Tag: Nextseq

Detection of DNA methylation signatures through the lens of genomic imprinting

Animals and samples The study included 10 pigs, 8 pigs were bred at the INRAE experimental farm (doi.org/doi.org/10.15454/1.5572415481185847E12) and 2 pigs come from breeding organizations in accordance with the French and European legislation on animal welfare. The animals belong to the same family, except for one LW animal. Animals were…

Continue Reading Detection of DNA methylation signatures through the lens of genomic imprinting

fastq.gz.fastsanger.gz to fastq.gz in Galaxy and FastQC – usegalaxy.org support

Hi,Is it possible to convert fastq.gz.fastsanger.gz to fastq.gz in Galaxy?The data is in fastq.gz.fastsanger.gz format and was generated by the NextSeq 2000. I downloaded the data from Galaxy and want to convert fastq.gz.fastsanger.gz to fastq.gz using Galaxy. I uploaded the dataset, clicked the pencil icon, and went into the Edit…

Continue Reading fastq.gz.fastsanger.gz to fastq.gz in Galaxy and FastQC – usegalaxy.org support

Genomic hypomethylation in cell-free DNA predicts responses to checkpoint blockade in lung and breast cancer

Lung cancer ICB cohort Advanced non-small cell lung carcinoma patients who were treated with anti-PD-1/PD-L1 monotherapy at Samsung Medical Center, Seoul, Republic of Korea were enrolled for this study. The present study has been reviewed and approved by the Institutional Review Board (IRB) of the Samsung Medical Center (IRB no….

Continue Reading Genomic hypomethylation in cell-free DNA predicts responses to checkpoint blockade in lung and breast cancer

bcl2fastq troubleshooting all reads dumped to “Undetermined”

Hi everyone, Another lab ran a single-end sequencing run on a NextSeq for us, but now they can’t properly demultiplex them. I’m trying to see if I can figure it out. I run bcl2fastq (newest version) on the files, but all reads are dumped to Undetermined_S0_L001_R1_001.fastq.gz I’ve got a SampleSheet.csv…

Continue Reading bcl2fastq troubleshooting all reads dumped to “Undetermined”

Illumina partners with HaploX to build a domestically produced flagship benchtop sequencing system

SHENZHEN, China, Dec. 12, 2023 /PRNewswire/ — On December 9, Illumina, a global leader in DNA sequencing and array-based technologies, and HaploX, a China-based high-tech company specializing in oncology liquid biopsy and genetic big data, jointly announced the official launch of the first NextSeq™ 2000Dx-CN-HAP, a domestically-produced genetic sequencing system, in…

Continue Reading Illumina partners with HaploX to build a domestically produced flagship benchtop sequencing system

Genome sequence and characterization of a novel Pseudomonas putida phage, MiCath

Bacterial strains We used P. putida strains S12, DOT-T1E, F1 (kindly gifted by Grant Rybnicky), ATCC 12633 (purchased from ATCC), JUb85 (kindly provided by Samuel Buck), EM383 (kindly gifted by Huseyin Tas), p106 (kindly provided by Carey-Ann Burnham), and KT2440 (obtained from lab stocks). An overnight culture of each P….

Continue Reading Genome sequence and characterization of a novel Pseudomonas putida phage, MiCath

Metagenomic next-gene sequencing for respiratory infections

Introduction Respiratory tract infections are common and occur frequently. Rapid and accurate microbial detection is essential for timely and appropriate treatment. Traditional microbial detection methods have some limitations such as dependence on morphology, long duration, low sensitivity, and high variability.1,2 Metagenomic next-generation sequencing (mNGS) is a new detection technology characterized…

Continue Reading Metagenomic next-gene sequencing for respiratory infections

Ribo-Zero Plus Microbiome rRNA Depletion Kit

Description Depletion of abundant transcripts from host and bacterial rRNA for metatranscriptomics research. Single-tube depletion of abundant transcripts from multiple species or transcripts Input Quantity Minimum 25 ng of total RNA, 50 ng recommended for optimal performance 1-1000 ng total RNA for standard-quality RNA samples….

Continue Reading Ribo-Zero Plus Microbiome rRNA Depletion Kit

Yes .. BBMap can do that!

NOTE: This collection was originally posted at SeqAnswers.com. Creating a copy here to preserve the information.Part I is available here: Yes .. BBMap can do that! – Part I : bbmap (aligner), bbduk (scan/trim), repair (fix PE reads) and reformat (format conversions)Part II is available here: Yes .. BBMap can…

Continue Reading Yes .. BBMap can do that!

How to check for incorporation of plasmid DNA into human genomic DNA (ChIP-seq)?

How to check for incorporation of plasmid DNA into human genomic DNA (ChIP-seq)? 0 I have data from a human ChIP-Seq-like experiment where some samples were treated with a drug in combination with a synthetic plasmid. Now, I’d like to check if the plasmid was incorporated (partial or total) somehow…

Continue Reading How to check for incorporation of plasmid DNA into human genomic DNA (ChIP-seq)?

Greenphire, Florence Healthcare Team Up; Illumina Partnerships; Oxford Nanopore Develops New Data Technology

November 29, 2023 | Greenphire and Florence Healthcare announce a technology partnership; Illumina and Veracyte join together in a multi-year agreement; Oxford Nanopore Technologies collaborates with Fabric Genomics and Saphetor to develop data technology for research; more.  Greenphire and Florence Healthcare announced a technology partnership that integrates two of the…

Continue Reading Greenphire, Florence Healthcare Team Up; Illumina Partnerships; Oxford Nanopore Develops New Data Technology

Application of CNV-seq technology | IJWH

Introduction Ultrasound soft markers refer to small nonspecific variations in foetal structure found in prenatal ultrasound that are often associated with abnormal chromosome number or pathogenic copy number variations (CNVs).1,2 Common ultrasound soft markers include nuchal translucency (NT) thickness, nuchal fold (NF) thickness, nasal bone dysplasia, choroid plexus cyst, intracardiac…

Continue Reading Application of CNV-seq technology | IJWH

Quality filtering prior to pseudoalignment

Quality filtering prior to pseudoalignment 0 Hi, I have often read (and anecdotally confirmed) that adapter removal, quality trimming and such are not necessary for simple estimation of transcript relative abundance in a pseudoalignment framework. My tool of choice is Kallisto, and I am doing bulk RNAseq on a NextSeq,…

Continue Reading Quality filtering prior to pseudoalignment

Diagnosis of Two meningitis Cases caused by Rickettsia felis

Introduction Rickettsia felis belongs to the transitional group in the genus Rickettsia and is mainly transmitted by the cat flea (Ctenocephalides felis) but has been detected in a variety of arthropods including mosquitoes, ticks, and mites.1 Flea-borne spotted fever is caused by R. felis, with symptoms including fever, headache, and…

Continue Reading Diagnosis of Two meningitis Cases caused by Rickettsia felis

Veracyte and Illumina collaborate to advance in vitro diagnostic tests

Decentralised IVD tests enhance diagnostic accessibility, particularly in regions lacking centralised facilities, fostering early detection and treatment for improved patient outcomes. Credit: Okrasiuk via Shutterstock. Veracyte, a leading genomic diagnostics company, has joined forces with Illumina, a pioneer in DNA sequencing and array-based technologies, in a multi-year partnership aimed at…

Continue Reading Veracyte and Illumina collaborate to advance in vitro diagnostic tests

Head of Bioinformatics Job in Greater London, Career, Permanent Jobs in Bactobio

We are looking for an exceptional microbial bioinformatician to join our leadership team at Bactobio as Head of Bioinformatics. Company Bactobio is a London-based biotechnology company founded in 2020. We use breakthrough technologies in synthetic biology, next-generation sequencing, and machine learning to cultivate the 99% previously unculturable microbes. These…

Continue Reading Head of Bioinformatics Job in Greater London, Career, Permanent Jobs in Bactobio

IJMS | Free Full-Text | CRISPR/Cas9 Directed Reprogramming of iPSC for Accelerated Motor Neuron Differentiation Leads to Dysregulation of Neuronal Fate Patterning and Function

1. Introduction As the world population ages, neurodegenerative diseases are increasing. The outcome of these diagnoses varies but can lead to fatality 50% of the time within 15–20 months [1]. Treatments for neurodegeneration, in particular motor neuron (MN) diseases, are restricted due to the limitations of motor neuron repair and…

Continue Reading IJMS | Free Full-Text | CRISPR/Cas9 Directed Reprogramming of iPSC for Accelerated Motor Neuron Differentiation Leads to Dysregulation of Neuronal Fate Patterning and Function

NGS Updates from ASHG: What’s New in Sequencing?

As expected, the NGS companies were sharing their news, out in full force, at the annual American Society for Human Genetics (ASHG) meeting last week in Washington, DC. Whether the updates came from the expo booths showcasing instruments, or users sharing data in the lecture halls, each company had progress…

Continue Reading NGS Updates from ASHG: What’s New in Sequencing?

Single-nucleus DNA sequencing reveals hidden somatic loss-of-heterozygosity in Cerebral Cavernous Malformations

Ethical statement Our research complies with all relevant ethical regulations, including the Declaration of Helsinki and has been approved by the Institutional Review Boards of University of Chicago, Duke University and the Alliance to Cure Cavernous Malformations. Cerebral cavernous malformation lesions All human CCM tissue specimens have been previously reported18,19…

Continue Reading Single-nucleus DNA sequencing reveals hidden somatic loss-of-heterozygosity in Cerebral Cavernous Malformations

Illumina sequencing | Cornell Institute of Biotechnology

Description Internal price (Cornell and Cornell affiliates) External price MiSeq V2 kit, 50 bp (12-15 M/fc, 0.6-0.75 Gbp/run) $992 $1,627 MiSeq V2 kit, 300 bp (12-15 M/fc, 3.6-4.5 Gbp/run) $1,263 $2,071 MiSeq V2 kit, 500 bp (12-15 M/fc, 7.2-9 Gbp/run) $1,422 $2,333 MiSeq V3 kit, 150 bp (22-25 M/fc, 3.3-3.75…

Continue Reading Illumina sequencing | Cornell Institute of Biotechnology

Bid on On-site System Health Checks for Illumina Miseq and Nextseq Sequencing Instruments (IFB) in Texas Department of State Health Services Laboratory 1100 W. 49 th St., Austin

On-site System Health Checks for Illumina Miseq and Nextseq Sequencing Instruments (IFB) Login for complete opportunity report. Added/Updated: 10/25/23 Solicitation Title: On-site System Health Checks for Illumina Miseq and Nextseq Sequencing Instruments (IFB) Scope: To establish contract(s) for on-site system health checks for illumina miseq and nextseq sequencing instruments.  …

Continue Reading Bid on On-site System Health Checks for Illumina Miseq and Nextseq Sequencing Instruments (IFB) in Texas Department of State Health Services Laboratory 1100 W. 49 th St., Austin

Distribution tendencies of pathogens causing LRTI

Introduction Lower respiratory tract infection (LRTI) remains one of the leading causes of death worldwide.1 Several well-known pathogens, including Streptococcus pneumoniae, Pseudomonas aeruginosa, Klebsiella pneumoniae, Candida, Herpesvirus, and others, have been identified as significant causes of infection.2 Nonetheless, nearly half of the cases still have an undetermined etiology,3,4 despite the…

Continue Reading Distribution tendencies of pathogens causing LRTI

Assistant Professor in Forensic Sciences job with NORTHUMBRIA UNIVERSITY

ABOUT THE ROLE Working within the Department of Applied Sciences, this role involves both teaching and research. The successful candidate will be part of a multidisciplinary team that teaches undergraduate and postgraduate forensic science students, on programmes accredited by the Chartered Society of Forensic Sciences. This post will involve designing,…

Continue Reading Assistant Professor in Forensic Sciences job with NORTHUMBRIA UNIVERSITY

Broken String Biosciences strengthens senior leadership team to accelerate product development and commercialization

Broken String Biosciences (“Broken String”), a genomics company building a technology platform to drive the development of cell and gene therapies that are safer by design, today announced the expansion of its senior leadership team with the appointments of Vincent Smith, Ph.D., as Chief Technology Officer and Jessica Rich as…

Continue Reading Broken String Biosciences strengthens senior leadership team to accelerate product development and commercialization

The Clinical Impact of mNGS for the Diagnosis of PJI

Introduction The total number of periprosthetic joint infection cases is increasing with the surging numbers of joint arthroplasties, internal fixation implantation and the use of immunosuppressive agents.1,2 Unfortunately, the identification of corresponding pathogens remains time-consuming and challenging because of inert bacteria, biofilm formation and prior antibiotic administration.3–8 Metagenomic next-generation sequencing…

Continue Reading The Clinical Impact of mNGS for the Diagnosis of PJI

PTEN-induced kinase 1 gene single-nucleotide variants as biomarkers in adjuvant chemotherapy for colorectal cancer: a retrospective study | BMC Gastroenterology

Tissue samples A total of 84 analytic samples from surgical or biopsy specimens were collected from 84 patients who underwent radical surgery for CRC at Saitama Medical University International Medical Center between January and December 2016. One case was excluded because the specimen was too small; therefore, we used a…

Continue Reading PTEN-induced kinase 1 gene single-nucleotide variants as biomarkers in adjuvant chemotherapy for colorectal cancer: a retrospective study | BMC Gastroenterology

Secondary infection surveillance | IDR

Introduction The coronavirus disease 2019 (COVID-19) caused by the emerging severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variants continues to threaten human life worldwide. The disease severity of COVID-19 patients is very wide: from an asymptomatic carrier state to severe infection and critical illness with intensive care admission and/or mechanical…

Continue Reading Secondary infection surveillance | IDR

Assembloid CRISPR screens reveal impact of disease genes in human neurodevelopment

Culture of hiPS cells The hiPS cell lines used in this study were validated as previously described51. The SEC61B-mEGFP hiPS cell line (AICS-0059 cl.36) was developed at the Allen Institute for Cell Science (www.allencell.org/cell-catalog.html) and is distributed through Coriell43. The CAG::Cas9 cell line was genetically engineered in the laboratory (the…

Continue Reading Assembloid CRISPR screens reveal impact of disease genes in human neurodevelopment

Cancer Biopsy Market’s Soaring Trajectory: US$ 131.4 Billion Forecasted by 2033, CAGR of 18%

In a recently published analysis report, Future Market Insights reveals that the global Cancer Biopsy Market achieved remarkable sales of US$ 22.2 Billion in 2022. Anticipating an impressive 18% Compound Annual Growth Rate (CAGR), the market’s projected growth from 2023 to 2033 is set to surpass historical trends. Notably, the…

Continue Reading Cancer Biopsy Market’s Soaring Trajectory: US$ 131.4 Billion Forecasted by 2033, CAGR of 18%

Diagnostic value and clinical application of mNGS

Introduction Infection is one of the greatest challenges for critically ill patients and intensivists. Previous investigations reported that 30% to 60% of antimicrobials used in ICUs are unnecessary, inappropriate, or suboptimal,1,2 which might be partly attributed to the many defects of conventional microbiological tests (CMT). Culture is the most commonly…

Continue Reading Diagnostic value and clinical application of mNGS

Lecturer in Forensic Sciences job with NORTHUMBRIA UNIVERSITY

ABOUT THE ROLE Working as part of multi-disciplinary teams, you will be responsible for contributing to an exceptional student experience through the delivery of teaching, research, knowledge exchange and business and enterprise engagement activity. Colleagues appointed into our Lecturer grade are usually early career academics who are supported through their…

Continue Reading Lecturer in Forensic Sciences job with NORTHUMBRIA UNIVERSITY

Read Counts from BAM file

Read Counts from BAM file 0 for a set of samples, paired end nextseq illumina p2 was performed. in all, i am getting read count much higher than my actual flow cell capacity. How is it even possible? my flow cell can generate total reads upto one billion (paired-end), and…

Continue Reading Read Counts from BAM file

Why Pathogen Surveillance Is Critical During a “Tripledemic”

Published 7 hours ago Submitted by Illumina Virologist Dr. Efrem Lim and researchers at ASU’s Lim Lab | Photo: Andy DeLisle/Arizona State University Originally published on Illumina News Center The 2022–23 “tripledemic” season—in which influenza, SARS-CoV-2, and respiratory syncytial virus (RSV) all surged at the same time—was especially bad for…

Continue Reading Why Pathogen Surveillance Is Critical During a “Tripledemic”

Pitt UPMC Center for Advanced Research Genomics

Health Sciences Sequencing Core All PITT/UPMC prices below are effective March 1, 2023. Sample Preparation Unit Price RNA/DNA extraction tissue Sample $32 RNA/DNA extraction biofluid (PaxGene, blood) or FFPE Sample $47 Quality checks Unit Price Agilent TapeStation DNA or RNA Sample $9 Qubit Fluorometric Quantification Sample $5 RNA Library preparation…

Continue Reading Pitt UPMC Center for Advanced Research Genomics

Whole genomes from bacteria collected at diagnostic units around the world 2020

Preparation of partners to collect samples Partners registered for participation by contributing isolates or DNA samples to the study. Material was sent to partners according to their registered participation format. This included material for sample collection, metadata registration, DNA extraction and sample shipment to Denmark. Specific protocols were provided, according…

Continue Reading Whole genomes from bacteria collected at diagnostic units around the world 2020

sequencing machines output files layout

sequencing machines output files layout 2 Hi! Does anyone know if someone has created a resource or gathered information about which type of layout each sequencing machine produces? Some table or something where one can look up a sequencer model, say “NextSeq 500” and there’s information about the resulting layout…

Continue Reading sequencing machines output files layout

Metagenomic next-generation sequencing in CNS cryptococcosis

Introduction Central nervous system (CNS) cryptococcosis is an invasive fungal infection caused by Cryptococcus spp. Although the infection is preventable and treatable, its morbidity and mortality rates are still high.1 Global cryptococcal meningitis accounts for 15% of acquired immune deficiency syndrome-related deaths, with an estimated 181,100 deaths annually.2 In the…

Continue Reading Metagenomic next-generation sequencing in CNS cryptococcosis

Genome analysis of ST1 Bartonella henselae

Introduction Infective endocarditis (IE), as a disease first recognized in 1885, is defined by infection of a native or prosthetic heart valve, the endocardial surface, or an indwelling cardiac device.1–3 Despite advances in diagnostic capabilities and treatment options, IE remains a rare condition but with high associated mortality. And epidemiological…

Continue Reading Genome analysis of ST1 Bartonella henselae

over-presented sequence in negative control

miRNAseq – over-presented sequence in negative control 0 Hello, everyone I have this sequence in the negative control of miRNA seq. TGGTAATACGACGTACTTAGTGT It did not map to any references (miRNA, tRNA, rRNA, piRNA, mRNA, hg19, bacteria). I use QIAseq miRNA Library and NextSeq 550. Any idea what it might be???…

Continue Reading over-presented sequence in negative control

Clinical efficiency of mNGS in sputum for pathogen detection

Introduction Lower respiratory infections (LRIs) are the world’s most deadly communicable disease and ranks fourth as the primary cause of death globally according to the World Health Organization (WHO) 2019 report.1,2 LRIs include hospital-acquired pneumonia (HAP), community-acquired pneumonia (CAP), bronchiolitis, bronchitis, and tracheitis.3,4 Immunocompromised patients have a higher risk of…

Continue Reading Clinical efficiency of mNGS in sputum for pathogen detection

Symmetric inheritance of parental histones governs epigenome maintenance and embryonic stem cell identity

The research in this study was conducted under the ethical approval of the Danish Regulatory Authority under project license 2018-15-0201-01520. Cell culture and differentiation assays WT, MCM2-2A, MCM2-R and POLE4-KO mouse ESCs used in this study were derived from the male, E14JU cell line with a 129/Ola background81. Genome editing…

Continue Reading Symmetric inheritance of parental histones governs epigenome maintenance and embryonic stem cell identity

KRTA6A and FA2H Are Hub Genes Associated With Cgas-STING-related Immunogenic Cell Death in Lung Adenocarcinoma

Abstract Background/Aim: The immunogenic cell death (ICD) pathway plays a crucial prognostic role in lung adenocarcinoma (LUAD) therapy. The cyclic GMP–AMP synthase (cGAS)-stimulator of interferon genes (STING) pathway is an upstream mechanism that drives ICD activation, but the interaction of hub genes remains unclear. The present study aimed to investigate…

Continue Reading KRTA6A and FA2H Are Hub Genes Associated With Cgas-STING-related Immunogenic Cell Death in Lung Adenocarcinoma

Accelerated evolution of SARS-CoV-2 in free-ranging white-tailed deer

Sample collection Previously, we collected nasal samples from WTD in northeastern Ohio focusing on metropolitan area parks11. In the present study, we expanded geographical study area by approximately 1000-fold to target the entire state of Ohio. We collected 1522 nasal swabs from WTD across 83 of Ohio’s 88 counties from…

Continue Reading Accelerated evolution of SARS-CoV-2 in free-ranging white-tailed deer

Next Generation Sequencing (NGS) is a high-throughput DNA sequencing technology surpass US$ 49,279.9 Mn With CAGR of 18.3% – Coherent Market Insights

A high-throughput DNA sequencing technique called Next Generation Sequencing (NGS) separates billions or millions of DNA strands and sequences them simultaneously, producing more data and obviating the need for fragment-cloning techniques (Sanger sequencing of genomes). However, because the signal to noise ratio rises with read length, NGS read durations are…

Continue Reading Next Generation Sequencing (NGS) is a high-throughput DNA sequencing technology surpass US$ 49,279.9 Mn With CAGR of 18.3% – Coherent Market Insights

bcl2fastq conversion with specifying exact match of indices

bcl2fastq conversion with specifying exact match of indices 0 Hello everyone, I recently ran a NextSeq 2000 using 6-nucleotide Illumina TruSeq unique indices. My goal is to demultiplex using bcl2fastq and extract only the reads that match my indices. However, there’s a complication: the run included samples from another person…

Continue Reading bcl2fastq conversion with specifying exact match of indices

Illumina, Inc. (NASDAQ:ILMN) Q2 2023 Earnings Call Transcript

Illumina, Inc. (NASDAQ:ILMN) Q2 2023 Earnings Call Transcript August 10, 2023 Operator: Good day, ladies and gentlemen, and welcome to the Second Quarter 2023 Illumina Earnings Conference Call. At this time, all participants are in a listen-only mode. After the speakers’ presentation, there will be a question-and-answer session. Please be…

Continue Reading Illumina, Inc. (NASDAQ:ILMN) Q2 2023 Earnings Call Transcript

Bridging the Diagnostic Frontier: Cancer Biopsy Market’s 18% CAGR Journey to US$131.4 Billion From 2023 To 2033

The Cancer Biopsy Market revenues were estimated at US$ 22.2 Bn in 2022 and are anticipated to grow at a CAGR of 18% from 2023-2033, according to a recently published Future Market Insights report. By the end of 2033, the market is expected to reach US$ 131.4 Bn. The increasing elderly populace, along with the rise…

Continue Reading Bridging the Diagnostic Frontier: Cancer Biopsy Market’s 18% CAGR Journey to US$131.4 Billion From 2023 To 2033

Sequencing 101: SBB sequencing – PacBio

Since the inception of next generation sequencing (NGS) more than a decade ago, short-read sequencing accuracy has seen only marginal improvement. Having achieved a level of precision thought to be “good enough” for most applications, much of NGS development has been focused on optimizing for cost and throughput. As a…

Continue Reading Sequencing 101: SBB sequencing – PacBio

16S rRNA gene primer choice impacts off-target amplification in human gastrointestinal tract biopsies and microbiome profiling

The problem of off-target amplification The widely used standardized protocol for 16S rRNA gene amplicon sequencing7,14 turned out to be inadequate due to robust off-target amplification of human DNA during the analysis of bacteriome in samples of different biopsy sites from the upper gastrointestinal (GI) tract. In samples from all…

Continue Reading 16S rRNA gene primer choice impacts off-target amplification in human gastrointestinal tract biopsies and microbiome profiling

Transcriptomic analysis of neutrophil apoptosis induced by large B-cell lymphoma

introduce Difuse large B-cell lymphoma is the most common subtype of non-Hodgkin lymphoma, accounting for 30 percent of new cases in NHL each year. Although approximately 50-60% of human patients are cured by R-CHOP immunochemotherapy, more than 30% of patients are refractory to these regimens or relapse after remission, and…

Continue Reading Transcriptomic analysis of neutrophil apoptosis induced by large B-cell lymphoma

Next Generation Sequencing Market is projected to grow at a

Visiongain has published a new report entitled Next Generation Sequencing Market Report 2023-2033: Forecasts by Type (Consumables, Bioinformatics, Sequencing Services, Pre-sequencing Services, Instruments), by Workflow (Library Preparation, Sequencing, Data Analysis), by Application (Oncology, Reproductive Health, Genetic and Rare Diseases, Consumer Genomics, Agrigenomics & Forensics, Others), by End-use (Hospitals and Clinics,…

Continue Reading Next Generation Sequencing Market is projected to grow at a

Molecular features driving condensate formation and gene expression by the BRD4-NUT fusion oncoprotein are overlapping but distinct

Cell culture HCC2429 cells were a kind gift from the Hamon Center for Therapeutic Oncology Research at UT Southwestern Medical Center. The cells were grown in RPMI 1640 medium (Thermo Fisher Scientific, #11875119) with addition of 10% heat-inactivated Fetal Bovine Serum (Thermo Fisher Scientific, #10-438-026) and 1% penicillin—streptomycin (Thermo Fisher…

Continue Reading Molecular features driving condensate formation and gene expression by the BRD4-NUT fusion oncoprotein are overlapping but distinct

Plasticity of circulating tumor cells in small cell lung cancer

Liquid biopsy samples Patients with histological or cytological confirmation of chemotherapy-naive SCLC were recruited and consented at The Christie NHS Foundation Trust according to an ethically approved protocol (NHS Northwest 9 Research Ethical Committee). Informed written consent was obtained from all subjects. Experimental protocols were approved by the Institutional Review board of…

Continue Reading Plasticity of circulating tumor cells in small cell lung cancer

Wait for process ending to call the next one without output

Nextflow – Wait for process ending to call the next one without output 1 Hello, In my nextflow workflow, I have a process PREPARE_READS before a trimming process. In the first process, I simply rename the reads files and combine them if they came from NextSeq. The process have to…

Continue Reading Wait for process ending to call the next one without output

Integrated analysis of copy number variation-associated lncRNAs identifies candidates contributing to the etiologies of congenital kidney anomalies

Study design We aimed to investigate the potential contribution of lncRNAs to the pathogenicity of CAKUT associated CNVs. 19 recurrent CAKUT-associated CNVs were identified based on clinical researches of congenital anomalies of the kidney and urinary tracts (CAKUT) cases3,4,12,13 (Table 1). We retrieved lncRNAs located within these genomic regions as candidate…

Continue Reading Integrated analysis of copy number variation-associated lncRNAs identifies candidates contributing to the etiologies of congenital kidney anomalies

Uncovering a hidden diversity: optimized protocols for the extraction of dsDNA bacteriophages from soil | Microbiome | Full Text

Soil free Agricultural soil samples were collected out a long-term soil experimental range (ZOFE, Zurich Biological Fertilization Experiment), found into an pastoral area surrounding Zurich (Agroscope, Reckenholz, Switzerland). Soil consisted of 56% sand, 28% silt and 14% clay (in mass %: 0.6 soil organic charcoal, 1.1 soil humus, pH ~ 5.7)….

Continue Reading Uncovering a hidden diversity: optimized protocols for the extraction of dsDNA bacteriophages from soil | Microbiome | Full Text

Overexpression of human alpha-Synuclein leads to dysregulated microbiome/metabolites with ageing in a rat model of Parkinson disease | Molecular Neurodegeneration

Aim, design and setting of the study We aim to address our research question – how does microbial diversity affect PD pathology with ageing at the molecular level and can early intervention in the microbiome modulate the disease course? Herein, we have studied longitudinally the gut microbiome dynamics with ageing and report that with ageing,…

Continue Reading Overexpression of human alpha-Synuclein leads to dysregulated microbiome/metabolites with ageing in a rat model of Parkinson disease | Molecular Neurodegeneration

Diagnostic performance of mNGS in identification of NTMPD

Introduction Non-tuberculous mycobacteria (NTM) is a collective name given to a group of more than 190 species of Mycobacterium other than Mycobacterium tuberculosis and Mycobacterium leprae.1 NTM are labeled as environmental mycobacteria as they are widely distributed in the environment, such as in soil, marshland, streams, rivers, estuaries, dust, domestic…

Continue Reading Diagnostic performance of mNGS in identification of NTMPD

Dryad | Data — RNAseq data from: Medial prefrontal cortex samples of glutamate dehydrogenase-deficient mice, stress-exposed or -naive, and their Nestin-Cre+ controls

Glutamate abnormalities in the medial prefrontal cortex (mPFC) are associated with cognitive deficits. We previously showed that homozygous deletion of CNS glutamate dehydrogenase 1 (Glud1), a metabolic enzyme critical for glutamate metabolism, leads to schizophrenia-like behavioral abnormalities and increased mPFC glutamate; mice heterozygous for CNS Glud1 deletion (C-Glud1+/- mice) showed…

Continue Reading Dryad | Data — RNAseq data from: Medial prefrontal cortex samples of glutamate dehydrogenase-deficient mice, stress-exposed or -naive, and their Nestin-Cre+ controls

Adipogenic and SWAT cells separate from a common progenitor in human brown and white adipose depots

Human samples Human adipogenic progenitor cells were isolated from the stromal vascular fraction of adipose tissue samples on the day they were obtained (surgery or biopsy) from four regions: (1) visceral adipose tissue (obtained during gallbladder surgery); (2) perirenal adipose tissue (obtained during nephrectomy surgery); (3) abdominal subcutaneous adipose tissue…

Continue Reading Adipogenic and SWAT cells separate from a common progenitor in human brown and white adipose depots

A Guide to NGS Sequencers

Next-generation sequencing (NGS) is a comprehensive method that helps evaluate DNA or RNA sequences to analyze genetic variations useful for disease diagnosis and other biological phenomena. Image Credit: Elpisterra/Shutterstock.com   In the last two decades, NGS sequencers have significantly improved the speed, throughput, and accuracy of NGS and have revolutionized…

Continue Reading A Guide to NGS Sequencers

Generate_FASTQ Module on NextSeq: Manifest?

Generate_FASTQ Module on NextSeq: Manifest? 0 Hello! I need to obtain FASTQ files for a WES Project using a NextSeq 550. If I use the Generate FASTQs Module, I do not need to load a Manifest, korrect? Manifest NextSeq Generate_FASTQ • 32 views • link updated 1 hour ago by…

Continue Reading Generate_FASTQ Module on NextSeq: Manifest?

Bacterial DNA metabolism analysis by metagenomic next-generation sequencing (mNGS) after treatment of bloodstream infection | BMC Infectious Diseases

Animals Adult New Zealand rabbits (male, 2.0-2.5 kg) were purchased from Guangdong Medical Laboratory Animal Center. The rabbits were reared in experimental conditions (temperature, 20–25 °C; humidity, 50–70%) with a 12 h light/dark cycle and fed standard chow and water. All of the rabbits were injected with the inactivated E. coli. Bacteria The…

Continue Reading Bacterial DNA metabolism analysis by metagenomic next-generation sequencing (mNGS) after treatment of bloodstream infection | BMC Infectious Diseases

Comparison of pathogen detection consistency between metagenomic next-generation sequencing and blood culture in patients with suspected bloodstream infection

Study subjects We retrospectively studied patients with suspected bloodstream infection admitted to the emergency department of Ruijin Hospital from January 2020 to June 2022. The inclusion criteria were as follows: all patients were ≥ 16 years old and meanwhile, had a maximum body temperature higher than 38.5 °C, chills, and antibiotic use for more…

Continue Reading Comparison of pathogen detection consistency between metagenomic next-generation sequencing and blood culture in patients with suspected bloodstream infection

Rising Demand for Early Cancer Detection is Significantly Contributing to Growth

DUBLIN, June 9, 2023 /PRNewswire/ — The “DNA and Gene Chip Global Market Report 2023” report has been added to ResearchAndMarkets.com‘s offering. This report provides strategists, marketers and senior management with the critical information they need to assess the market. The global DNA and gene chip market is expected to…

Continue Reading Rising Demand for Early Cancer Detection is Significantly Contributing to Growth

Efflux pump gene amplifications bypass necessity of multiple target mutations for resistance against dual-targeting antibiotic

Strains and growth conditions All strains and plasmids used in this work are described in Supplementary Table 1. The clinical isolates were obtained from the Cystic Fibrosis Foundation Isolate Core at Seattle Children’s Hospital and were originally isolated from two different cystic fibrosis patients. Distribution of these isolates is covered by…

Continue Reading Efflux pump gene amplifications bypass necessity of multiple target mutations for resistance against dual-targeting antibiotic

acCRISPR: an activity-correction method for improving the accuracy of CRISPR screens

acCRISPR framework acCRISPR performs essential gene identification by calculating two scores for each sgRNA, namely the cutting score (CS) and the fitness score (FS). CS and FS are the log2-fold change of sgRNA abundance in the appropriate treatment sample with respect to that in the corresponding control sample (see Supplementary…

Continue Reading acCRISPR: an activity-correction method for improving the accuracy of CRISPR screens

A case report of cutaneous anthrax diagnosed with mNGS

Yushan Liu,1,2 Gezhi Zheng,1,3 Jing Li,1,3 Nan Yang,1– 4 Juan Li,1,2 Zhengwen Liu,1– 4 Qunying Han,1– 4 Yingren Zhao,1– 4 Fenjing Du,1,3 Yingli He,1,* Taotao Yan1,* 1Department of Infectious Diseases, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi, People’s Republic of China; 2Institution of Hepatology, The First Affiliated…

Continue Reading A case report of cutaneous anthrax diagnosed with mNGS

LHH hiring Bioinformatics Scientist in Waltham, Massachusetts, United States

A Bioinformatics Scientist position in Waltham, MA is now available through Adecco Medical and Science. We are seeking a Contract Bioinformatics Scientist to be part of a team focused on cell and genome engineering in the Genomic Medicine Unit. The successful candidate will support the activities around various projects that…

Continue Reading LHH hiring Bioinformatics Scientist in Waltham, Massachusetts, United States

PacBio Pipeline and Tools for Variant Call

PacBio Pipeline and Tools for Variant Call 0 Hi, I am new to long read seq, I am trying to call Variants on GIAB Trio samples from PacBio data Initially i Aligned reads with Pbmm2 tool, then variant call by DeepVariant 1.5, Phasing through Whatshap. My queries are as follows…

Continue Reading PacBio Pipeline and Tools for Variant Call

Frederick National Laboratory for Cancer Research hiring Bioinformatics Analyst II/III in Frederick, Maryland, United States

Job ID: req3395Employee Type: exempt full-timeDivision: Bioinformatics and Computational ScienceFacility: Frederick: ATRFLocation: 8560 Progress Dr, Frederick, MD 21701 USAThe Frederick National Laboratory is a Federally Funded Research and Development Center (FFRDC) sponsored by the National Cancer Institute (NCI) and operated by Leidos Biomedical Research, Inc. The lab addresses some of…

Continue Reading Frederick National Laboratory for Cancer Research hiring Bioinformatics Analyst II/III in Frederick, Maryland, United States

Integrated Resources, Inc ( IRI ) hiring Bioinformatics Scientist in Waltham, Massachusetts, United States

Description: Contract Worker, Bioinformatics, Cell and Genome Engineering, Genomic Medicine Unit We are seeking a contract bioinformatics scientist to be part of a team focused on cell and genome engineering in the Genomic Medicine Unit. The successful candidate will play an important role to support the activities around various projects…

Continue Reading Integrated Resources, Inc ( IRI ) hiring Bioinformatics Scientist in Waltham, Massachusetts, United States

Four MORE Chinese DNA Sequencing Startups

Yesterday I wrote about eight Chinese DNA sequencing companies. Today I found out about 4 more! So let’s very quickly review! Looks like Illumina-style SBS using an unspecified surface amplification approach. According to their website: Q30>85%, run outputs up to 300Gb. Two instruments, the Salus Pro and Salus Evo. Seems…

Continue Reading Four MORE Chinese DNA Sequencing Startups

an extremely low rate of correct barcodes was observed

cellranger count: an extremely low rate of correct barcodes was observed 1 I am new to cellranger. And I tried to run cellranger count for a fastq.gz file. My code is something like this: (** is just to replace my address name due to privacy issue) fastq-dump –outdir fastq –split-files…

Continue Reading an extremely low rate of correct barcodes was observed

Methanol fixation is the method of choice for droplet-based single-cell transcriptomics of neural cells

hiPSC cell culture and differentiation hiPSCs were maintained on 1:40 matrigel (Corning, #354277) coated dishes in supplemented mTeSR-1 medium (StemCell Technologies, #85850) with 500 U ml−1 penicillin and 500 mg ml−1 streptomycin (Gibco, #15140122). For the differentiation of cortical neurons the protocol described previously21 was followed with slight modifications. Briefly, hiPSC colonies were seeded…

Continue Reading Methanol fixation is the method of choice for droplet-based single-cell transcriptomics of neural cells

How to choose parameters for kallisto single end mode?

How to choose parameters for kallisto single end mode? 1 Hello, I have some fastq files produced by NextSeq. The average fragment length is between 350-400bp. The library prep adds 139bp of adapters, so the inserts are 200-250bp. Would the kallisto command look like this? kallisto quant -i index -o…

Continue Reading How to choose parameters for kallisto single end mode?

Hospital Surveillance Sequencing Helps Link Cases to Nationwide Contaminated Eyedrop Outbreak

NEW YORK – A whole-genome sequencing (WGS)-based hospital outbreak surveillance program has helped researchers at the University of Pittsburgh to identify two drug-resistant Pseudomonas aeruginosa infections associated with a national outbreak of contaminated eyedrops. While the cases were ruled out as in-hospital transmissions, the findings illustrate the potential value of…

Continue Reading Hospital Surveillance Sequencing Helps Link Cases to Nationwide Contaminated Eyedrop Outbreak

Shallow shotgun sequencing reduces technical variation in microbiome analysis

Participant selection and sample collection Informed consent was obtained for five adult volunteers. The study protocols were reviewed and approved by the Advarra Institutional Review Board (Advarra, Inc., Columbia, MD). All analyses were performed according to the relevant guidelines and regulations. Fecal collection was completed by self-sampling, which has proven…

Continue Reading Shallow shotgun sequencing reduces technical variation in microbiome analysis

Illumina TruSeq Stranded total Sample Preparation Protocol | CHMI services – TruSeq Stranded Total RNA

Preparation of total transcriptome libraries for sequencing on an Illumina dais Edit me Documentation TruSeq Running Absolute RNA Sample Prep Guide. This method makes a cDNA library of all RNA molecules presentational in your spot after rRNA depletion. Important: the succeed of this kit is dependent on of ability of…

Continue Reading Illumina TruSeq Stranded total Sample Preparation Protocol | CHMI services – TruSeq Stranded Total RNA

MANAGEMENT’S DISCUSSION & ANALYSIS | MarketScreener

Our Management’s Discussion and Analysis (MD&A) will help readers understand our results of operations, financial condition, and cash flow. It is provided in addition to the accompanying condensed consolidated financial statements and notes. This MD&A is organized as follows: •Management’s Overview and Outlook. High level discussion of our operating results…

Continue Reading MANAGEMENT’S DISCUSSION & ANALYSIS | MarketScreener

Illumina Sequencing Instruments Affected by Maximum Severity Vulnerability

Posted By HIPAA Journal on May 5, 2023 Healthcare providers and laboratory personnel have been warned about a maximum severity vulnerability in Illumina Universal Copy Service software used by its DNA sequencing instruments. The vulnerability affects Illumina products with Illumina Universal Copy Service (UCS) v2.x installed: iScan Controls Software (v4.0.0…

Continue Reading Illumina Sequencing Instruments Affected by Maximum Severity Vulnerability

Vulnerabilities Discovered in Illumina DNA Sequencing Devices

Healthcare providers and laboratory personnel have been put on alert after two separate cybersecurity vulnerabilities were discovered in medical devices commonly used in clinical diagnostics and research.

Continue Reading Vulnerabilities Discovered in Illumina DNA Sequencing Devices

Bioinformatics Analyst II job with Frederick National Laboratory

Bioinformatics Analyst II Job ID: req2894Employee Type: exempt full-timeDivision: Bioinformatics and Computational ScienceFacility: Frederick: ATRFLocation: 8560 Progress Dr, Frederick, MD 21701 USA The Frederick National Laboratory is a Federally Funded Research and Development Center (FFRDC) sponsored by the National Cancer Institute (NCI) and operated by Leidos Biomedical Research, Inc. The…

Continue Reading Bioinformatics Analyst II job with Frederick National Laboratory

Illumina Software Raises Critical Warning for Medical Device Vulnerability

The Universal Copy Service (UCS) service in Illumina devices has been found to have critical security gaps that could allow attackers to execute code and take control of the devices, warns the US Cybersecurity and Infrastructure Security Agency (CISA). These devices are widely used worldwide, particularly for DNA sequencing. Attackers…

Continue Reading Illumina Software Raises Critical Warning for Medical Device Vulnerability

Illumina NGS instrument software vulnerable to cybersecurity breach: FDA

The U.S. Food and Drug Administration (FDA) last week warned healthcare providers and laboratory personnel about a cybersecurity vulnerability affecting software in Illumina instruments that may be specified either for clinical diagnostic use in sequencing a person’s DNA for various genetic conditions or for research use only (RUO). The sequencing…

Continue Reading Illumina NGS instrument software vulnerable to cybersecurity breach: FDA

Critical Vulnerabilities In Illumina Universal Copy Service Devices

1 US CISA warns of critical vulnerabilities affecting the security of Illumina devices. The vulnerabilities exist in the Illumina Universal Copy Service software, allowing remote code execution attacks. Illumina Universal Copy Service Vulnerabilities According to a recent CISA alert, at least two vulnerabilities were discovered in Illumina DNA sequencing devices….

Continue Reading Critical Vulnerabilities In Illumina Universal Copy Service Devices

FDA Warns of Cybersecurity Vulnerabilities in Certain DNA Sequencing Devices

Federal health officials are warning medical facilities that certain diagnostic DNA sequencing devices contain software vulnerabilities, which could make them susceptible to cybersecurity hacks.

Continue Reading FDA Warns of Cybersecurity Vulnerabilities in Certain DNA Sequencing Devices

FDA Warns Cybersecurity Vulnerability For Illumina Sequencers

The FDA issued a letter noting that nearly the entire Illumina Inc’s (NASDAQ: ILMN) sequencer lineup carries a cybersecurity vulnerability that could impact genomic data results or even result in a data breach. The agency said that the Universal Copy Service software in the Illumina NovaSeq 6000, NextSeq 500, NextSeq 550, NextSeq 550Dx NextSeq…

Continue Reading FDA Warns Cybersecurity Vulnerability For Illumina Sequencers

CISA, FDA warn of new Illumina DNA device vulnerability

Several U.S. agencies warned this week about a vulnerability affecting software in devices used for DNA research that would allow hackers access to sensitive patient information. The Food and Drug Administration (FDA) and the company behind the devices — Illumina — said they have not received any reports indicating the…

Continue Reading CISA, FDA warn of new Illumina DNA device vulnerability

CISA Warns of Critical Flaws in Illumina’s DNA Sequencing Instruments

Apr 29, 2023Ravie LakshmananHealthcare / Cybersecurity The U.S. Cybersecurity and Infrastructure Security Agency (CISA) has released an Industrial Control Systems (ICS) medical advisory warning of a critical flaw impacting Illumina medical devices. The issues impact the Universal Copy Service (UCS) software in the Illumina MiSeqDx, NextSeq 550Dx, iScan, iSeq 100,…

Continue Reading CISA Warns of Critical Flaws in Illumina’s DNA Sequencing Instruments

Vulnerability in Illumina genome sequencing medical devices ranked 10.0

A critical vulnerability ranked 10.0 found in certain universal copy service software used in certain Illumina genome sequencing tools could enable a host of nefarious activities, including the remote upload and execution of code at the operating system level. The Cybersecurity and Infrastructure Security Agency (CISA) and the Food and…

Continue Reading Vulnerability in Illumina genome sequencing medical devices ranked 10.0

FDA Roundup: April 28, 2023

For Immediate Release: April 28, 2023 Today, the U.S. Food and Drug Administration is providing an at-a-glance summary of news from around the agency:  Today, the FDA issued a final guidance for industry titled Smoking Cessation and Related Indications: Developing Nicotine Replacement Therapy Drug Products, which replaces the draft guidance…

Continue Reading FDA Roundup: April 28, 2023

Illumina Sequencers Face Cybersecurity Vulnerability, FDA Warns

NEW YORK – The US Food and Drug Administration said on Thursday afternoon that nearly the entire Illumina sequencer lineup carries a cybersecurity vulnerability that could impact genomic data results or even result in a data breach. In a letter to healthcare providers and laboratory personnel, the FDA said that…

Continue Reading Illumina Sequencers Face Cybersecurity Vulnerability, FDA Warns

Critical-rated security flaw in Illumina DNA sequencing tech exposes patient data

The U.S. government has sounded the alarm about a critical software vulnerability found in genomics giant Illumina’s DNA sequencing devices, which hackers can exploit to modify or steal patients’ sensitive medical data. In separate advisories released on Thursday, U.S. cybersecurity agency CISA and the U.S. Food and Drug Administration warned…

Continue Reading Critical-rated security flaw in Illumina DNA sequencing tech exposes patient data

Vital-rated safety flaw in Illumina DNA sequencing tech exposes affected person information

The U.S. authorities has sounded the alarm a couple of essential software program vulnerability present in genomics large Illumina’s DNA sequencing gadgets, which hackers can exploit to change or steal sufferers’ delicate medical information. In separate advisories launched on Thursday, U.S. cybersecurity company CISA and the U.S. Meals and Drug…

Continue Reading Vital-rated safety flaw in Illumina DNA sequencing tech exposes affected person information

FDA Issues Warning Regarding Cybersecurity Vulnerability in Illuminas Universal Copy Service Software

As of April 27, 2023, the U.S. Food and Drug Administration (FDA) has issued a warning regarding a cybersecurity vulnerability discovered in Illumina’s Universal Copy Service software. This vulnerability can potentially pose risks to patient health results and customer networks. Fortunately, the FDA has not received any reports indicating the…

Continue Reading FDA Issues Warning Regarding Cybersecurity Vulnerability in Illuminas Universal Copy Service Software

Combining data from single- and paired-end sequencing done on same samples

Combining data from single- and paired-end sequencing done on same samples 0 Hi everyone, This is my first post in this community as I’m still fairly new to bioinformatics. Please forgive me if I make any mistakes. My current issue is in regards to reads of the same samples not…

Continue Reading Combining data from single- and paired-end sequencing done on same samples

Illumina gets cybersecurity warning from FDA over sequencing software

A cybersecurity vulnerability in Illumina DNA sequencing instruments could allow an unauthorized user to take control of the devices remotely or alter genomic data results, the U.S. Food and Drug Administration said Thursday in a warning to healthcare providers and laboratory personnel. The DNA-sequencing company first notified customers on April 5,…

Continue Reading Illumina gets cybersecurity warning from FDA over sequencing software

Asia-Pacific and Middle East NGS Global Market to 2027:

Dublin, April 27, 2023 (GLOBE NEWSWIRE) — The “Asia-Pacific and Middle East NGS Market: Focus on Offering, Platform, Throughput, Technology Type, Application, End User, and Country Analysis – Analysis and Forecast, 2022-2027” report has been added to ResearchAndMarkets.com‘s offering. The Asia-Pacific and Middle East NGS market was valued at $1,055.6…

Continue Reading Asia-Pacific and Middle East NGS Global Market to 2027:

Illumina (ILMN) Q1 Earnings Beat Estimates, Margins Contract

Illumina Inc. ILMN reported adjusted earnings per share (EPS) of 8 cents in the first quarter of 2023, sailing past the Zacks Consensus Estimate of 2 cents by a remarkable margin. However, the bottom line declined 92.5% from the year-ago quarter’s earnings of $1.07. The adjustments exclude the impact of GRAIL…

Continue Reading Illumina (ILMN) Q1 Earnings Beat Estimates, Margins Contract