

Continue Reading plm – Error with indexing pdata.frame in r using pgmm()

NODULIN HOMEOBOX is required for heterochromatin homeostasis in Arabidopsis

NDX is a heterochromatin-associated factor To understand the genome-wide regulatory roles of NDX, we first analyzed its genomic distribution. For this, we performed chromatin immunoprecipitation sequencing (ChIP-seq) in 10-day old Arabidopsis seedlings expressing N-terminally and C-terminally tagged NDX fusion proteins (flag-NDX/ndx1-1(FRI)/flc-2 and NDX-GFP/ndx1-1(FRI)/flc-2, respectively) expressed from their endogenous promoter21,32. The…

Continue Reading NODULIN HOMEOBOX is required for heterochromatin homeostasis in Arabidopsis

Differential enrichment of H3K9me3 in intrahepatic cholangiocarcinoma | BMC Medical Genomics

Sia D, Tovar V, Moeini A, Llovet JM. Intrahepatic cholangiocarcinoma: pathogenesis and rationale for molecular therapies. Oncogene. 2013;32(41):4861–70. CAS  Article  Google Scholar  Sungwan P, Lert-Itthiporn W, Silsirivanit A, Klinhom-On N, Okada S, Wongkham S, Seubwai W. Bioinformatics analysis identified CDC20 as a potential drug target for cholangiocarcinoma. PeerJ. 2021;9:e11067. Article …

Continue Reading Differential enrichment of H3K9me3 in intrahepatic cholangiocarcinoma | BMC Medical Genomics

ggplot2 – Query On geom_raster When Creating Maps

I have a code for creating a map that works. I am now trying to add a raster layer with salinity gradient. I have been following a couple of tutorials and my current approach goes as follows: # Loads .TIF file ~ Salinity <- stack(“Present.Surface.Salinity.Mean.tif”) # Converts .TIF into dataframe…

Continue Reading ggplot2 – Query On geom_raster When Creating Maps

Proscillaridin A induces mitochondrial damage and autophagy in pancreatic cancer and reduces the stability of SMAD4 in Panc-1 cells – Hou

Introduction Pancreatic cancer (PC) is one of the most aggressive and lethal cancers (1). Previous studies have shown that aging, environmental and behavioral changes are more closely related to the dramatic increase in the incidence of PC worldwide than genetic factors (2–5). A position paper published by the European Federation…

Continue Reading Proscillaridin A induces mitochondrial damage and autophagy in pancreatic cancer and reduces the stability of SMAD4 in Panc-1 cells – Hou

Patrick Murphy Bulk RNA-Seq – HackMD

Patrick Murphy Bulk RNA-Seq – HackMD        owned this note   Published Linked with GitHub — title: ‘Patrick Murphy Bulk RNA-Seq’ disqus: hackmd — Patrick Murphy bulk RNA-Seq Analysis === ## Table of Contents [TOC] ## 1. Introduction This is a bulk RNA-Seq project, which includes human data….

Continue Reading Patrick Murphy Bulk RNA-Seq – HackMD

Interfering B cell receptor signaling via SHP-1/p-Lyn axis shows therapeutic potential in diffuse large B-cell lymphoma | Molecular Medicine

Alizadeh AA, Eisen MB, Davis RE, Ma C, Lossos IS, Rosenwald A, et al. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature. 2000;403(6769):503–11. CAS  PubMed  Article  Google Scholar  Camicia R, Winkler HC, Hassa PO. Novel drug targets for personalized precision medicine in relapsed/refractory diffuse large…

Continue Reading Interfering B cell receptor signaling via SHP-1/p-Lyn axis shows therapeutic potential in diffuse large B-cell lymphoma | Molecular Medicine

Dietary selection of metabolically distinct microorganisms drives hydrogen metabolism in ruminants

Volatile fatty acid production and absorption is modulated by diet Animals were adapted to a starch-rich diet by gradually increasing dietary concentrate content from 50 to 90% over the three 100-d experimental periods (Fig. 1A). With both diets, rumen structure and epithelial morphology were robust and rumen pH remained above 6.0…

Continue Reading Dietary selection of metabolically distinct microorganisms drives hydrogen metabolism in ruminants

Targeted inhibition of ubiquitin signaling reverses metabolic reprogramming and suppresses glioblastoma growth

Cell culture Human glioblastoma cells (U87MG and U87MG-Luc) and human embryonic kidney cells (HEK293) were obtained from the American Type Culture Collection (Manassas, Va.). Cells were cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum (Gibco™ Fetal Bovine Serum South America, Thermo Scientific Fisher-US), 2 mM l-glutamine, 50 U/ml…

Continue Reading Targeted inhibition of ubiquitin signaling reverses metabolic reprogramming and suppresses glioblastoma growth

Gene Expression Analysis Steps ?

Hi everybody, I’m new in this field. I’m trying to replicate a paper to train my self . The results come out pretty the same but not exactly the same, so I wanted to know if all my steps are right or if I’m missing something ( or even completely…

Continue Reading Gene Expression Analysis Steps ?

Is there a way to force specific dates to display on the x-axis in ggplot? : RStudio

Hello, I’m trying to build a time series of instrument responses against a reference instrument. I pulled the reference instrument data from a SQL server – it’s not been manipulated beyond that. When I try to use the Date_Time to plot that the SQL server spits out, I get the…

Continue Reading Is there a way to force specific dates to display on the x-axis in ggplot? : RStudio

AURKA is a prognostic potential therapeutic target in skin cutaneous melanoma modulating the tumor microenvironment, apoptosis, and hypoxia

Aran D, Hu Z, Butte AJ (2017) xCell: digitally portraying the tissue cellular heterogeneity landscape. Genome Biol 18(1):220. doi.org/10.1186/s13059-017-1349-1 CAS  Article  PubMed  PubMed Central  Google Scholar  Bajor DL, Mick R, Riese MJ, Huang AC, Sullivan B, Richman LP, Torigian DA, George SM, Stelekati E, Chen F, Melenhorst JJ, Lacey SF,…

Continue Reading AURKA is a prognostic potential therapeutic target in skin cutaneous melanoma modulating the tumor microenvironment, apoptosis, and hypoxia

[Solved] Omit SOME data labels from ggplot bar plot

finalBarPlotData <- structure(list(State = structure(c(2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 1L, 10L, 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 1L, 10L, 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 1L, 10L, 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 1L, 10L, 2L, 3L, 4L, 5L, 6L, 7L,…

Continue Reading [Solved] Omit SOME data labels from ggplot bar plot

Researchers Discover Novel Light-Gated Potassium Channel in Neurons

Summary: Researchers report they have identified the first natural light-gated potassium channel-rhodopsins. Source: Baylor College of Medicine A key approach to understanding the brain is to observe the behavioral effects of turning on specific populations of neurons. One of the most popular approaches to controlling neuronal activity in model systems…

Continue Reading Researchers Discover Novel Light-Gated Potassium Channel in Neurons

SMAD4 rs10502913 | COPD

1Department of Pulmonary and Critical Care Medicine, Sinopharm Tongmei General Hospital, Datong, People’s Republic of China; 2China-Japan Friendship Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, People’s Republic of China; 3Department of Emergency, Chinese PLA General Hospital -Fourth Medical Center, Beijing, People’s Republic of China; 4School…

Continue Reading SMAD4 rs10502913 | COPD

Python pandas transforming int to float in gff subsetting

Hey guys, I’ve written this python code. import pandas as pd from Bio import SeqIO import argparse parser= argparse.ArgumentParser(add_help=False) parser.add_argument(“-h”, “–help”, action=”help”, default=argparse.SUPPRESS, help= “Get partial gff given a pattern on Names field”) parser.add_argument(“-g”, help= “-g: gff file”, required = “True”) parser.add_argument(“-l”, help= “-l: list of patterns to search on…

Continue Reading Python pandas transforming int to float in gff subsetting

rna seq – Tutorial for the WGCNA: changes in heatmap colours

I am trying to reproduce the results of the R tutorial of the WGCNA package. In section I number 5, when generating the heatmap it is quite similar to the one provided by the pdf but the colours of the heatmap differ from the document. Is it possible to change…

Continue Reading rna seq – Tutorial for the WGCNA: changes in heatmap colours

How to Make Grouped Violinplot with jittered data points in R

In this post, we will learn how to make grouped violin plot with jittered data points on top of it using ggplot2 in R. One of the challenges in making grouped violin or box plots with jittered data points is proper alignment of data points and the underlying plot. In…

Continue Reading How to Make Grouped Violinplot with jittered data points in R

Error when adding new residue to hdb (CHARMM36) – User discussions

dom June 26, 2022, 2:05am #1 GROMACS version:2022.2GROMACS modification: No I am adding a new protein residue to the CHARMM36 forcefield (July 2021). As per the instructions in the GROMACS manual (“Adding a Residue to a Force Field”), I modified residuetypes.dat, aminoacids.rtp, and aminoacids.hdb with the new residue entry. It…

Continue Reading Error when adding new residue to hdb (CHARMM36) – User discussions

extendedSequences length is not the required for DeepCpf1 (34bp)

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

Continue Reading extendedSequences length is not the required for DeepCpf1 (34bp)

Escherichia coli K-12 substr. MG1655 EC 2.7.1.180

BioCyc ID: RXN-14461 EC Number: 2.7.1.180 Enzymes and Genes: FAD:protein FMN transferase: ftp Reaction Locations: periplasmic space The reaction direction shown is in accordance with the direction in which it was curated. Mass balance status: Balanced. Enzyme Commission Primary Name: FAD:protein FMN transferase Enzyme Commission Synonyms: flavin transferase, apbE (gene…

Continue Reading Escherichia coli K-12 substr. MG1655 EC 2.7.1.180

python – Matching two files(vcf to maf) using a dictionaries, and appending the contents

annotation_file ##INFO=<ID=ClinVar_CLNSIG,Number=.,xxx ##INFO=<ID=ClinVar_CLNREVSTAT,Number=.,yyy ##INFO=<ID=ClinVar_CLNDN,Number=.zzz #CHROM POS ID REF ALT QUAL FILTER INFO chr1 10145 . AAC A 101.83 . AC=2;AF=0.067;AN=30;aaa chr1 10146 . AC A 98.25 . AC=2;AF=0.083;AN=24;bbb chr1 10146 . AC * 79.25 . AC=2;AF=0.083;AN=24;ccc chr1 10439 . AC A 81.33 . AC=1;AF=0.008333;AN=120;ddd chr1 10450 . T G 53.09…

Continue Reading python – Matching two files(vcf to maf) using a dictionaries, and appending the contents

ERROR No such moleculetype NA – User discussions

GROMACS version:GROMACS modification: Yes/No I got this errorwhen I run the line: gmx grompp -f em.mdp -c solv_ions.gro -p topol.top -o em.tpr -maxwarn 10in the topol.top there is 3 NA atoms 🙂 GROMACS – gmx grompp, 2020.1-Ubuntu-2020.1-1 (-: GROMACS is written by: Emile Apol Rossen Apostolov Paul Bauer Herman J.C….

Continue Reading ERROR No such moleculetype NA – User discussions

Using element_ Textcustomize text in ggplot2

Ggplot2’s theme system allows us to better control graphicsNon data elementTo enhance the beauty of the image through more subtle modifications,Theme system of ggplot2Self contained multipleelement_function element_text( ) element_line( ) element_rect( ) element_blank( ) This section describes the topic element element_ Text (), which controls many parts of text elements…

Continue Reading Using element_ Textcustomize text in ggplot2

Merge multiple text files to create a combined dataframe and rename columns in R – General

Hi, I have multiple .txt files (each file contains 4 columns; an identifier Gene column, a raw_counts and other columns). I would like to merge those files into a combined dataframe using the common gene column. I was able to import multiple .txt files together, merge based on identifier column,…

Continue Reading Merge multiple text files to create a combined dataframe and rename columns in R – General

Description, Programming Languages, Similar Projects of ggfx

ggfx is a (currently experimantal) package that allows the use of various filters and shaders on ggplot2 layers. Installation You can install ggfx from CRAN in the usual manner (install.packages(‘ggfx’)) or you can grab the development version directly from github using the devtools package: # install.packages(‘devtools’) devtools::install_github(‘thomasp85/ggfx’) Example The basic…

Continue Reading Description, Programming Languages, Similar Projects of ggfx

python – Scikit optimize with objective function returning None

Can the expensive objective function that is being passed to scikit-optimize return None (NA/NaN/…) type? I would need to optimize simulation parameters and sometimes, the simulation can return a non-feasible result. I could theoretically return some artificially large number (1/ε), but that would probably break the scikit normality assumption. And…

Continue Reading python – Scikit optimize with objective function returning None

Breast Reconstruction with Inferior Flap and Fat Transfer as Curative Treatment for BIA-ALCL

Araco A, Gravante G, Araco F, Delogu D, Cervelli V, Walgenbach K. A retrospective analysis of 3,000 primary aesthetic breast augmentations: postoperative complications and associated factors. Aesthet Plast Surg. 2007;31(5):532–9. doi.org/10.1007/s00266-007-0162-8. CAS  CrossRef  Google Scholar  Nahabedian MY, Patel K. Management of common and uncommon problems after primary breast augmentation. Clin…

Continue Reading Breast Reconstruction with Inferior Flap and Fat Transfer as Curative Treatment for BIA-ALCL

Parse a file of strings in python separated by newline into a json array

I don’t see where you’re actually reading from the file in the first place. You have to actually read your path_text.txt before you can format it correctly right? with open(‘path_text.txt’,’r’,encoding=’utf-8′) as myfile: content = myfiel.read().splitlines() Which will give you [‘/gp/oi/eu/gatk/inputs/NA12878_24RG_med.hg38.bam’, ‘/gp/oi/eu/gatk/inputs/NA12878_24RG_small.hg38.bam’] in content. Now if you want to write this…

Continue Reading Parse a file of strings in python separated by newline into a json array

Reordering boxplot (ggplot) with scale_x_discrete(limits=(…) results in Warning message: Removed 103 rows containing missing values (stat_boxplot)

Probably a user error but I can’t find it for the life of me. Trying to rearrange the order of factors in a boxplot I am making using ggplot using the, “scale_x_discrete(limits=(…)” function. Doing so results in the following warning message “Warning message: Removed 103 rows containing missing values (stat_boxplot”….

Continue Reading Reordering boxplot (ggplot) with scale_x_discrete(limits=(…) results in Warning message: Removed 103 rows containing missing values (stat_boxplot)

[Solved] tryCatch not catching error produced by install.packages within RStudio

RStudio does not exectute the normal install.packages but instead does its own thing: look at the code in RStudio: > install.packages function (…) .rs.callAs(name, hook, original, …) <environment: 0x3e4b478> > .rs.callAs function (name, f, …) { withCallingHandlers(tryCatch(f(…), error = function(e) { cat(“Error in “, name, ” : “, e$message, “\n”,…

Continue Reading [Solved] tryCatch not catching error produced by install.packages within RStudio

[BioC] rtracklayer 1.6: invalid class “ucscCart” object

Dear Bioc, Following the rtracklayer documentation, section 2.2.4, ‘A Shortcut’, I encounter the following error browseGenome (subTargetTrack) Error in validObject(.Object) :invalid class “ucscCart” object: superclass “ANYTHING” not defined in the environment of the object’s class traceback () 13: stop(msg, ” “, errors, domain = NA)12: validObject(.Object)11: initialize(value, …)10: initialize(value, …)9:…

Continue Reading [BioC] rtracklayer 1.6: invalid class “ucscCart” object

xml – I am trying to importxml from ENSEMBL using xpath copied from Chrome, but it is not working

I want to use google sheet’s IMPORTXML to extract the gene name (SLC3A1) and ensembl ID (ENSG00000138079) from this URL: asia.ensembl.org/Multi/Search/Results?q=SLC3A1;site=ensembl I tried copying xpath from Chrome and also tried deriving it on my own step by step, but I am only getting a #NA. My xpath: /html/body/div[1]/div/div[2]/div[1]/div[1]/div[2]/div[2]/div[4]/div/div/div[2]/div/div/div[3]/div[2]/div[1]/div[2]/div/div/div/div[1]/div/div[2]/span From Chrome:…

Continue Reading xml – I am trying to importxml from ENSEMBL using xpath copied from Chrome, but it is not working

CYP2D6 antibody | Anti-CYP2D6 | stjohnslabs

Host: Goat Applications: Pep-ELISA, WB Reactivity: Human Note: FOR RESEARCH USE ONLY (RUO). Short Description: Goat polyclonal antibody anti-CYP2D6 (C-Term) is suitable for use in ELISA and Western Blot research applications. Clonality: Polyclonal Conjugation: Unconjugated Isotype: IgG Formulation: 0.5 mg/ml in Tris saline, 0.02% sodium azide, pH7.3 with 0.5% bovine…

Continue Reading CYP2D6 antibody | Anti-CYP2D6 | stjohnslabs

LinkedIn

LinkedIn svg{display:block;margin:auto}li-icon[type$=-icon]{width:24px;height:24px}li-icon[type$=-icon][size=small]{width:16px;height:16px}li-icon[type$=-icon]>svg{vertical-align:top}li-icon[type^=nav-]{width:32px!important;height:32px!important}li-icon .inactive-item,li-icon .large-icon{fill:currentColor}li-icon .active-item,li-icon .small-icon{fill:currentColor;visibility:hidden}li-icon[size=small] .inactive-item,li-icon[size=small] .large-icon,li-icon[type^=nav-][active] .inactive-item,li-icon[type^=nav-][active] .large-icon{visibility:hidden}li-icon[size=small] .active-item,li-icon[size=small] .small-icon,li-icon[type^=nav-][active] .active-item,li-icon[type^=nav-][active] .small-icon{visibility:visible}li-icon[type^=app-]{width:40px!important;height:40px!important}li-icon[type=loader]{fill-opacity:1;stroke-opacity:1;fill:transparent;stroke:transparent}li-icon[type=loader][size=small]{fill-opacity:0;stroke-opacity:0;fill:currentColor;stroke:currentColor}li-icon .color-icon,li-icon[color] .solid-icon{display:none}li-icon[color] .color-icon{display:block}li-icon[type^=large-],li-icon[type^=large-][size=small]{width:48px!important;height:48px!important}[dir=rtl] li-icon[type*=arrow],[dir=rtl] li-icon[type*=chevron],[dir=rtl] li-icon[type*=follow],[dir=rtl] li-icon[type=enter-icon],[dir=rtl] li-icon[type=forward-icon],[dir=rtl] li-icon[type=leave-icon],[dir=rtl] li-icon[type=question-pebble-icon],[dir=rtl] li-icon[type=reply-icon],[dir=rtl] li-icon[type=share-ios-icon],[dir=rtl] li-icon[type=share-linkedin-icon],[dir=rtl] li-icon[type=to-end-icon],[dir=rtl] li-icon[type=to-start-icon]{transform:rotateY(180deg)}[dir=rtl] li-icon>svg{float:left}li-icon[type$=-pebble-icon][animate]{transform:scale(.2);animation:b 334ms ease-in-out forwards}li-icon[type$=-pebble-icon][animate] .circle{stroke-dasharray:63;stroke-dashoffset:63;animation:a .5s ease-out forwards;animation-delay:334ms}li-icon[type$=-pebble-icon][animate][size=small] .circle{stroke-dasharray:38;stroke-dashoffset:38}li-icon[type^=premium-]{width:auto;height:16px}li-icon[type^=premium-][type^=premium-app-icon],li-icon[type^=premium-][type^=premium-inverse-app]{height:24px}li-icon[type^=premium-][size=”8dp”]{height:8px}li-icon[type^=premium-][size=”10dp”]{height:10px}li-icon[type^=premium-][size=”12dp”]{height:12px}li-icon[type^=premium-][size=”16dp”]{height:16px}li-icon[type^=premium-][size=”20dp”]{height:20px}li-icon[type^=premium-][size=”24dp”]{height:24px}li-icon[type^=premium-][size=”32dp”]{height:32px}li-icon[type^=premium-] text{font-size:24px;font-weight:600;letter-spacing:4px;dominant-baseline:text-before-edge;font-family:Source Sans Pro,Helvetica,Arial,sans-serif}@media screen and (-ms-high-contrast:white-on-black){li-icon[type=premium-app-icon],li-icon[type=premium-badge]{-ms-high-contrast-adjust:none;background-color:#fff}li-icon[type=premium-app-icon] svg,li-icon[type=premium-badge] svg{height:90%!important;position:relative;top:5%;right:2%}}@media screen and (-ms-high-contrast:black-on-white){li-icon[type=premium-inverse-app-icon],li-icon[type=premium-inverse-badge]{-ms-high-contrast-adjust:none;background-color:#000}li-icon[type=premium-inverse-app-icon] svg,li-icon[type=premium-inverse-badge]…

Continue Reading LinkedIn

Human stem cell modelling for heart disease of long QT syndrome

Abstract Sudden cardiac death (SCD) in otherwise healthy young people is a public health priority. Long QT syndrome (LQTS) is the commonest life-threatening cardiac arrhythmia contributing to SCD under 40 years old with an estimated prevalence of 1:2,000. Cardiac rhythm is driven by coordinated cardiac action potential, which is triggered…

Continue Reading Human stem cell modelling for heart disease of long QT syndrome

Unable to open pdf file of volcano plots created using many group comparisons from EnhancedVolcano package in R

Hi, I am working with a dataframe in R containing the quantitative data and trying to plot a volcano plot using library(EnhancedVolcano) package. I am currently analyzing by subsetting based on corresponding matching pairs of “Coef” and “P.value” obtained from limma (for instance; Coef.HC_6h_vs_0h and P.value.HC_6h_vs_0h) individually and export the…

Continue Reading Unable to open pdf file of volcano plots created using many group comparisons from EnhancedVolcano package in R

Endometriosis-related functional modules and hub genes

Introduction Endometriosis (EMS) is a chronic gynecological disease defined as implantation and periodic growth of the endometrial glands and stroma outside the uterine cavity, causing chronic pelvic pain, severe dysmenorrhea, and infertility in 10% reproductive-age women, among which the infertility rate is approximately 30–50%.1,2 Surgical excision is commonly used for…

Continue Reading Endometriosis-related functional modules and hub genes

Digital Identity Solutions Market In-Depth Analysis including Development Strategy, Regional Analysis, Key Segmentation by Major Companies like IDEMIA, ForgeRock, Imageware Systems, Jumio, NEC, Samsung SDS

“ The global Digital Identity Solutions Market is an information rich representation of the current market developments that echo upward spike in growth numbers. Our team of research experts at Adroit Market Research has relied upon dedicated primary and secondary research methodologies to make accurate deductions of the market developments,…

Continue Reading Digital Identity Solutions Market In-Depth Analysis including Development Strategy, Regional Analysis, Key Segmentation by Major Companies like IDEMIA, ForgeRock, Imageware Systems, Jumio, NEC, Samsung SDS

r – How to combine two qualitative data to make a bar graph

If you want to make two graphs to display Yesterday and Today in a single ggplot (or want to display both in the same plot) you’ll need to include a pivot_longer Example data df <- as.data.frame(structure(c(1L, 2, 3, 4, 5, 6, “Male”, “Female”, “Female”, “Male”, “Male”, “Female”, “Very good”, “Good”,…

Continue Reading r – How to combine two qualitative data to make a bar graph

Pangenome-based genome inference allows efficient and accurate genotyping across a wide spectrum of variant classes

Sequencing data We used publicly available sequencing data from the GIAB consortium45, 1000 Genomes Project high-coverage data46 and Human Genome Structural Variation Consortium (HGSVC)4. All datasets include only samples consented for public dissemination of the full genomes. Statistics and reproducibility For generating the assemblies, we used all 14 samples for…

Continue Reading Pangenome-based genome inference allows efficient and accurate genotyping across a wide spectrum of variant classes

r – convert ALL genes from ensembl ID to symbol without NAs

I tried to convert genes with ensembl ID to Symbol I used the “EnsDb.Hsapiens.v86” package using this code: library(“EnsDb.Hsapiens.v86”) mapIds <- mapIds(EnsDb.Hsapiens.v86, keys = genes, keytype = “GENEID”, column = “SYMBOL”) mapIds Results is like that: ENSG00000033327 GAB2 ENSG00000033627 ATP6V0A1 ENSG00000033800 PIAS1 ENSG00000033867 SLC4A7 ENSG00000034063 < NA > ENSG00000034152 MAP2K3…

Continue Reading r – convert ALL genes from ensembl ID to symbol without NAs

Install Bioconductor package using rpy2 in Python Jupyter notebook

This introduction comes from this SO question: “argument is of length zero” is a very specific problem that comes from one of my least-liked elements of R. Let me demonstrate the problem: > FALSE == “turnip” [1] FALSE > TRUE == “turnip” [1] FALSE > NA == “turnip” [1] NA…

Continue Reading Install Bioconductor package using rpy2 in Python Jupyter notebook

Histograms using ggplot2 within loop

I agree with @GabrielMagno, facetting is the way to go. But if for some reason you need to work with the loop, then either of these will do the job. library(gridExtra) library(ggplot2) df<-matrix(NA,2000,5) df[,1]<-rnorm(2000,1,1) df[,2]<-rnorm(2000,2,1) df[,3]<-rnorm(2000,3,1) df[,4]<-rnorm(2000,4,1) df[,5]<-rnorm(2000,5,1) df<-data.frame(df) out<-list() for (i in 1:5){ x = df[,i] out[[i]] <- ggplot(data.frame(x),…

Continue Reading Histograms using ggplot2 within loop

How to specify tagging levels when using textual layout in patchwork package? – General

I want to tag the plots: A1, A2, B. I can get A-C and A1-A3 but not what I am after, what am I missing? #Grid layout grid <- ” AABB CCCC ” #the following tags A-C patchwork <- p1 + p2 + p3 + plot_layout(design = grid, guides =…

Continue Reading How to specify tagging levels when using textual layout in patchwork package? – General

Accepted slurm-wlm 21.08.6-1 (source) into unstable

—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA512 Format: 1.8 Date: Tue, 22 Mar 2022 21:59:40 +0100 Source: slurm-wlm Architecture: source Version: 21.08.6-1 Distribution: unstable Urgency: medium Maintainer: Debian HPC Team <debian-…@lists.debian.org> Changed-By: Gennaro Oliva <oliv…@na.icar.cnr.it> Changes: slurm-wlm (21.08.6-1) unstable; urgency=medium . * New upstream release * Remove fix-typos patch included upstream…

Continue Reading Accepted slurm-wlm 21.08.6-1 (source) into unstable

ggplot2 – How To Update R Values

I have the below code which runs a 3 month picture of my metrics. I open the saved code, remove “Nov-21” and add “Feb-22”, then delete the first entry for each metric and add “Feb-22” entry to end of each metric (957L, 1208L, 1054L, 476L). Previously, the 3 month picture…

Continue Reading ggplot2 – How To Update R Values

Development of Cas12a-Based Cell-Free Small-Molecule Biosensors via Allosteric Regulation of CRISPR Array Expression

In nature, microbes have evolved different systems to sense external stimuli. Synthetic biology approaches (1) repurpose these systems as biosensors to specifically and sensitively detect various targets of interest. Although various highly sensitive and specific laboratory-based analytical methods (including high-performance liquid chromatography and mass spectrometry) can detect small-molecule targets, they…

Continue Reading Development of Cas12a-Based Cell-Free Small-Molecule Biosensors via Allosteric Regulation of CRISPR Array Expression

Htseq is giving me 0 counts using the GFF3 of miRBase

Hello! I am trying to annotate a miRNA-seq so that it gives me mature miRNAs where I already have 5p and 3p. For this, I have used the index mm10.fa and the miRBase mmu.gff3. I have aligned with HISAT2 and am trying to count with HTSeq, however I get 0…

Continue Reading Htseq is giving me 0 counts using the GFF3 of miRBase

A Comprehensive Guide on ggplot2 in R

                                                                  Image source: Author       Introduction Visualization plays an important role in the decision-making process after analyzing relevant data. Graphical representation highlighting the interdependence of key elements affecting performance is important in the above process. There are many libraries in Python and R which provide different options showing…

Continue Reading A Comprehensive Guide on ggplot2 in R

Accurate prediction of metagenome-assembled genome completeness by MAGISTA, a random forest model built on alignment-free intra-bin statistics | Environmental Microbiome

Steen AD, Crits-Christoph A, Carini P, DeAngelis KM, Fierer N, Lloyd KG, Cameron TJ. High proportions of bacteria and archaea across most biomes remain uncultured. ISME J. 2019;13:3126–30. PubMed  PubMed Central  Google Scholar  Goh KM, Shahar S, Chan K-G, Chong CS, Amran SI, Sani MH, Zakaria II, Kahar UM. Current…

Continue Reading Accurate prediction of metagenome-assembled genome completeness by MAGISTA, a random forest model built on alignment-free intra-bin statistics | Environmental Microbiome

r – How to get dates aligned with data points in ggplot()

So I have ran into a problem where I can only get my data points to align with the x-axis labels when I specify in scale_x_date(…, date_breaks = “days”) which misrepresents the data. Could someone please give some indication why they aren’t aligned and how to fix it? tidy_sales$Week_End <-…

Continue Reading r – How to get dates aligned with data points in ggplot()

R: PC gamma

PCgamma {GSAgm} R Documentation PC gamma Description For GSA of SNP data, the following two-step procedure is implemented (see Biernacka et al[1] for more details on the method). Step 1: Principal components analysis for SNPs within a gene is completed with the components needed to explain 80 percent of the…

Continue Reading R: PC gamma

Notch activation suppresses endothelial cell migration and sprouting via miR-223-3p targeting Fbxw7

Alabi RO, Farber G, Blobel CP (2018) Intriguing roles for endothelial ADAM10/Notch signaling in the development of organ-specific vascular beds. Physiol Rev 98:2025–2061 CAS  Article  Google Scholar  Autiero M, De Smet F, Claes F, Carmeliet P (2005) Role of neural guidance signals in blood vessel navigation. Cardiovasc Res 65:629–638 CAS …

Continue Reading Notch activation suppresses endothelial cell migration and sprouting via miR-223-3p targeting Fbxw7

The epigenetic dimension of protein structure

References [1] Tunyasuvunakool K, Adler J, Wu Z, Green T, Zielinski M, Žídek A, et al. Highly accurate protein structure prediction for the human proteome. Nature. 2021;596:590–6.10.1038/s41586-021-03828-1Search in Google Scholar [2] Hardy J, Allsop D. Amyloid deposition as the central event in the aetiology of Alzheimer’s disease. Trends Pharmacol Sci….

Continue Reading The epigenetic dimension of protein structure

ggplot2 – How can I directly compute a t-test for proportion in R from a data frame using prop_test?

I have a data frame with n>1000 in which each row includes data for columns Year, which is a numeric year, and Gender, which is either “Male” or “Female”. I want to compute a t-test for the proportion of Gender == “Male” pairwise between Years. I have succeeded in creating…

Continue Reading ggplot2 – How can I directly compute a t-test for proportion in R from a data frame using prop_test?

r – ggplot2 running for minutes without plotting

I am attempting to plot the below vector, but when I run the function, it just continues to run and does not plot. I have waited 5 minutes before I feel uncomfortable and click stop in the console. Wondering what is going on. Up until this point I have had…

Continue Reading r – ggplot2 running for minutes without plotting

Fatty infiltration after rotator cuff tear

Introduction Rotator cuff tear (RCT) is a common shoulder disorder causing shoulder pain and disability. The prevalence of full-thickness RCT is 20.7% in the general population, and increased with age.1 Rotator cuff play essential roles in shoulder function and the treatment of proximal humeral fractures.2,3 It is important to repair…

Continue Reading Fatty infiltration after rotator cuff tear

use tcgabiolinks package to download TCGA data

TCGA Data download in terms of ease of use ,RTCGA The bag should be better , And because it’s already downloaded data , The use is relatively stable . But also because of the downloaded data , There is no guarantee that the data is new .TCGAbiolinks The package is…

Continue Reading use tcgabiolinks package to download TCGA data

r – Creating legend and defining colours for facetwrap with multiple geoms

I’m creating a faceted plot of each sampling point, and trying to show four variables – a bar (species abundance at each sampling point), a line for water depth at the sampling point, another line for river height (measured elsewhere), and symbols for treatment intervention. My problem is I can’t…

Continue Reading r – Creating legend and defining colours for facetwrap with multiple geoms

Estimating prediction accuracy of a Cox survival model using sbrier (R)

You can use the pec package, instead. Example: library(pec) set.seed(18713) library(prodlim) library(survival) dat=SimSurv(100) pmodel=coxph(Surv(time,status)~X1+X2,data=dat) perror=pec(list(Cox=pmodel),Hist(time,status)~1,data=dat) ## cumulative prediction error crps(perror) # between min time and 1 ## same thing: ibs(perror) library(survival) library(ipred) data(“DLBCL”, package = “ipred”) smod <- Surv(DLBCL$time, DLBCL$cens) coxmod <- coxph(smod ~ IPI, data = DLBCL) coxmod Call:…

Continue Reading Estimating prediction accuracy of a Cox survival model using sbrier (R)

Requirement of Xk and Vps13a for the P2X7-mediated phospholipid scrambling and cell lysis in mouse T cells

Significance The extracellular concentration of adenosine triphosphate (ATP) reaches several hundred micromoles in the inflamed tissues or tumor environment. A high concentration of ATP activates P2X7, a purinergic receptor, and induces the formation of a nonselective cation channel, accompanied by reversible phosphatidylserine (PtdSer) exposure, leading to cell lysis. Here, we…

Continue Reading Requirement of Xk and Vps13a for the P2X7-mediated phospholipid scrambling and cell lysis in mouse T cells

r – Reorder and split the ggplot heatmap based on the clusters in one of the columns

I generated a heatmap with ggplot, and order the samples by using hclust, However, I still need more reordering to get all the similar values corespondent with one of the samples in the ordered cluster. Here I generate a samples data to explain better. set.seed(99) M <- data.frame(names = paste0(“g”,…

Continue Reading r – Reorder and split the ggplot heatmap based on the clusters in one of the columns

Quip potential – LAMMPS Development

Hi,I am trying to run quip pair_style in lammps ( 9 Nov 21) to perform MD using my trained gap potential. I trained GAP potential for sodium data using distance_2b and soap as descriptors. But when I run the input file, I get the following warnings and no data are…

Continue Reading Quip potential – LAMMPS Development

[BioC] limma, remove two type of batch effect

Hi All, In my analysis, I want to find the different expression genes betweendissese A and B. There are two type of batch effect in my analysis. Iwant to use limma to remove two type of batch effect, one is gender,another is tissue type. I do as fellow. But I…

Continue Reading [BioC] limma, remove two type of batch effect

ggplot2 – How to wrap graphs by categories while keeping the same width of bars with ggplot in R?

I am struggling with using facet_grid() and facet wrap() with ggplot(). I would like to be able to wrap the different stacked barcharts for every two categories (of the variable Department here) but at the same time have the same width of bars. The first action can be achieved with…

Continue Reading ggplot2 – How to wrap graphs by categories while keeping the same width of bars with ggplot in R?

Plotting date intervals in ggplot2

I have a dataset which has a bunch of date intervals (i.e. POSIXct format start dates and end dates). In the example provided, let’s say it’s each period is associated to when someone was in school or out of school. I’m interested in plotting the data in ggplot2, each row…

Continue Reading Plotting date intervals in ggplot2

Writing ggplot custom geometry function

stat_accum <- function(mapping = NULL, data = NULL, geom = “point”, position = “stack”, …, show.legend = NA, inherit.aes = TRUE) { layer( data = data, mapping = mapping, stat = StatAccum, geom = geom, position = position, show.legend = show.legend, inherit.aes = inherit.aes, params = list( na.rm = na.rm,…

Continue Reading Writing ggplot custom geometry function

ggplot2 – R knitr Markdown: Output Plots within For Loop

I am using child Rmd files in markdown, also works in sweave. in Rmd use following snippet: “`{r run-numeric-md, include=FALSE} out = NULL for (i in c(1:num_vars)) { out = c(out, knit_child(‘da-numeric.Rmd’)) } “` da-numeric.Rmd looks like: Variabele `r num_var_names[i]` ———————————— Missing : `r sum(is.na(data[[num_var_names[i]]]))` Minimum value : `r min(na.omit(data[[num_var_names[i]]]))`…

Continue Reading ggplot2 – R knitr Markdown: Output Plots within For Loop

how to make 2d rendering on directx 11 more faster – Graphics and GPU Programming

I make an editor for own game engine and I used for 2d rendering Direct2D but I wanted to render a directx texture on window in editor, I didn’t find convenient way to convert directx texture to direct2d bitmap. I decided to make own 2d render on directx 11 and…

Continue Reading how to make 2d rendering on directx 11 more faster – Graphics and GPU Programming

Heatmap deseq2

I’m using deseq2 for DEA but when I create a heatmap with only DEGs, it looks very strange: I’m not sure whether there are only overexpressed genes or whether the dataset is not normalized properly. I probably made a mistake somewhere in my coding but I don’t know where to…

Continue Reading Heatmap deseq2

Immune-related Prognostic Genes of ccRCC

Introduction Kidney cancer is one of the most commonly diagnosed tumors around the globe.1 According to the statistics from the World Health Organization, annually, there are more than 140,000 RCC-related deaths.2 ccRCC is the most typical subtype of kidney cancer and contributes to the majority of kidney cancer-related deaths.3,4 Until…

Continue Reading Immune-related Prognostic Genes of ccRCC

Figure.03

%PDF-1.5 % 1 0 obj >/OCGs[10 0 R]>>/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj >stream 2011-01-04T12:38:47-06:00 2011-01-04T12:38:47-06:00 Adobe Illustrator CS4 2011-01-04T12:38:47-05:00 188 256 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgBAAC8AwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FWKeevO135WNhN+jo7nT7mVIJ7mW7S3 f1ZZUjigtYSkj3E7hmfh8C8UPxdsVZXirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVd irsVdirsVdirHfNvkq18zRfV7rUb61spYXtb+xtZIxBdW8hBaOVJY5uPSnqRcJACfixVkWKuxV2K uxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxVi/njzXrWgx2y6 Xo0mqPcK7TTqJGjto0kijaSRIkkdwomL8F+IqjcanbFWFQ/m/wCepNWt7Q+UJ47eaWIR3DQ3wWZG KROE5QI0TCUTEesqjgFLUriqvrX5y+ZtI1C5tj5K1LUUt5LyJmtIbgUNtLd+gQzRFHE9tbwyVQ7e p7Yqq3f5uebY9M0nUYfI2oOupJqTSWLCQXFubCWJI/WCxME9dTKyL+0FFDuaKpOv57+eJLGK4j/L vU1aJ2W+9RJhyWK0a5ZoFENaSMnBGfpUV3NAqmulfnbrF7FLLN5F1mySLT77UG9eN0IayhWVYG5R oPUm5UShPVe/IKqoXf5veeUinls/J8126L/odtEt0zXSpNxkuY5hD9XWMxIzIjSBzsdwRiqK0782 PNElnPdXfle79CG6EbXMNvdcEhJKsrxOgnaRfhPKNGSh6jicVZD+WvnPWvM+n3b6zpLaRqFlMIpr chwAWXlxIkCsHA3I8Cp74qzDFXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FVJry1S 7js2mRbuaOSaKAsObRxMiyOq9SqNKgY9uQ8cVVcVcAAKDYDoMVdirqD7+uKuxV2KuxV2KuxV2Kux V2KuxV2KuxV2KuxVjP6W8y6vqd/b6G9nZWGmTfVZb68hku2nuFVXkWOGKa14JHz482cktUcaAMyq t9S8/wD/AFedK/7hVz/3kcVd9S8//wDV50r/ALhVz/3kcVd9S8//APV50r/uFXP/AHkcVd9S8/8A /V50r/uFXP8A3kcVd9S8/wD/AFedK/7hVz/3kcVS9/I2rXGoR67d66x8y2w9OzuoIBFZxQN/ewC0 aSVmjmPFpeUxYlUKsvEYqj1sfzB4jlrWklqfERpVyAT7D9InFW/qXn//AKvOlf8AcKuf+8jirvqX n/8A6vOlf9wq5/7yOKu+pef/APq86V/3Crn/ALyOKu+pef8A/q86V/3Crn/vI4qhtQn8/aVaS6jJ Np2sQWqmWewt7SazneJAS/oyvdXSGTiPhRkAY7Fl64qyS0uoLu1hu7d+dvcRrLC46MjgMp+kHFVX…

Continue Reading Figure.03

Change size of label annotations in a ggplot

I am trying to change text label sizes inside my plot (not the axes, rather the label annotations) I am working with a phyloseq object but I don’t think that matters. Here is the code and the output. Any suggestions? plot_ordination(prokaryote_ra, ordBC, color = “Stage”, label=”SampleID”) + ggtitle(“PCoA: Bray-Curtis”) graph…

Continue Reading Change size of label annotations in a ggplot

Comparative de novo transcriptome analysis identifies salinity stress responsive genes and metabolic pathways in sugarcane and its wild relative Erianthus arundinaceus [Retzius] Jeswiet

1. Singh, A. et al. Phytochemical profile of sugarcane and its potential health aspects. Pharmacogn. Rev. 9, 45–54 (2015). CAS  PubMed  PubMed Central  Google Scholar  2. Eggleston, G. Positive aspects of cane sugar and sugar cane derived products in food and nutrition. J. Agric. Food Chem. 66, 4007–4012 (2018). CAS …

Continue Reading Comparative de novo transcriptome analysis identifies salinity stress responsive genes and metabolic pathways in sugarcane and its wild relative Erianthus arundinaceus [Retzius] Jeswiet

Monocle3 differential expression failed when active.assay is not “RNA”

after run estimate_size_factors, data with active.assay = ‘integrated’ works too, but no deg in the result. > [email protected] = ‘integrated’ > cds_raw <- as.cell_data_set(seurat_object) Warning: Monocle 3 trajectories require cluster partitions, which Seurat does not calculate. Please run ‘cluster_cells’ on your cell_data_set object > cds <- cluster_cells(cds_raw) > pr_graph_test_res <-…

Continue Reading Monocle3 differential expression failed when active.assay is not “RNA”

python – NameError: name ‘Seq’ is not defined

I want to fill null value with Average. data2 = data.na.drop(Seq(“code”)).select(avg(col(“code”))) data2.display() This error I got: ————————————————————————— NameError Traceback (most recent call last) <command-1060196488305723> in <module> —-> 1 data2 = data.na.drop(Seq(“code”)).select(avg(col(“code”))) 2 data2.display() NameError: name ‘Seq’ is not defined Read more here: Source link

Continue Reading python – NameError: name ‘Seq’ is not defined