Tag: ncbi

Welcome to another blog post! ‍ Reference genomes are essential benchmarks of a species’ genome that facilitate the accurate comparison of individual genomes and are crucial tools for identifying genetic variants and diagnosing rare diseases. Here, we will explore the evolution of the human reference genome, focusing on the transition…

Executive Summary: WuXi AppTec, a major Chinese biotechnology and pharmaceutical firm, claimed that the company has not, does not, and will not pose a national security risk to any country in response to new legislation introduced in the US Congress. The company’s claims are undermined by WuXi Apptec’s network of…

Entry 118725205         ncRNA     T07682                                  Name (RefSeq) U1 spliceosomal RNA   KO K14276   U1 spliceosomal RNA Organism pkl  Pipistrellus kuhlii (Kuhl’s pipistrelle) Pathway pkl03040   Spliceosome Brite KEGG Orthology (KO) [BR:pkl00001] 09120 Genetic Information Processing  09121 Transcription   03040 Spliceosome    118725205 09180 Brite Hierarchies  09182 Protein families: genetic information processing   03041 Spliceosome [BR:pkl03041]    118725205  09184 RNA family   03100 Non-coding RNAs [BR:pkl03100]    118725205Spliceosome [BR:pkl03041] Splicing related RNAs  118725205Non-coding RNAs [BR:pkl03100] Small non-coding…

Entry 4332822           CDS       T01015                                  Name (RefSeq) LOW QUALITY PROTEIN: nuclear cap-binding protein subunit 1-like   KO K12882   nuclear cap-binding protein subunit 1 Organism osa  Oryza sativa japonica (Japanese rice) (RefSeq) Pathway osa03013   Nucleocytoplasmic transport osa03015   mRNA surveillance pathway osa03040   Spliceosome Brite KEGG Orthology (KO) [BR:osa00001] 09120 Genetic Information Processing  09121 Transcription   03040 Spliceosome    4332822  09122 Translation   03013 Nucleocytoplasmic transport    4332822   03015 mRNA…

Cho, C. et al. Haploinsufficiency of protamine-1 or-2 causes infertility in mice. Nat. Genet. 28, 82–86 (2001). Article  CAS  PubMed  Google Scholar  Oliva, R. Protamines and male infertility. Hum. Reprod. Update 12, 417–435 (2006). Article  CAS  PubMed  Google Scholar  Balhorn, R. The protamine family of sperm nuclear proteins. Genome Biol….

Entry 100782702         CDS       T01710                                  Symbol COX2 Name (RefSeq) cytochrome c oxidase subunit 2, mitochondrial   KO K02261   cytochrome c oxidase subunit 2 Organism gmx  Glycine max (soybean) Pathway gmx00190   Oxidative phosphorylation gmx01100   Metabolic pathways Brite KEGG Orthology (KO) [BR:gmx00001] 09100 Metabolism  09102 Energy metabolism   00190 Oxidative phosphorylation    100782702 (COX2) 09180 Brite Hierarchies  09182 Protein families: genetic information processing   03029 Mitochondrial biogenesis…

The Biopython logo Biopython is a set of tools for doing all sorts of genomics tasks: reading DNA and RNA, aligning sequences, analyzing similarities between sequences, and more. This is the second part in a series on analyzing coronavirus RNA with Python. Here we’ll install Biopython and use it to…

The genetic sequence itself doesn’t indicate the origins of the virus that causes Covid-19. (Alissa Eckert/Dan Higgins/CDC) The genetic sequence of SARS-CoV-2, the virus that causes COVID-19, was submitted to a National Institutes of Health database two weeks before its release by the Chinese regime, according to documents that were…

Identification of putative anti-crispr proteins using structural features To identify Acrs in phage genomes, we began by retrieving ~66.5 million proteins from Integrated Microbial Genomes Virus database (IMG/VR)37. We excluded large proteins because over 90% of known Acrs contain less than 200 amino acids38 (Fig. 1A, Supplementary Data 1). To reduce computational…

Bacteria Strain Cori.ST1911 was isolated from fresh stool of 20-week-old C57/BL6J mice fed a HFD at the Animal Center of the West China Hospital of Sichuan University. Briefly, faecal particles were ground with a glass grinding rod and suspended in sterile phosphate-buffered saline (PBS). After gradient dilution, the suspension was…

The specific environmental/history/collection context The Huseby Klev materials were unearthed and collected by archaeologists (including two of the co-authors of this article) during the excavation of this coastal hunter-fisher-gatherer site in the 90s50. The material assemblage was rich and well preserved: human bones, animal bones, plant remains and pieces of…

Less than 15% of the global population lives in Europe or North America. Yet more than 70% of published human microbiome data — on the collections of bacteria, fungi and viruses that live on and in our bodies — comes from European and North American populations1. Around 85% of the…

Ethics and animal welfare statement All infectious work with RESTV, including sample inactivation, was performed in the Containment Level 4 laboratory (CL4) in accordance with the policies and protocols outlined by the Canadian Science Centre for Human and Animal Health Institutional Biosafety Committee. All animal work was performed in strict…

Finding EntreZ IDs for refseq IDs 1 Hi all, I have a list of bacterial RefSeq IDs corresponding to protein sequences (e.g., WP_007430823.1, WP_019686959.1, etc.). I need to retrieve the corresponding EntreZ IDs for these RefSeq IDs, in order to cotinue the RNA-seq downstream analysis (GO enrichment analysis ). Here’s…

From nucleotide or proteine sequences to EC number using biopython 0 Hi, if I have a fasta file containing nucleotide sequences or proteines sequences is it possible to get EC number using biopython for example 1.1.1.169 1.1.1.205 1.1.1.25 1.1.1.302 1.1.1.330 1.1.1.34 ps : I’m working on fungus so I need…

Isolate characteristics From June 2020 to October 2021, our analysis included a total of 28 isolates from patient and environmental samples, all subjected to Whole Genome Sequencing (WGS) (refer to Table 1). To ensure robustness and minimize the influence of sequencing errors on our findings, all 28 WGS datasets maintained a…

Download: pdf | pdf ClinVar RCV Page Survey 2022 Start of Block: Default Question Block OMB Approval Info OMB Control Number: 0925-0648 Expiration Date: 06/30/2024 Public reporting burden for this collection of information is estimated to average 5 minutes per response, including the time for reviewing instructions, searching existing data…

a python beginner here. I have a fasta file with 2500+ sequences, and after doing some analysis I want to remove around 200+ sequences based on the matching IDs. Now, I have one fasta file (as sample.fa) and a text file with a list of IDs for the sequences that…

Broaden your search Bioinformatics, Full Time, $50,000 – $74,999, Colorado 1 Life Sciences, Full Time, $50,000 – $74,999, Postdoc, Colorado 1 Bioinformatics, Full Time, $50,000 – $74,999, Postdoc, United States 5 Refine your search Sign up for job alerts …

Pharmaceutical cell biology Uppsala University Bioinformatics computer lab Student name: 1. Sequence alignment using BLAST You are provided with a file named ‘sequences.txt‘, containing a sequence named ‘Sequence1’, extracted from a viral sample. Your task is to identify the type of virus from which this sequence originates. Visit the NCBI…

Tool:Dot_plot_like_in_BLAST, a standalone tool for making dot plots similar to what online BLAST makes 0 The online BLAST (blast.ncbi.nlm.nih.gov) makes dot plots which look like this: Unfortunately, the standalone BLAST lacks the capability of making dot plots. I have made a tool, named Dot_plot_like_in_BLAST, specifically for this purpose. Basically, it…

Introduction Brucellosis is a zoonotic disease caused by Brucella spp., a gram-negative facultative intracellular coccobacillus.1 These microorganisms can infect livestock, wildlife, and humans, causing significant public concern and substantial agricultural economic loss. Currently, at least six novel Brucella species have been identified: Brucella pinnipedialis, Brucella ceti,2 Brucella papionis,3 Brucella microti,4…

Entry IA203_01755       CDS       T08053                                  Name (GenBank) UDP-N-acetylmuramate dehydrogenase   KO K00075   UDP-N-acetylmuramate dehydrogenase [EC:1.3.1.98] Organism cwk  Corynebacterium wankanglinii Pathway cwk00520   Amino sugar and nucleotide sugar metabolism cwk00550   Peptidoglycan biosynthesis cwk01100   Metabolic pathways cwk01250   Biosynthesis of nucleotide sugars Brite KEGG Orthology (KO) [BR:cwk00001] 09100 Metabolism  09101 Carbohydrate metabolism   00520 Amino sugar and nucleotide sugar metabolism    IA203_01755  09107 Glycan biosynthesis and…

Entry BWI76_09435       CDS       T09148                                  Name (GenBank) glutaredoxin, GrxA family   KO K03674   glutaredoxin 1 Organism klm  Klebsiella sp. M5al Brite KEGG Orthology (KO) [BR:klm00001] 09180 Brite Hierarchies  09182 Protein families: genetic information processing   03110 Chaperones and folding catalysts [BR:klm03110]    BWI76_09435Chaperones and folding catalysts [BR:klm03110] Protein folding catalysts  Protein disulfide isomerase   BWI76_09435 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin Glrx-like Thioredoxin_3…

Introduction The incidence and mortality rates of AF are continuously increasing, leading to serious complications such as heart failure and stroke (Fig. 1) (Sagris et al., 2021). The occurrence and development of AF involve different mechanisms and interactions (Kornej et al., 2020). AF often progresses from paroxysmal to persistent (Nattel…

Introduction Sepsis is one of the major diseases that poses a serious threat to human health, and its incidence and in-hospital mortality rates remain high despite the continuous updating of sepsis guidelines.1 Its main clinical manifestations are elevated body temperature, chills, and rapid heart rate, and it is most common…

Alston JM, Sambucci O. Grapes in the world economy. In: Cantu D, Walker MA, editors. The grape genome. Springer International Publishing; 2019. p. 1–24. Google Scholar  Rahemi A, Dodson Peterson JC, Lund KT. Grape rootstocks and related species. Cham: Springer International Publishing; 2022. Walker MA, Heinitz C, Riaz S, Uretsky…

Position Summary: Stealth NewCo is a discovery-stage biotechnology company leveraging insights in RNA biology to discover and develop new therapeutics for indications across multiple disease areas including oncology and neuromuscular disorders. We are seeking a talented Bioinformatics and Data Science Senior/Principal Scientist with experience analyzing multidimensional chemical, biological, and sequencing…

Description This version is to stay up to date with the improvements and increase in 16S rRNA gene sequences (SSU) added to the GTDB release 214.1.  Please read this post for the stats on the updates. gtdb.ecogenomic.org/stats/r214 . There has been no change to the RDP-RefSeq reference database If anyone…

circRNA-drug sensitivity associations We download the circRNA-drug sensitivity association dataset from reference [17], where Deng et al. [17] collected and organized the association data between circRNA and drug sensitivity from the circRic database [16]. Here, the drug sensitivity and circRNA data come from the GDSC database [19], which provides 80,076…

Summary:Metagenomics, the study of entire microbial communities using genetic sequencing, has gained significant attention in recent years, especially in the LAMEA region (Latin America, Middle East, and Africa). This article explores the fascinating convergence of LAMEA metagenomics and modern technology, highlighting the advancements, challenges, and potential implications for various industries….

Provided by: libbio-eutilities-perl_1.77-2_all NAME Bio::EUtilities – BioPerl low-level API for retrieving and storing data from NCBI eUtils VERSION version 1.77 SYNOPSIS See Bio::DB::EUtilities for example usage with NCBI. DESCRIPTION This distribution encompasses a low-level API for interacting with (and storing) information from) NCBI’s eUtils interface. See Bio::DB::EUtilities for the query…

Dobson, G. E. On a new genus and species of Rhinolophidae, with description of a new species of Vesperus, and notes on some other species of insectivorous bats from Persia. J. Asiat. Soc. Bengal. 40, 455–461 (1871). Google Scholar  Bates, P., Bumrungsri, S., Francis, C., Csorba, G. & Furey, N….

Allam RM, Al-Abd AM, Khedr A, Sharaf OA, Nofal SM, Khalifa AE, Mosli HA, Abdel-Naim AB (2018) Fingolimod interrupts the cross talk between estrogen metabolism and sphingolipid metabolism within prostate cancer cells. Toxicol Lett 291:77–85 Article  CAS  PubMed  Google Scholar  Andrews S et al (2010) FastQC: a quality control tool…

  Q&A Report from the workshop: QuestonWha is he bes msa ool?clusal 2 and clusal omega are he sameHow would we ener multple sequences? because here is only one inpu boxCould he legend explaining symbiols (*, -,…) be shown in he resul window?Wha is he max number of sequences one…

Summary DescriptionFAM86B1 540px.gif English: Protein structure of human FAM86B1 isoform 1 predicted by AlphaFold. Colored by secondary structure, with alpha helices in red and beta strands in yellow. The SKL2 peroxisomal targeting signal is shown in green. Remaining coils are blue. gif shows FAM86B1 slowly spinning, so that the full…

Pair ended short reads assemble to multiple references with a plasmid also inside 0 Hello, I am new to bioinformatics and am having trouble doing an assembly and alignment. First I will describe my sample data, I have Illumina MiSeq data of pair ended reads on a yeast organism. This…

Installation: Tax4Fun2 package are not found and github repository is not maintained anymore 5 Hi everyone! I have tried to find the R package Tax4Fun2 from the paper (pubmed.ncbi.nlm.nih.gov/33902725/) . This R package lets analizes the microbiome in an easy way to predict functional profiles from metagenomic 16S rRNA data….

‘Country’ will transition to ‘Geographic Location’ effective June 2024 As announced earlier this year, we will begin to systematically gather ‘location of collection’ and ‘date and time of collection’ for sequence data submitted to GenBank and the Sequence Read Archive (SRA). As part of this effort and to make location data more accurate and informative,…

Is it possible to obtain all bacterial assemblies from RefSeq and GenBank that contain a specific gene? 0 Hello, I am trying to do some analysis on bacterial assemblies containing a particular AMR gene. I tried searching through NCBI genbank, refseq and it does not give me all the assemblies….

–Must See– Freshers Job Bsc Msc – Freshers Clarivate Job – Associate Content Editor Job Number: JREQ124259 City, ST: Chennai, TN Associate Content Editor – GENESEQ We are seeking an Associate Content Editor to join our GENESEQ process in Hyderabad/Chennai. This presents a fantastic opportunity to contribute to the GENESEQ…

Boukouvala, M. C. et al. Lymantria dispar (L.) (Lepidoptera: Erebidae): Current Status of Biology, Ecology, and Management in Europe with Notes from North America. Insects 13 (2022). Keena M. A., Richards, J. Y. Comparison of Survival and Development of Gypsy Moth Lymantria dispar L. (Lepidoptera: Erebidae) Populations from Different Geographic…

Exercise 1:Finding an unknown gene. Your supervisor has conducted a PCR experiment and given you an unknown sequence for analysis. The sequence is as below: >Unknown_sequence_1 AAATGAGTTAATAGAATCTTTACAAATAAGAATATACACTTCTGCTTAGGATGATAATTG GAGGCAAGTGAATCCTGAGCGTGATTTGATAATGACCTAATAATGATGGGTTTTATTT CCAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAAT TAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCAC CATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCA TCAAAGCATGCCAACTAGAAGAGGTAAGAAACTATGTGAAAACTTTTTGATTATGCAT ATGAACCCTTCACACTACCCAAATTATATATTTGGCTCCATATTCAATCGGTTAGTCTA CATATATTTATGTTTCCTCTATGGGTAAGCTACTGTGAATGGATCAATTAATAAAACACA TGACCTATGCTTTAAGAAGCTTGCAAACACATGAA Guidelines to conduct sequence analysis 1. Navigate to the main BLAST page (blast.ncbi.nlm.nih.gov/Blast.cgi) 2. Select…

Cohorts Saliva and/or blood samples were collected from consenting individuals among four NCIG-partnered communities: Tiwi Islands (comprising the Wurrumiyanga, Pirlangimpi and Millikapiti communities), Galiwin’ku, Titjikala and Yarrabah, between 2015 and 2019. Non-Indigenous comparison data, generated from unrelated Australian individuals of European ancestry, was drawn from two existing biomedical research cohorts:…

What you will do Work with other engineers and scientists to build Isos platform, applying AI to biological systems. Design, develop and maintain bioinformatics pipelines for the ingestion, management and analysis of biological datasets, especially -omics, imaging, and clinical data. Perform data analysis and data quality assurance according to best…

Understanding nanomedicinesNanomedicine in hepatic fibrosis diagnosisNanomedicine in hepatic fibrosis treatmentNanomedicine in drug delivery  Nanomedicine in targeted drug delivery  Future perspectivesReferencesFurther reading Hepatic fibrosis is an abnormal wound-healing response triggered by chronic liver diseases, including non-alcoholic fatty liver disease, viral or alcoholic hepatitis, and Wilson’s disease. The response is characterized by…

How to query NCBI to extract Virus fasta files using BioPython? 1 Hi ! I want to extract the genome fasta files of 30 samples automatically using python script from here www.ncbi.nlm.nih.gov/genomes/GenomesGroup.cgi?taxid=10239&host=bacteria. I want the virusus that have has host bacteria and I am using BioPython Package. Entrez.email = “mail”…

Overview of samples and data The study included 1674 volunteers without apparent diseases (referred to as “healthy”, 712 males and 813 females, age range 0.01–103 years with a median of 41), which comprised 1349 Han Chinese, 309 individuals from seven ethnic minority groups (Tibetan, 93; Hui, 72; Miao, 36; Naxi,…

README This is the large single amplified genome calatog (bbsag20) corresponding to the publication below: Title: “Single Amplified Genome Catalog Reveals the Dynamics of Mobilome and Resistome in the Human Microbiome” (preprint: 10.1101/2023.12.06.570492) Authors: Tetsuro Kawano-Sugaya, Koji Arikawa, Tatsuya Saeki, Taruho Endoh, Kazuma Kamata, Ayumi Matsuhashi, and Masahito Hosokawa Research…

Get a reference phylogenetic tree of known taxa from GTDB 2 Hello, I have a set of genomes I downloaded from NCBI. I would like to make a reference phylogenetic tree where only they appear. Instead of aligning them or using mash distance to make my own tree, is there…

The code and approaches that I share here are those I am using to analyze TCGA methylation data. At the bottom of the page, you can find references used to make this tutorial. If you are coming from a computer background, please bear with a geneticist who tried to code…

Hello Biostars, I am looking for some guidance on how to merge some files for my rna-bulk sequencing analysis. Let me start by describing the problem: I recieved an mRNA sequence of 4775 characters which I would like to merge with the human reference genome that I download from NCBI…

I am getting this error message after using the following code: C:\sratoolkit.3.0.7-win64\sratoolkit.3.0.7-win64\bin>fastq-dump –fasta SRR1658345 Error: 2023-12-11T06:08:04 fastq-dump.3.0.7 err: timeout exhausted while waiting condition within process system module – failed SRR1658345 ============================================================= An error occurred during processing. A report was generated into the file ‘C:\Users\Hp/ncbi_error_report.txt’. If the problem persists, you may…

BLAST1 is widely used in molecular biology to search for nucleotide and protein sequences. Three decades after BLAST was introduced, there were major breakthroughs in structure prediction, and tools such as RoseTTAFold2 and AlphaFold3 emerged. Consequently, every protein sequence in the major sequence databases now comes with a model of…

Virani, S. S. et al. Heart disease and stroke statistics-2021 update: a report from the American Heart Association. Circulation 143, e254–e743 (2021). Article  PubMed  Google Scholar  Nauffal, V. et al. Genetics of myocardial interstitial fibrosis in the human heart and association with disease. Nat. Genet. 55, 777–786 (2023). Article  CAS …

1. Introduction Staphylococcus aureus [1], one of the top five foodborne pathogens, has a common and strong aggressiveness in humans and can secrete multiple toxic proteins (Pathogenic enterotoxins, Hemolysin, PVL) [1,2] which can cause bacteraemia, endocarditis, meningitis, toxic shock syndrome, pneumonia and other dangerous infectious diseases [3]. Moreover, the worldwide…

“Unlock Your Potential: Join AstraZeneca as a Bioinformatics Consultant and Revolutionize Drug Discovery!” –Must See– AstraZeneca Bioinformatics Job Job Post: Consultant – Bio Informatician At AstraZeneca, our mission is to improve the quality of healthcare and make a positive impact on the lives of millions of patients. We are seeking…

SRA toolkit (NCBI) – sra to fasta 1 Dear all, At the moment I’m trying to download sequences from the Sequence Read Archive (SRA) from NCBI and put them into fasta format. For this I downloaded the SRA-toolkit of NCBI and used the following code: set PATH=%PATH%;C:\Users\Admin\Desktop\sratoolkit.2.9.0-win64\sratoolkit.2.9.0-win64\bin prefetch –max-size 100000000…

PacBio subreads.fastq files? 0 I have downloaded PacBio isoseq data as subreads.fastq format from NCBI. Most of the isoseq analysis tools require input as Pacbio .bam file, which is unavailable form NCBI. I want to perform differential gene expression analysis and alternative splicing analysis. I have confusion regarding the nature…

1. Introduction Orientia tsutsugamushi (OT) is an obligate intracellular parasite bacteria and the causative agent of scrub typhus (ST), which is associated with acute febrile illness (AFI) [1] and transmitted by mites through an infected chigger bite (in the larval stage). This disease, which was earlier believed to be endemic…

Features of animal and human isolates of this study On average, sequencing of isolates of this study generated 2.36 M of reads per genome, with an estimated genome size of 4.2 M bases, with a coverage depth of 204X (Table S1). Animal isolates included in this study (n = 33) were found mostly in…

Bark preparation Spruce bark was obtained from the Iggesund pulp and paper mill (Iggesund, Holmen AB, Sweden), from a bark pile resulting from stripping of spruce logs at the mill after harvest, with the average age of trees at harvest being ~70 years. The bark was left to dry at…

A detailed overview of 3 ways to download FASTQ files of SRA runs from NCBI As bioinformaticians, the National Center for Biotechnology Information (NCBI) is one of the most important resources we use to get data. NCBI plays a crucial role in our research community due to its extensive databases…

Wang, P. et al. The genome evolution and domestication of tropical fruit mango. Genome Biol 21 (2020). Tang, C. et al. The rubber tree genome reveals new insights into rubber production and species adaptation. Nat Plants 2 (2016). Bredeson, J. V. et al. Sequencing wild and cultivated cassava and related…

Bacterial strains We used P. putida strains S12, DOT-T1E, F1 (kindly gifted by Grant Rybnicky), ATCC 12633 (purchased from ATCC), JUb85 (kindly provided by Samuel Buck), EM383 (kindly gifted by Huseyin Tas), p106 (kindly provided by Carey-Ann Burnham), and KT2440 (obtained from lab stocks). An overnight culture of each P….

Datasets To avoid the so-called ‘dataset bias’20,that some datasets are generated with specific structures and thus the results are ‘over-optimistic’ (in the case of working with our novel method), we performed the analysis in the light of several real datasets (see Table 4). We used four different datasets from the NCBI…

Bowtie 2 alignment 0 Hello All, My objective is to align paired reads against my reference genome (nematode) and I have used bowtie2 and bwa to accomplish this. The process is complete, but the alignment stats from bowtie2 doesn’t make any sense. Initially I used the –very-sensitive parameter, hence I…

DOI: 10.18129/B9.bioc.IFAA   This is the development version of IFAA; for the stable release version, see IFAA. Robust Inference for Absolute Abundance in Microbiome Analysis Bioconductor version: Development (3.19) This package offers a robust approach to make inference on the association of covariates with the absolute abundance (AA) of microbiome…

Microbiomes contain diverse microbial communities whose interactions not only impact the system residents, but also have profound effects on the ecology, chemistry, and health of their shared host or environment. Capturing the interactions among microbes is essential as we expand our understanding of host-microbe dynamics, evaluate environmental degradation or remediation,…

I’m trying to do a SQL request on the BigQuery Google service to search for family names present in my sample DRR000836, and more precisly, on the cyanobacteria phylum part but I’m not sure how to do it… Here are the 2 SQL requests that I would like to merge…

Introduction Respiratory tract infections are common and occur frequently. Rapid and accurate microbial detection is essential for timely and appropriate treatment. Traditional microbial detection methods have some limitations such as dependence on morphology, long duration, low sensitivity, and high variability.1,2 Metagenomic next-generation sequencing (mNGS) is a new detection technology characterized…

Convert NCBI Downloaded files to ANNOVAR format 0 I have been trying to understand from the ANNOVAR documentation and other sites the steps needed to make these files from NCBI available to ANNOVAR. I admit to being new to bioinformatics, but have been a software developer for 30+ years. My…

Differential expression using Bowtie2 0 Hi, I have a gene and I want to investigate its expression in different organs. I’m not sure how best to do this though. I am thinking of using Bowtie2 to either: Align the transcript of the gene to the transcriptome for a cell in…

Obesity has been a heated topic in recent years, as the statistics suggest that it is the world’s leading cause of death, brought on by the likes of diabetes, heart disease, stroke, and possible cancers. Naturally, so much money is being invested in this research area to tame the risk…

     Custom Tracks ac4C-RIP-seq peaks, hESC CTL-1hidedensesquishpackfull ac4C-RIP-seq peaks, hESC CTL-2hidedensesquishpackfull ac4C-RIP-seq peaks, hESC NAT10-KD-1hidedensesquishpackfull ac4C-RIP-seq peaks, hESC NAT10-KD-2hidedensesquishpackfull    Mapping and Sequencing Base Positionhidedensefull p14 Fix Patcheshidedensesquishpackfull p14 Alt Haplotypeshidedensesquishpackfull Assemblyhidedensesquishpackfull Centromereshidedensesquishpackfull Chromosome Bandhidedensesquishpackfull Clone Endshidedensesquishpackfull Exome Probesetshidedensesquishpackfull FISH Cloneshidedensesquishpackfull Gaphidedensesquishpackfull GC Percenthidedensefull GRC Contigshidedensefull GRC Incidenthidedensesquishpackfull Hg19…

Given files genes.bed and snps.bed, you could do something like: $ bedmap –echo –echo-map-id –delim ‘\t’ genes.bed snps.bed > answer.bed The file answer.bed will contain the gene annotation and a semi-colon delimited list of SNP identifiers that overlap each gene. In order to get genes.bed, you could use Gencode v44…

##Genome-Annotation-Data-START## Annotation Provider::NCBI Annotation Date::08/05/2022 10:42:45 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::6.2 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::3,366 CDSs (total)::3,329 Genes (coding)::3,296 CDSs (with protein)::3,296 Genes (RNA)::37 tRNAs::34 ncRNAs::3 Pseudo Genes (total)::33 CDSs (without protein)::33 Pseudo Genes…

Friedman-Einat, M. & Seroussi, E. Avian leptin: bird’s-eye view of the evolution of vertebrate energy-balance control. Trends Endocrinol. Metab. 30, 819–832 (2019). Article  CAS  PubMed  Google Scholar  International Chicken Genome Sequencing C. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432, 695–716 (2004)….

Study areas The samples were collected from wild boars hunted in rural properties from the municipalities of São Simão, Monte Azul, Paraíso, Colina, Matão, Bebedouro e Monte Alto (São Paulo), Ipiranga (Paraná), and Santo Antônio das Missões (Rio Grande do Sul) (Fig. 1). Fig. 1 Sampling collection sites of wild boars…

Fig 1. rrnI-dependent expression of HspA in V. vulnificus MO6-24/O strains. (A) Schematic representation of the allele-specific RT-PCR analysis analyzing the relative amounts of I-rRNA or G-rRNA. (B) The number of I-rRNA or G-rRNA amplicons and other rRNAs amplified from the cDNA of the MO6 WT, MO6+rrnG, and MO6+rrnI strains…

Introduction With nearly 2 million new cases and 1 million deaths worldwide in 2020, colorectal cancer is the third-most common cancer and the second leading cause of cancer-related deaths.1 According to data from the US Surveillance, Epidemiology and End Results program and the National Program of Cancer Registries program, the…

Kaiyuan Zhang,1,* Ziyue Luo,1,* Xinchao Zhu,1 Xinyi Yao,1 Dingqi Lu,2 Liying Chen,1 Tao Hong,1 Yating Ren,1 Xinchang Wang3 1Second Clinical Medical College, Zhejiang Chinese Medical University, Hangzhou, Zhejiang Province, 310053, People’s Republic of China; 2First Clinical Medical College, Zhejiang Chinese Medical University, Hangzhou, Zhejiang Province, 310053, People’s Republic of China;…

Body: Hello, Biostars Community, I am working on creating a custom database of variants using the VCF from the latest dbSNP alpha release available at ftp.ncbi.nih.gov/snp/population_frequency/latest_release/. I have encountered a couple of issues that I’m hoping someone might help me resolve. Firstly, the chromosome encoding uses RefSeq IDs (e.g., NC_000007.12)…

datasets download genome accession –inputfile accessions.txt –include gff3,gbff,rna,cds,protein,genome,seq-report Or you simply specify mutliple accessions on the commandline: datasets download genome accession GCF_000001405.40 GCA_003774525.2 GCA_000001635 Edit: Sorry, I overlooked the –inputfile option. This is necessary unless all accessions are from a common taxon or bioproject. In the first case you can…

Enzyme commission number in ncbi Gene database 0 In the browser of www.ncbi.nlm.nih.gov/gene when looking at a gene or gene product, in the section “General protein information”, we can find the EC number. However i am not sure how to find it in the FTP available. Which source file would…

Posted by flickaj on Monday, December 4, 2023 in featured. By: Sarah Ward Evolutionary Studies graduate communications assistant Picture a thriving marine environment. Perhaps you envision a community as colorful and lively as “Finding Nemo,” where massive schools of fish are flanked by sharks and sea turtles. What about sponges?…

Project Associate 1 I have been working on NCBI-submitted data, I downloaded the GAF file but am unable to view the file. Can anyone suggest to me which tool should I use to view the GAF file and how to execute it? Bioinformatics GO annotation • 53 views Login before…

4 Fastq files for a single run generated by 10X 0 Hello, I have a question about the 10X generated Fastq files. As I know 10X platforms can generate up to 4 Fastq files as R1, R2, I1 and I2. I need to use Fastq files and align them with…

Hi, I’m using blastn in BLAST 2.11.0 and it keeps failing for specific sequences for a reason that I’m yet to understand. Any lead on what he problem might be? The error message is Error: NCBI C++ Exception: T0 “/tmp/BLAST/2.11.0/gompi-2020b/ncbi-blast-2.11.0+-src/c++/src/serial/objistrasnb.cpp”, line 499: Error: (CSerialException::eOverflow) byte 132: overflow error ( at…

Error in blast+ 0 Hello, I have a problem with creating a local database (blast+) I downloaded NCBI BLAST and then put a fasta file in the bin folder. Later I opened this folder in PowerShell and wrote a command “makeblastdb -in ownBLASTdb.fasta -out DataBase -dbtype prot -parse_seqids”. I got…

Centers for Disease Control and Prevention (U.S.). Antibiotic Resistance Threats in the United States, 2019. doi.org/10.15620/cdc:82532 (2019). Centers for Disease Control and Prevention. COVID-19: U.S. Impact on Antimicrobial Resistance, Special Report 2022. doi.org/10.15620/CDC:117915 (2022). Fricks-Lima, J. et al. Differences in biofilm formation and antimicrobial resistance of Pseudomonas aeruginosa isolated from…

A novel collection of genomes from Cabinda, Angola and Maputo, Mozambique Genomic DNA was extracted using saliva samples collected with informed consent and sequenced using the Illumina HiSeq X™ platform to an average autosomal read depth of ~12X from 300 individuals sampled in Cabinda and 50 individuals sampled in Maputo…

Jiao, Y. N. et al. Ancestral polyploidy in seed plants and angiosperms. Nature 473, 97–100 (2011). Article  PubMed  Google Scholar  Levin, D. A. Polyploidy and novelty in flowering plants. Am. Nat. 122, 1–25 (1983). Article  Google Scholar  Soltis, P. S. & Soltis, D. E. Ancient WGD events as drivers of…

Product Details Description: Anti-XRCC1 (CHICKEN) Antibody – 200-901-MG5 Synonyms: Chicken Anti-X-Ray Repair Cross Complementing 1 Antibody, X-Ray Repair Complementing Defective Repair In Chinese Hamster Cells 1, X-Ray Repair Cross-Complementing Protein 1, DNA Repair Protein XRCC1, SCAR26, RCC Host Species: Chicken Clonality: Polyclonal Format: IgY Target Details Gene Name: XRCC1  – View…

Browse – GSA – CNCB-NGDC      Home GSA SRA1757663 SRA1757663 Information Title: SUB14000603 Release date: 2023-11-26 Data Source: NCBI Center Name:The John Paul II Catholic University of Lublin Lab Name:Faculty of Medicine Read more…

Long-read sequencing is driving rapid progress in genome assembly across all major groups of life, including species of the family Drosophilidae, a longtime model system for genetics, genomics, and evolution. Whole-genome sequence alignments link evolution at the nucleotide level across species and are a critical but computationally intensive step for…

Broaden your search Refine your search Sign up for job alerts Get new jobs for this search by email Found 1 Faculty job Invites applications for a tenure track/ tenured faculty position at the level…

Plant material Five alfalfa plants (stems and leaves) were sampled from each of the four different fields, 10–15 acres in size, located in Yuma Country, Arizona, USA. Geographic coordinates of the alfalfa fields and the adjacent crops are shown in Table 1. Table 1 Geographic locations of alfalfa fields Total…

Phylogenomic analysis of Orthopoxvirus genomes A phylogenomic analysis of 200 Orthopoxvirus genomes, identified 10 distinct clades within this genus, which are here named as phylogroups 1 to 10 and are denoted as OPV-PG-01 to OPV-PG-10 (Fig. 1) based on their nesting patterns (Supplementary Fig. S1), where the 100 MPV isolates included…

Summary of Pseudomonas borbori DSM 17834, version 27.1 Tier 3 Uncurated Database Database Authors: Pallavi Subhraveti1, Quang Ong1, Ingrid Keseler1, Anamika Kothari1, Ron Caspi1, Peter D Karp1 1SRI International Summary: This Pathway/Genome Database (PGDB) was generated on 27-Feb-2018 from the annotated genome of Pseudomonas borbori DSM 17834, as obtained from…