Tag: NGS

Burning Rock Receives CE Mark

SHANGHAI, June 1, 2022 /PRNewswire/ — Burning Rock Biotech Limited (NASDAQ: BNR, the “Company” or “Burning Rock”) announced that it has received CE marking for its OverC™ Multi-Cancer Detection Blood Test manufactured in both the US and China facilities (Identification Number: DE/CA20/01-IVD-Luxuslebenswelt-523/22, DE/CA20/01-IVD-Luxuslebenswelt-524/22). OverC™ Multi-Cancer Detection Blood Test is a…

Continue Reading Burning Rock Receives CE Mark

Postdoctoral Researcher in Computational Biology at Karolinska Institute, Sweden 2022

Postdoctoral Researcher in Computational Biology is available for doctoral degree candidates in Bioinformatics, Computer science, Mathematics, Biostatistics, Neuroscience, or similar field at the Department of Clinical Neuroscience, Karolinska Institute, Sweden 2022 Qualification Details Qualified to be employed as a postdoctor is one who has obtained a doctorate or has equivalent…

Continue Reading Postdoctoral Researcher in Computational Biology at Karolinska Institute, Sweden 2022

A*STAR RESEARCH ENTITIES hiring #SGUnitedJobs Bioinformatics Specialist, Lab of Cancer Epigenetic Regulation, GIS in Singapore, Singapore

The Laboratory of Cancer Epigenetic Regulation, helmed by GIS Executive Director Patrick Tan, is seeking a Bioinformatician to join a new multi-institutional effort targeting the genetic basis of cancer to create novel therapies and diagnostics. Led by an award-winning thought leader in the field of Asian gastrointestinal cancer research with…

Continue Reading A*STAR RESEARCH ENTITIES hiring #SGUnitedJobs Bioinformatics Specialist, Lab of Cancer Epigenetic Regulation, GIS in Singapore, Singapore

Bioinformatics Analyst-Entry Level-Remote Position In Waukegan, IL

Job Description Responsibilities: You will be responsible for all aspects of bioinformatics analysis for transcriptomics and other specialized NGS experiments including quality control, differential gene expression, and pathway enrichment. You will work closely with a senior computational biologist to ensure smooth communication across teams and timely delivery of results. You…

Continue Reading Bioinformatics Analyst-Entry Level-Remote Position In Waukegan, IL

Postdoctoral position in Bioinformatics at Uppsala, Sweden, Aug 2022

The postdoctoral fellow position in Bioinformatics is available for applicants with a doctoral degree at the Department of Cell and Molecular Biology, Uppsala University, Sweden, in August 2022. General Info Position: Postdoctoral FellowNo. of Positions: 1Research Field: Bioinformatics, Computational BiologyJoining Date: ASAPContract Period: 2 YearsSalary: Subject to norms Workplace: Department…

Continue Reading Postdoctoral position in Bioinformatics at Uppsala, Sweden, Aug 2022

can i skip cutadapt?? – User Support

recently i receive rowdata from NGS center..and i start analysis using QIIME2 i want ‘cutadapt’, so i ask primer sequence to NGS center..but center reply to me “it is secret” if it is neccessery, i request to NGS center…. thank u for reading Hi @svbreqwaiu01, You do not need to…

Continue Reading can i skip cutadapt?? – User Support

Pooled shRNA Library Screening to Identify Factors that Modulate a Drug Resistance Phenotype

High-throughput RNA interference (RNAi) screening using a pool of lentiviral shRNAs can be a tool to detect therapeutically relevant synthetic lethal targets in malignancies. We provide a pooled shRNA screening approach to investigate the epigenetic effectors in acute myeloid leukemia (AML). The overall goal of the following video is to…

Continue Reading Pooled shRNA Library Screening to Identify Factors that Modulate a Drug Resistance Phenotype

SMARCE1 deficiency generates a targetable mSWI/SNF dependency in clear cell meningioma

Clapier, C. R., Iwasa, J., Cairns, B. R. & Peterson, C. L. Mechanisms of action and regulation of ATP-dependent chromatin-remodelling complexes. Nat. Rev. Mol. Cell Biol. 18, 407–422 (2017). CAS  PubMed  PubMed Central  Article  Google Scholar  Mashtalir, N. et al. Modular organization and assembly of SWI/SNF family chromatin remodeling complexes….

Continue Reading SMARCE1 deficiency generates a targetable mSWI/SNF dependency in clear cell meningioma

CISA Warned About Critical Vulnerabilities in Illumina’s DNA Sequencing Devices

The U.S. Cybersecurity and Infrastructure Security Agency (CISA) and Food and Drug Administration (FDA) have issued an advisory about critical security vulnerabilities in Illumina’s next-generation sequencing (NGS) software. Three of the flaws are rated 10 out of 10 for severity on the Common Vulnerability Scoring System (CVSS), with two others…

Continue Reading CISA Warned About Critical Vulnerabilities in Illumina’s DNA Sequencing Devices

cfDNA-Based NGS IG Analysis in Lymphoma

Circulating cell-free DNA (cfDNA) is fragmented extracellular DNA, which is released from apoptotic and necrotic cells in small fragments of <200 bp [1]. cfDNA is typically isolated from the blood stream; however, it is also possible to detect cfDNA in other biological fluids such as urine or cerebrospinal fluid [2, 3,…

Continue Reading cfDNA-Based NGS IG Analysis in Lymphoma

LncRNA Sequencing Helps to Find Deep Links to Disease

Long non-coding RNAs (lncRNAs) are a class of RNAs that do not code for proteins and are typically greater than 200 nucleotides in length. Studies have shown that lncRNAs are quite complex in function and play an important role in various biological processes such as development, differentiation, proliferation, metastasis, apoptosis,…

Continue Reading LncRNA Sequencing Helps to Find Deep Links to Disease

Singular Genomics Partners with Qiagen to Enable Qiaseq Kits for the G4 Sequencing Platform

LA JOLLA, Calif., Feb. 28, 2022 (GLOBE NEWSWIRE) — Singular Genomics Systems, Inc. (Nasdaq: OMIC), a company leveraging novel next-generation sequencing (NGS) and multiomics technologies to empower researchers and clinicians, today announced a partnership with Agilent Technologies (www.agilent.com) to validate its NGS Target Enrichment Products, highly sensitive target enrichment panels…

Continue Reading Singular Genomics Partners with Qiagen to Enable Qiaseq Kits for the G4 Sequencing Platform

Read counts an order of magnitude higher on one chromosome

Read counts an order of magnitude higher on one chromosome 3 Hi, I am having an issue with a sequencing run that when demultiplexed, aligned, and filtered each individual has 1-2 million reads, but these reads are predominantly on one chromosome. For background these are oncorhynchus mykiss and o. clarki…

Continue Reading Read counts an order of magnitude higher on one chromosome

Bioinformatics Jobs : Latest 251 Bioinformatics Openings & Vacancies in Singapore

MiRXES is a Singapore-headquartered molecular diagnostic company with R&D, manufacturing, and clinical lab operations in Singapore, USA, Japan, and China. We specialize in microRNA technologies and th Skills : Genomics , NGS , Data Analysis , Pipelines , Interpersonal Skills , assay development , workflow management , Bioinformatics , sequencing…

Continue Reading Bioinformatics Jobs : Latest 251 Bioinformatics Openings & Vacancies in Singapore

Assistant Project Scientist, Bioinformatics in Los Angeles, CA for University of California Los Angeles

Details Posted: 15-May-22 Location: Los Angeles, California Type: Full-time Salary: Open Categories: Academic/Faculty Physical Sciences Assistant Project Scientist, BioinformaticsUniversity of California Los Angeles Requisition Number: JPF07378 The Department of Molecular and Medical Pharmacology is recruiting for a bioinformatics Project Scientist at the Assistant level. The candidate will investigate the human…

Continue Reading Assistant Project Scientist, Bioinformatics in Los Angeles, CA for University of California Los Angeles

Norgen 16S rRNA and ITS Library Preparation Kits

Analyze Bacterial and Fungal Microbiomes 16S rRNA Library Preparation Kits Simple and quick workflow. Library could be prepared in less than 4 hours Part of Norgen’s metagenomics workflow: collection, preservation, DNA isolation, sequencing, and analysis. Protocol optimized for DNA isolated from a large range of sample types Up to 384…

Continue Reading Norgen 16S rRNA and ITS Library Preparation Kits

CALITHERA BIOSCIENCES, INC. MANAGEMENT’S DISCUSSION AND ANALYSIS OF FINANCIAL CONDITION AND RESULTS OF OPERATIONS (form 10-Q)

You should read the following discussion and analysis of our financial condition and results of operations in conjunction with our unaudited condensed consolidated financial statements and related notes included in Part I, Item 1 of this report. This Quarterly Report on Form 10-Q contains forward-looking statements within the meaning of…

Continue Reading CALITHERA BIOSCIENCES, INC. MANAGEMENT’S DISCUSSION AND ANALYSIS OF FINANCIAL CONDITION AND RESULTS OF OPERATIONS (form 10-Q)

Frontiers | Divergence With Gene Flow and Contrasting Population Size Blur the Species Boundary in Cycas Sect. Asiorientales, as Inferred From Morphology and RAD-Seq Data

Introduction Incipient species are critical for evolutionary biologists to study speciation, but they also challenge taxonomy due to gene flow or ancestral polymorphism. The former and contrasting population size lead to larger intraspecific than interspecific variations, a phenomenon called the species-definition anomaly zone (Jiao and Yang, 2021). The latter results…

Continue Reading Frontiers | Divergence With Gene Flow and Contrasting Population Size Blur the Species Boundary in Cycas Sect. Asiorientales, as Inferred From Morphology and RAD-Seq Data

Senior Research Associate, Bioinformatics at Kite Pharma

Job details Job type full-time Full job description Job description At kite pharma we are revolutionizing the treatment for cancers through immunotherapy through novel breakthrough technologyWe have developed and launched best in class car-t therapy yescarta, currently curing patients from previously intractable b-cell malignanciesWe are using our expertise to apply…

Continue Reading Senior Research Associate, Bioinformatics at Kite Pharma

Bioinformatics Jobs in Lausanne, Vaud

3.1 Data Manager Our client will be looking for a candidate with Data Management experience and experience in a previous Data Manager role.… 3.8 4.3 4.3 PhD Student in Gene Regulation There are regular possibilities to present and participate in local or international conferences and workshops. A copy of your…

Continue Reading Bioinformatics Jobs in Lausanne, Vaud

Postdoc (m/f/d) – CBIRT

Website Leibniz Institute on Aging – Fritz Lipmann Institute (FLI) Job Category: Bioinformatics Job Job ID: 22/16 Date Posted: 05.05.2022 Deadline: 19.06.2022 Location: Jena, Germany The Leibniz Institute on Aging – Fritz Lipmann Institute (FLI) in Jena is a federal and state government-funded research institute and member…

Continue Reading Postdoc (m/f/d) – CBIRT

Production Bioinformatics Manager, Clinical Informatics (Operations)

Invitae is dedicated to bringing comprehensive genetic information into mainstream medicine to improve healthcare for billions of people. The Clinical Informatics team is driven to make a difference for the patients we serve. We are leading the transformation of the genetics industry by making genetic testing affordable and accessible for…

Continue Reading Production Bioinformatics Manager, Clinical Informatics (Operations)

Director of Bioinformatics in Chicago, IL for University of Chicago (UC)

Details Posted: 03-May-22 Location: Chicago, Illinois Type: Full-time Salary: Open Categories: Research – Laboratory/Non-Laboratory Staff/Administrative Location: Hyde Park Campus Job Description: Provides technical expertise in the selection, validation, and implementation of the appropriate internal and external data analytic and bioinformatic solutions needed to analyze specimens, process and integrate data, and…

Continue Reading Director of Bioinformatics in Chicago, IL for University of Chicago (UC)

Bioinformatics Specialist at The University of Chicago in Chicago, IL – 4091

Job Info Department BSD PED – Section Administrator: Hematology, Oncology, and Stem Cell Transplantation About the Department The Section of Pediatric Hematology/Oncology provides care for patients and families with acute and chronic medical conditions, or other hematologic diseases, requiring the specialty knowledge and skills of Hematology, Oncology and Stem Cell…

Continue Reading Bioinformatics Specialist at The University of Chicago in Chicago, IL – 4091

New Products Posted to GenomeWeb: MGI, Tecan, Qiagen, More

MGI HotMps High-Throughput Sequencing Kit BGI Group affiliate MGI has launched new commercial sequencing chemistry called HotMps for its DnbSeq-G400 sequencer. Built upon the combinatorial Probe Anchor Synthesis technology proprietary to MGI, HotMps can achieve low error rates, low duplication rates, and low index hopping while being compatible with commonly…

Continue Reading New Products Posted to GenomeWeb: MGI, Tecan, Qiagen, More

Bioinformatics Data Engineer in Boston, MA for Dana-Farber Cancer Institute

Details Posted: 27-Apr-22 Location: Boston, Massachusetts Salary: Open Categories: Staff/Administrative Internal Number: 2022-26005 Located in Boston and the surrounding communities, Dana-Farber Cancer Institute (DFCI) brings together world renowned clinicians, innovative researchers and dedicated professionals, allies in the common mission of conquering cancer, HIV/AIDS and related diseases. Combining extremely talented people…

Continue Reading Bioinformatics Data Engineer in Boston, MA for Dana-Farber Cancer Institute

Postdoctoral Scientist – Bioinformatics and Integrative Genomics Research Cluster in , for Cedars-Sinai Medical Center

Details Posted: 26-Apr-22 Location: Nationwide Type: Full-time Salary: Open Internal Number: 20002022 At Cedars-Sinai, postdoctoral scientists and other junior researchers fulfill a critical role in expanding the horizons of medical knowledge through biomedical research. By hosting more than 100 postdocs, who conduct vital research and receive advanced training with expert…

Continue Reading Postdoctoral Scientist – Bioinformatics and Integrative Genomics Research Cluster in , for Cedars-Sinai Medical Center

14 Postdoctoral Fellowship at Umea University, Sweden

Umea University, Sweden invites online Application for various Postdoctoral Fellowship in their different Departments. We are providing a list of Postdoc Fellowship positions available at Umea University, Sweden. Eligible candidate may Apply as soon as possible.   (01) Postdoctoral Fellowship Position Postdoc Fellowship Position summary/title: Postdoctoral fellow – Molecular epidemiology…

Continue Reading 14 Postdoctoral Fellowship at Umea University, Sweden

Postdoc / Research Scientist in Bioinformatics and Computational Genomics

Job Description Are you a computer geek with a strong interest in genomics? Do you want to use your computational skills to solve human diseases? At the Department of Neurology at Harvard Medical School and Brigham & Women’s Hospital, we have two vacant positions: postdoctoral fellow and research scientist in…

Continue Reading Postdoc / Research Scientist in Bioinformatics and Computational Genomics

Bioinformatics Analyst II – Remote in Danville, PA for Geisinger

Details Posted: 22-Apr-22 Location: Danville, Pennsylvania Type: Full Time Salary: Open Categories: Operations Job Summary Primary accountability is to leverage the organization’s data assets exome sequencing data (>180,000 individuals) from MyCode Community Health Initiative to improve quality, efficiency and generate knowledge specifically in the field of bioinformatics within health research….

Continue Reading Bioinformatics Analyst II – Remote in Danville, PA for Geisinger

Atrial standstill, digenic (GJA5/SCN5A), 108770, Autosomal dominant; ATRST1 (Atrial standstill) (GJA5 gene) (Sequence Analysis-All Coding Exons) (Postnatal) – Clinical test – NIH Genetic Testing Registry (GTR)

Overview Test order codeHelpLaboratory’s order or catalog code for the test (used in the order requisition form).: 1586 Atrial standstill, digenic (GJA5/SCN5A), 108770, Autosomal dominant; ATRST1 (Atrial standstill) (GJA5 gene) (Sequence Analysis-All Coding Exons) (Postnatal) This is a clinical test intended for HelpPurposes or indications for the test. Lab-provided.: Diagnosis…

Continue Reading Atrial standstill, digenic (GJA5/SCN5A), 108770, Autosomal dominant; ATRST1 (Atrial standstill) (GJA5 gene) (Sequence Analysis-All Coding Exons) (Postnatal) – Clinical test – NIH Genetic Testing Registry (GTR)

Bioinformatics Scientist III – D3b at Children`s Hospital of Philadelphia

Job details Job type full-time Full job description Location: loc_roberts-roberts ctr pediatric research req id: 134035 shift: days employment status: regular – full time job summary the bioinformatics unit (bixu) within the center for data driven discovery (d3b) at the children’s hospital of philadelphia (chop) is seeking a level iii…

Continue Reading Bioinformatics Scientist III – D3b at Children`s Hospital of Philadelphia

long run-time and low CPU usage

Pindel: long run-time and low CPU usage 0 I’m trying to run Pindel on some 30x Illumina WGS data. I aligned reads with BWA-MEM, then sorted by co-ordinates and indexed them with Samtools. I also tried filtering the bam files with samtools -F 0x800 as suggested by another post. I…

Continue Reading long run-time and low CPU usage

aCGH – Allie: Result by abbreviation

1  array comparative genomic hybridization(1473 times) Neoplasms(306 times) FISH (238 times)CNVs (135 times)MLPA (72 times) 2003 1-Mb resolution array-based comparative genomic hybridization using a BAC clone set optimized for cancer gene analysis. 2  array CGH(43 times) Neoplasms(12 times) CNVs (7 times)FISH (3 times)ID (3 times) 2003 Combined array comparative genomic hybridization and…

Continue Reading aCGH – Allie: Result by abbreviation

Bioinformatics Pipeline Development Engineer II at Personalis, Inc

Personalis, Inc. is a leader in advanced cancer genomics for enabling the next generation of precision cancer therapies and diagnostics. The Personalis NeXT Platform® is designed to adapt to the complex and evolving understanding of cancer, providing its biopharmaceutical customers and clinicians with information on all of the approximately 20,000 human genes,…

Continue Reading Bioinformatics Pipeline Development Engineer II at Personalis, Inc

Kits for the preparation of Illumina libraries

ChIP-Seq or ChIP sequencing is a new generation sequencing technique (NSG) for studying the interactions between proteins and DNA, to identify genome-wide DNA binding sites for transcription factors and other proteins. ChIP-Seq sequencing is therefore a key tool in epigenomics research. It is an approach based on a sequencing technique…

Continue Reading Kits for the preparation of Illumina libraries

3 -tag XM” failed! when running rsem-calculate-expression

Dear sir, When I ran “rsem-calculate-expression –paired-end –alignments -p 8input.bam” gencodev22 ./out. I got error message rsem-parse-alignments ../bowtie2/hg38 ./rsem-out.temp/rsem-out ./rsem-out.stat/rsem-out /NGS_Storage/Debbie/RNA-seq/variant_calling_20210602/RNA-leukemia002A-906.para.bam 3 -tag XM Read A00355:209:H3KTLDSX2:2:2606:24677:17425: The adjacent two lines do not represent the two mates of a paired-end read! (RSEM assumes the two mates of a paired-end read should…

Continue Reading 3 -tag XM” failed! when running rsem-calculate-expression

JCI – insights to advance clinical investigations of the microbiome

Next-generation sequencing (NGS) technology has advanced our understanding of the human microbiome by allowing for the discovery and characterization of unculturable microbes with prediction of their function. Key NGS methods include 16S rRNA gene sequencing, shotgun metagenomic sequencing, and RNA sequencing. The choice of which NGS methodology to pursue for…

Continue Reading JCI – insights to advance clinical investigations of the microbiome

Fortis Life Sciences Inks Distribution Deal for AccuGenomics NGS Standards Tech

NEW YORK — Fortis Life Sciences, a provider of capital and other resources to life science tool companies, said on Tuesday that it has signed a deal to distribute AccuGenomics’ SNAQ-SEQ internal standards technology for next-generation sequencing in the US and Europe. Under the terms of the deal, Waltham, Massachusetts-based…

Continue Reading Fortis Life Sciences Inks Distribution Deal for AccuGenomics NGS Standards Tech

Your Source Of Daily World News Crypto Business Technology & Sports News

Cholangiocarcinoma, or bile duct most cancers, is lethal even when caught early. The 5-year survival rate amongst these identified early is 17% to 25%; for many sufferers, the speed is under 10%. Experts say the important thing to bettering these dismal statistics is to give attention to the various genetic…

Continue Reading Your Source Of Daily World News Crypto Business Technology & Sports News

Bioinformatics Application Scientist – Carlsbad

Job Description Bioinformatics Application Scientist (Actual title will depend on qualification and experience, including director level appointment) The Company: Universal Sequencing Technology Corporation (universalsequencing.com), a leading NGS biotechnology company engaged in long range/long read sequencing technology is relocating its headquarters from the greater Boston area to Carlsbad, CA where R&D…

Continue Reading Bioinformatics Application Scientist – Carlsbad

Bioinformatics Specialist (Ref:DMSTBT) Job in Singapore

We would like to recruit a Bioinformatics Specialist with expertise in plant-based omics data analysis. You will be required to perform data management, extraction, mining, and analysis of NGS and third generation sequencing data. You will be required to: – Apply scientific principles and insights in computational biology into various…

Continue Reading Bioinformatics Specialist (Ref:DMSTBT) Job in Singapore

Untangling SNP Variations within CYP2D6 Gene in Croatian Roma

CYP2D6 is a highly polymorphic gene whose variations affect its enzyme activity. To assess whether the specific population history of Roma, characterized by constant migrations and endogamy, influenced the distribution of alleles and thus phenotypes, the CYP2D6 gene was sequenced using NGS (Next Generation Sequencing) method-targeted sequencing in three groups…

Continue Reading Untangling SNP Variations within CYP2D6 Gene in Croatian Roma

BioInformatics Product Manager at Helix (remote)

You + Helix Helix is a place where innovators and doers gather in order to drive significant progress in population genomics. We have come together to work at the intersection of clinical care, research, and genomics.   If you’re excited by the idea of making a meaningful impact and joining a…

Continue Reading BioInformatics Product Manager at Helix (remote)

Results From Genome Sequencing and Clinical Genotyping.docx

Objective: Hmong individuals represent a unique East Asian subpopulation in whom limited information concerning pharmacogenetic variation exists. The objectives of this study were to comprehensively characterize the highly polymorphic CYP2D6 gene in Hmong, estimate allele and phenotype frequencies and to compare results between two testing platforms. Methods: DNA from 48…

Continue Reading Results From Genome Sequencing and Clinical Genotyping.docx

Color hiring Software Engineer, Bioinformatics in Remote

About Color Color’s mission is to help people lead the healthiest lives that science and medicine can offer. We launched in April 2015 with a simple, affordable genetic test to help people understand their risk for hereditary cancer. In 2017, we added coverage for hereditary heart conditions. Between them, cancer…

Continue Reading Color hiring Software Engineer, Bioinformatics in Remote

how to downolad genbank file from islandviewer

how to downolad genbank file from islandviewer 0 Dear All, am working on a salmonella st313 genome which i uploaded on islandViewer to try and get genomic islands, i want to download a genbank file i can use to visualize the islands on artemis but i cant seem to find…

Continue Reading how to downolad genbank file from islandviewer

When proteome meets AI, what is accelerated

What meaningful or interesting information can an ordinary person obtain by performing mass spectrometry detection of the whole blood proteome? Who will be the 23andMe (DNA identification company) in the proteome space? In July last year, when 98.5% of the protein structure of the human proteome was deciphered by the…

Continue Reading When proteome meets AI, what is accelerated

bam – Detect mutation context in a read of a sam file

That kind of custom fiddling with reads and variants is very cumbersome, non-standard and also error-prone. Do a standard variant callign pipeline and then filter for the mutations that you want. Then extract the variant position (so the coordinates) and get the variant context from the reference genome. Using individual…

Continue Reading bam – Detect mutation context in a read of a sam file

Next Generation Sequencing (NGS) Leader Nick McCooke Joins Genomics Company RevoluGen as Strategic Advisor

LONDON, March 10, 2022–(BUSINESS WIRE)–UK genomics company, RevoluGen Ltd. (RevoluGen or the Company), today announces that Nick McCooke, widely recognised leader in the next generation sequencing (NGS) field, has been appointed as Strategic Advisor. This press release features multimedia. View the full release here: www.businesswire.com/news/home/20220310005076/en/ Nick McCooke, NGS Expert and…

Continue Reading Next Generation Sequencing (NGS) Leader Nick McCooke Joins Genomics Company RevoluGen as Strategic Advisor

CEFAS22-11 Next Generation Sequencing Services Framework: | Construction Tenders

Tender Details Reference ocds-h6vhtk-031eee Common Procurement Vocabulary Technical analysis or consultancy services Procurement Method Open procedure Value £500,000 Tender Details Reference ocds-h6vhtk-031eee Common Procurement Vocabulary Technical analysis or consultancy services Procurement Method Open procedure Value £500,000 Section I: Contracting authority I.1) Name and addresses CEFAS Pakefield Road Lowestoft NR33 0HT…

Continue Reading CEFAS22-11 Next Generation Sequencing Services Framework: | Construction Tenders

Research Biologist Computational Bioinformatics Geneticist Research Associate Job in PEORIA, IL

Summary The Agricultural Research Service (ARS) is the United States Department of Agriculture’s chief scientific research agency and one of the world’s premiere scientific organizations. ARS Postdoctoral Research Associates are hired to supplement a lead scientist’s research on agricultural problems of high national priority affecting American agriculture. **ANNOUNCEMENT IS OPEN…

Continue Reading Research Biologist Computational Bioinformatics Geneticist Research Associate Job in PEORIA, IL

UWI performs Next Generation Sequencing service for the first time in Jamaica

The UWI Mona Campus, Kingston, Jamaica. Friday, February 25, 2022 —The University of the West Indies (The UWI) Mona Campus – working in close collaboration with the University Hospital of the West Indies (UHWI) and the Ministry of Health and Wellness (MOHW) – has established a Next Generation Sequencing (NGS) Service…

Continue Reading UWI performs Next Generation Sequencing service for the first time in Jamaica

Scientist III, Bioinformatics – Services Lab

Job Description Job Description: *Job Title: Scientist III, Bioinformatics – Services Lab* *Requisition ID: 175587* Thermo Fisher Scientific Inc. is the world leader in serving science, with annual revenue exceeding $25 billion. Our Mission is to enable our customers to make the world healthier, cleaner and safer. Whether our customers…

Continue Reading Scientist III, Bioinformatics – Services Lab

HRJOB7442 Bioinformatics Scientist 2 (Various Locations) in Nether Alderley, Macclesfield (SK10) | Almac Group (Uk) Ltd

Bioinformatics Scientist 2 Hours: 37.5 hours per week Salary: Competitive Ref No: HRJOB7442 Business Unit: Diagnostic Services Location: Craigavon or Manchester Open To: Internal and External Applicants The Company Almac Diagnostic Services is a leading stratified medicine business, specialising in biomarker-driven clinical trials. We are incredibly proud to be involved…

Continue Reading HRJOB7442 Bioinformatics Scientist 2 (Various Locations) in Nether Alderley, Macclesfield (SK10) | Almac Group (Uk) Ltd

Extracellular circulating miRNAs as stress-related signature to search and rescue dogs

Study approval was provided by the Research Ethics Committee of the University of Perugia (report n.2018-21 of 11/12/2018) according to Italian Ministry of Health legislation18. All methods were carried out following relevant guidelines and regulations and the study was carried out in compliance with the ARRIVE guidelines. Informed consent is…

Continue Reading Extracellular circulating miRNAs as stress-related signature to search and rescue dogs

Per base sequence quality – fastqc

Per base sequence quality – fastqc 2 Hi everyone, I am new to bioinformatics, I am asking a very basic question here, I have paired-end fastq data, I did fastqc, and in this per base sequence quality, few reads are in the red region, and there is no adapter and…

Continue Reading Per base sequence quality – fastqc

Genomic variation from an extinct species is retained in the extant radiation following speciation reversal

Vamosi, J. C., Magallon, S., Mayrose, I., Otto, S. P. & Sauquet, H. Macroevolutionary patterns of flowering plant speciation and extinction. Annu. Rev. Plant Biol. 69, 685–706 (2018). CAS  PubMed  Google Scholar  Rhymer, J. M. & Simberloff, D. Extinction by hybridization and introgression. Annu. Rev. Ecol. Syst. 27, 83–109 (1996)….

Continue Reading Genomic variation from an extinct species is retained in the extant radiation following speciation reversal

Very Long-Chain Acyl-CoA Dehydrogenase Deficiency (ACADVL) Sequencing and Deletion/Duplication

Ordering Recommendation Recommendations when to order or not order the test. May include related or preferred tests. Preferred molecular test to diagnose or rule out very long-chain acyl-CoA dehydrogenase (VLCAD) deficiency following clinical and/or biochemical presentation. May also be used for carrier testing for the reproductive partner of an individual…

Continue Reading Very Long-Chain Acyl-CoA Dehydrogenase Deficiency (ACADVL) Sequencing and Deletion/Duplication

CD Genomics: Bioinformatics-Analysis Division Provides Genotyping Analysis Service for Studying Genetic Variations

New York, USA – February 23, 2022 – The Bioinformatics-analysis division is a new division of CD Genomics that provides reliable next-generation and third-generation high-throughput sequencing data analysis, comprehensive technology services, database construction, and other related data analysis services. CD Genomics recently launched various types of genotyping analysis services, including…

Continue Reading CD Genomics: Bioinformatics-Analysis Division Provides Genotyping Analysis Service for Studying Genetic Variations

Using AnnoTree to Get More Assignments, Faster, in DIAMOND+MEGAN Microbiome Analysis

INTRODUCTION Next-generation sequencing (NGS) has revolutionized many areas of biological research (1, 2), providing ever-more data at an ever-decreasing cost. One such area is microbiome research, the study of microbes in their theater of activity using metagenomic sequencing (3). Here, deep short-read sequencing, and improving performance of long-read sequencing, are…

Continue Reading Using AnnoTree to Get More Assignments, Faster, in DIAMOND+MEGAN Microbiome Analysis

QuantSeq 3’ mRNA-Seq Library prep kits: Lexogen

QuantSeq 3’ mRNA-Seq Library Prep kits from Lexogen offers cost-efficient analysis of differential gene expression via 3’ mRNA-seq library preparation. Requiring fewer reads per samples and capable of multiplexing a high number of samples on a single sequencing lane, the 3’ mRNA-Seq technology simplifies your gene expression projects with no…

Continue Reading QuantSeq 3’ mRNA-Seq Library prep kits: Lexogen

Nuprobe USA Inc. Quality Assurance Manager

Quality Assurance Manager- Molecular NGS, PCR, IVD Quality Assurance ManagerHouston TX NuProbe USA Inc. is looking for a Quality Assurance Manager to lead the Quality program to establish and maintain compliance to ISO: 9001, ISO: 13485, and FDA 21 CFR Part 820 Quality System Regulations. NuProbe USA is a rapidly…

Continue Reading Nuprobe USA Inc. Quality Assurance Manager

Pathogenomix Developing Infectious Disease Testing Platform Enabled by Cloud-Based Analytics, NGS

NEW YORK — Pathogenomix is combining sequencer-agnostic, cloud-based analytics software with 16S rRNA gene sequencing to enable hospital laboratories to identify the pathogens behind life-threatening bacterial infections. Though no NGS-based tests have obtained full US Food and Drug Administration authorization to identify infectious disease pathogens, Pathogenomix said it is on…

Continue Reading Pathogenomix Developing Infectious Disease Testing Platform Enabled by Cloud-Based Analytics, NGS

How to apply vcftools –diff and extract only the different variants

How to apply vcftools –diff and extract only the different variants 0 Hello, I am trying to apply vcftools –diff in order to extract the different variants between two VCF files. vcftools –vcf marked_IO002_tumor-pe.vcf –diff marked_IO002_normal-pe.vcf –diff-site –out t_v_n I am getting this as result : VCFtools – 0.1.16 (C)…

Continue Reading How to apply vcftools –diff and extract only the different variants

PostDoc Plant Bioinformatics job with SKOLKOVO INSTITUTE OF SCIENCE AND TECHNOLOGY

<p><strong>Want to participate to the outstanding new area of agro-genomics ? To put into the practice how the genetic diversity and genome-assisted breeding in crops contribute to provide healthy and high quality food in a sustainable way to humankind? Strong in bioinformatics and interested in working with very large datasets…

Continue Reading PostDoc Plant Bioinformatics job with SKOLKOVO INSTITUTE OF SCIENCE AND TECHNOLOGY

Requirement of Xk and Vps13a for the P2X7-mediated phospholipid scrambling and cell lysis in mouse T cells

Significance The extracellular concentration of adenosine triphosphate (ATP) reaches several hundred micromoles in the inflamed tissues or tumor environment. A high concentration of ATP activates P2X7, a purinergic receptor, and induces the formation of a nonselective cation channel, accompanied by reversible phosphatidylserine (PtdSer) exposure, leading to cell lysis. Here, we…

Continue Reading Requirement of Xk and Vps13a for the P2X7-mediated phospholipid scrambling and cell lysis in mouse T cells

Associate Operations Manager Job Opening in Houston, TX at NuProbe USA Inc.

Associate Operations Manager NuProbe USA is hiring one Associate Operations Manager for its Houston (TX) location. The successful candidate will have the opportunity to join the NuProbe family in the G&A Department reporting directly to the Director of Operations. Essential Job Duties and Responsibilities: Essential responsibilities and duties include, but…

Continue Reading Associate Operations Manager Job Opening in Houston, TX at NuProbe USA Inc.

Postdoctoral position in bioinformatics – focused on single-cell immune transcriptomics – Karolinska Institute – job portal

Postdoctoral position in bioinformatics – focused on single-cell immune transcriptomics Login and apply Do you want to contribute to improving human health? We are looking for an ambitious postdoctoral fellow with solid genome-wide bioinformatics and computational biology skills to join our highly accomplished team. We offer a stimulating environment in…

Continue Reading Postdoctoral position in bioinformatics – focused on single-cell immune transcriptomics – Karolinska Institute – job portal

Does Trimmomatic merge paired-end reads into “single-end” files?

Does Trimmomatic merge paired-end reads into “single-end” files? 0 I’m new to NGS analysis, and I’m trying to build a de novo assembly from paired end sequencing data (150-bp paired end reads; RADseq libraries from insects). My reads have been demultiplexed according to the individual specimen they came from (70…

Continue Reading Does Trimmomatic merge paired-end reads into “single-end” files?

Vertical stratification of the air microbiome in the lower troposphere

Significance Large-scale meteorological and biological data demonstrate the vertical stratification of airborne biomass. The previously described diel cycle of airborne microorganisms is shown to disappear at height. Atmospheric turbulence and stratification are shown to be defining factors for the scale and boundaries, dynamics, and natural variability of airborne biomass, resulting…

Continue Reading Vertical stratification of the air microbiome in the lower troposphere

LIMS Developer, Bioinformatics, remote at Quest Diagnostics

Look for more than answers. At Quest, we are on a continuous journey of discovery and development. It’s this attitude that has made us an industry leader and the #1 Diagnostic Lab in the US. For those joining us, we offer exciting and fast moving career opportunities where you can…

Continue Reading LIMS Developer, Bioinformatics, remote at Quest Diagnostics

Manufacturing Associate Job Opening in Houston, TX at Nuprobe USA Inc.

MANUFACTURING ASSOCIATE (T1 or T2) NuProbe USA is hiring one Manufacturing Associate (T1 or T2) for its Houston (TX) location. The successful candidate will have the opportunity to join the NuProbe family in the Manufacturing Department reporting directly to the Manufacturing Manager. PRIMARY PURPOSE OF POSITION The new hire will…

Continue Reading Manufacturing Associate Job Opening in Houston, TX at Nuprobe USA Inc.

Monitoring multiple myeloma in the peripheral blood based on cell-free DNA and circulating plasma cells

This article was originally published here Ann Hematol. 2022 Feb 1. doi: 10.1007/s00277-022-04771-5. Online ahead of print. ABSTRACT With the advent of novel, highly effective therapies for multiple myeloma (MM), classical serologic monitoring appears insufficient for response assessment and prediction of relapse. Moreover, serologic studies in MM are hampered by…

Continue Reading Monitoring multiple myeloma in the peripheral blood based on cell-free DNA and circulating plasma cells

Nuprobe | Your Scientific Network

Nuprobe | Your Scientific Network | Labroots Date: February 09, 2021 Time: 09:00am (PST), 12:00pm (EST) In this webinar we introduce quantitative amplicon sequencing (QASeq): a highly-sensitive and robust NGS-based method for the detec… Let’s Talk Science. Let’s Talk Medicine. The leading scientific social networking website and producer of educational…

Continue Reading Nuprobe | Your Scientific Network

Bioinformatics NGS Data Analyst-Remote at Mindlance

Job Description Title: Bioinformatics NGS Data AnalystDuration: 12 monthsLocation: Remote Job Description:POSITION SUMMARY• Key member within the clinical imaging line within the Digital Medicine & Translational Imaging group, Early Clinical Development• Support the clinical image data management and analysis POSITION RESPONSIBILITIES• Work with Imaging Lead, Information Management – Clinical Trial…

Continue Reading Bioinformatics NGS Data Analyst-Remote at Mindlance

Sr. Bioinformatics Scientist-Project Manager – 114267

#114267 Sr. Bioinformatics Scientist-Project Manager Filing Deadline: Mon 2/14/2022 UCSD Layoff from Career Appointment: Apply by 02/02/2022 for consideration with preference for rehire. All layoff applicants should contact their Employment Advisor. Special Selection Applicants: Apply by 02/14/2022. Eligible Special Selection clients should contact their Disability Counselor for assistance. The UCSD…

Continue Reading Sr. Bioinformatics Scientist-Project Manager – 114267

Bioinformatics Scientist Job Opening in Seattle, WA at Alpine Immune Sciences

Job Posting for Bioinformatics Scientist at Alpine Immune Sciences Alpine Immune Sciences is applying our platform discovery technology to bring innovative new therapies to people living with serious or life-threatening illnesses or conditions, such as cancer and autoimmune/inflammatory diseases. Exciting challenges lie ahead—guided by our core values, we’ll…

Continue Reading Bioinformatics Scientist Job Opening in Seattle, WA at Alpine Immune Sciences

DNA Labs International Launches the Newest Technology for Forensic Genetic Genealogy

MiSeq FGx platform by Verogen DEERFIELD BEACH, Fla. (PRWEB) January 26, 2022 DNA Labs International, which specializes in forensic DNA analysis including forensic genetic genealogy (FGG) for law enforcement agencies, government forensic labs, and attorneys, is announcing the release of their newest technology, Single Nucleotide Polymorphism (SNP) testing with…

Continue Reading DNA Labs International Launches the Newest Technology for Forensic Genetic Genealogy

Discovery Life Sciences hiring Bioinformatics Scientist in Huntsville, Alabama, United States

The Bioinformatics Scientist will take lab-generated data and create computational models that allow further manipulation and experimentation, perform incremental analysis required to process large amounts of data generated in a high-throughput Next Generation Sequencing (NGS) laboratory devoted to analysis of genomics data with a focus on long- and short-read sequencing…

Continue Reading Discovery Life Sciences hiring Bioinformatics Scientist in Huntsville, Alabama, United States

Senior Bioinformatics Software Developer – Bethesda

Medical Science & Computing, (MSC), a Dovel company, is seeking skilled Senior Bioinformatics Software Developers to join our team supporting our client, NCBI at the National Institutes of Health, (NIH) in Bethesda, MD. The National Center for Biotechnology Information (NCBI) is part of the National Library of Medicine (NLM) at…

Continue Reading Senior Bioinformatics Software Developer – Bethesda

NuProbe Technology Showcases Quantitative PCR for

Houston, January 18, 2022 (GLOBE NEWSWIRE) – NuProbe, a genomics and molecular diagnostics company that develops ultra-sensitive tests for precision cancer research, today released research demonstrating new technology to qualitatively and quantitatively detect multiple low-grade variants frequency in a quantitative PCR (qPCR reaction). The new allele-specific BDA technology (As-BDA) uses…

Continue Reading NuProbe Technology Showcases Quantitative PCR for

Senior Manager, Bioinformatics and Genomics Data Scientist

Job Description Do you want to be part of an inclusive team that works to develop innovative therapies for patients? Every day, we are driven to develop and deliver innovative and effective new medicines to patients and physicians. If you want to be part of this exciting work, you belong…

Continue Reading Senior Manager, Bioinformatics and Genomics Data Scientist

Bioconductor – RiboCrypt

DOI: 10.18129/B9.bioc.RiboCrypt     Interactive visualization in genomics Bioconductor version: Release (3.14) R Package for interactive visualization and browsing NGS data. It contains a browser for both transcript and genomic coordinate view. In addition a QC and general metaplots are included, among others differential translation plots and gene expression plots….

Continue Reading Bioconductor – RiboCrypt

Roche hiring Sr Bioinformatics Scientist in Cambridge, Massachusetts, United States

SUMMARY We are seeking a talented and motivated Senior Bioinformatics Scientist who will be an integral member of the Sequencing team contributing to the support and development of ground-breaking next-generation sequencing (NGS) products. As a member of Roche’s Sequencing and Life Science (SLS), Scientific Support and Applications team, you will…

Continue Reading Roche hiring Sr Bioinformatics Scientist in Cambridge, Massachusetts, United States

Identification of missed viruses by metagenomic sequencing of clinical respiratory samples from Kenya

The detection of viruses As shown in Table 1, viral NGS identified at least one syndrome-associated mammalian virus in 35 of 95 Kilifi County Hospital (KCH) inpatient samples (36.8%) and 23 of 95 household cohort (study investigating Who-Acquires-Infection-From-Whom, WAIFW) samples (24.2%), leading to an overall 30.5% “missed virus detection rate”….

Continue Reading Identification of missed viruses by metagenomic sequencing of clinical respiratory samples from Kenya

Comparison of CNV analysis methods: Array CGH vs NGS

Rare genetic disorders are caused by variants in major functional genes. Most are SNV or INDEL variants, but SVs, such as CNVs or chromosomal variants, can also be the cause. Recently, a large-scale study has also been published showing that CNVs were identified in 11-12% more infants and children with…

Continue Reading Comparison of CNV analysis methods: Array CGH vs NGS

Exact Sciences hiring Director, Bioinformatics in San Diego Metropolitan Area

Summary Of Major ResponsibilitiesThe Director, Bioinformatics is self-driven, working on multiple projects that are extremely complex in scope. As a thought leader, the Director, Bioinformatics brings their knowledge and expertise to bear in planning, design, and execution to ensure successful and timely completion of large or complex projects. The Director,…

Continue Reading Exact Sciences hiring Director, Bioinformatics in San Diego Metropolitan Area

Associate Director, Bioinformatics Job Opening in Wilmington, DE at Incyte Corporation

Incyte is a biopharmaceutical company focused on the discovery, development, and commercialization of novel medicines to meet serious unmet medical needs in oncology and inflammation and autoimmunity. Incyte is committed to the rigorous pursuit of research and development excellence to improve the lives of patients, make a difference in health…

Continue Reading Associate Director, Bioinformatics Job Opening in Wilmington, DE at Incyte Corporation

Addgene: pEJS1096 Dual-sgRNA.Design 1 Sequences

> Addgene NGS Result CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGG CCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCTCTA GAGTTTAAACAAAAAAATAAACGATGCCCCTTAAAGCAGAAGCTTTAAGGGGCAGAGCGTTGCGGCACAT CTTTTCAGACGGCCTTATTGTAGCAACGTTTCGGGAGCTACAACTGAAGAGCTGGAATGCTCTTCCGGTG TTTCGTCCTTTCCACAAGATATATAAAGCCAAGAAATCGAAATACTTTCAAGTTACGGTAAGCATATGAT AGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAATTATTACTTTCTACGTCACGTATT TTGTACTAATATCTTTGTGTTTACAGTCAAATTAATTCTAATTATCTCTCTAACAGCCTTGTATCGTATA TGCAAATATGAAGGAATCATGGGAAATAGGCCCTCTTCCTGCCCGACCTTGACGGGTAGTGTTTAAACAA AAAAATAAACGATGCCCCTTAAAGCAGAAGCTTTAAGGGGCAGAGCGTTGCGGCACATCTTTTCAGACGG CCTTATTGTAGCAACGTTTCGGGAGCTACAACTGAGACGTGGAATCGTCTCCGGTGTTTCGTCCTTTCCA CAAGATATATAAAGCCAAGAAATCGAAATACTTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAA CATAATTTTAAAACTGCAAACTACCCAAGAAATTATTACTTTCTACGTCACGTATTTTGTACTAATATCT TTGTGTTTACAGTCAAATTAATTCTAATTATCTCTCTAACAGCCTTGTATCGTATATGCAAATATGAAGG AATCATGGGAAATAGGCCCTCATTATCCTCTAGAATGGAGGCGGTACTATGTAGATGAGAATTCAGGAGC AAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTTTTACAGTGTAGTTTTGGAAAAACTCTTAGCC TACCAATTCTTCTAAGTGTTTTAAAATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGG CTTAAATATTTACCGTAACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGCAACTC ATACTTAAGCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAACACCGCCACCATGGT GCCTAAGAAGAAGAGAAAGGTGGAAGATATGGCCGCCTTCAAGCCTAACCCAATCAATTACATCCTGGGA CTGGACATCGGAATCGCATCCGTGGGATGGGCTATGGTGGAGATCGACGAGGAGGAGAATCCTATCCGGC TGATCGATCTGGGCGTGAGAGTGTTTGAGAGGGCCGAGGTGCCAAAGACCGGCGATTCTCTGGCTATGGC CCGGAGACTGGCACGGAGCGTGAGGCGCCTGACACGGAGAAGGGCACACAGGCTGCTGAGGGCACGCCGG CTGCTGAAGAGAGAGGGCGTGCTGCAGGCAGCAGACTTCGATGAGAATGGCCTGATCAAGAGCCTGCCAA ACACCCCCTGGCAGCTGAGAGCAGCCGCCCTGGACAGGAAGCTGACACCACTGGAGTGGTCTGCCGTGCT GCTGCACCTGATCAAGCACCGCGGCTACCTGAGCCAGCGGAAGAACGAGGGAGAGACAGCAGACAAGGAG CTGGGCGCCCTGCTGAAGGGAGTGGCCAACAATGCCCACGCCCTGCAGACCGGCGATTTCAGGACACCTG CCGAGCTGGCCCTGAATAAGTTTGAGAAGGAGTCCGGCCACATCAGAAACCAGAGGGGCGACTATAGCCA CACCTTCTCCCGCAAGGATCTGCAGGCCGAGCTGATCCTGCTGTTCGAGAAGCAGAAGGAGTTTGGCAAT CCACACGTGAGCGGAGGCCTGAAGGAGGGAATCGAGACCCTGCTGATGACACAGAGGCCTGCCCTGTCCG GCGACGCAGTGCAGAAGATGCTGGGACACTGCACCTTCGAGCCTGCAGAGCCAAAGGCCGCCAAGAACAC CTACACAGCCGAGCGGTTTATCTGGCTGACAAAGCTGAACAATCTGAGAATCCTGGAGCAGGGATCCGAG AGGCCACTGACCGACACAGAGAGGGCCACCCTGATGGATGAGCCTTACCGGAAGTCTAAGCTGACATATG CCCAGGCCAGAAAGCTGCTGGGCCTGGAGGACACCGCCTTCTTTAAGGGCCTGAGATACGGCAAGGATAA TGCCGAGGCCTCCACACTGATGGAGATGAAGGCCTATCACGCCATCTCTCGCGCCCTGGAGAAGGAGGGC CTGAAGGACAAGAAGTCCCCCCTGAACCTGAGCTCCGAGCTGCAGGATGAGATCGGCACCGCCTTCTCTC TGTTTAAGACCGACGAGGATATCACAGGCCGCCTGAAGGACAGGGTGCAGCCTGAGATCCTGGAGGCCCT GCTGAAGCACATCTCTTTCGATAAGTTTGTGCAGATCAGCCTGAAGGCCCTGAGAAGGATCGTGCCACTG ATGGAGCAGGGCAAGCGGTACGACGAGGCCTGCGCCGAGATCTACGGCGATCACTATGGCAAGAAGAACA CAGAGGAGAAGATCTATCTGCCCCCTATCCCTGCCGACGAGATCAGAAATCCTGTGGTGCTGAGGGCCCT GTCCCAGGCAAGAAAAGTGATCAACGGAGTGGTGCGCCGGTACGGATCTCCAGCCCGGATCCACATCGAG ACCGCCAGAGAAGTGGGCAAGAGCTTCAAGGACCGGAAGGAGATCGAGAAGAGACAGGAGGAGAATCGCA AGGATCGGGAGAAGGCCGCCGCCAAGTTTAGGGAGTACTTCCCTAACTTTGTGGGCGAGCCAAAGTCTAA GGACATCCTGAAGCTGCGCCTGTACGAGCAGCAGCACGGCAAGTGTCTGTATAGCGGCAAGGAGATCAAT CTGGTGCGGCTGAACGAGAAGGGCTATGTGGAGATCGATCACGCCCTGCCTTTCTCCAGAACCTGGGACG ATTCTTTTAACAATAAGGTGCTGGTGCTGGGCAGCGAGAACCAGAATAAGGGCAATCAGACACCATACGA GTATTTCAATGGCAAGGACAACTCCAGGGAGTGGCAGGAGTTCAAGGCCCGCGTGGAGACCTCTAGATTT…

Continue Reading Addgene: pEJS1096 Dual-sgRNA.Design 1 Sequences

Single cell RNAseq data analysis

Github repository  02-04 February 2022  SciLifeLab Solna, Tomtebodavägen 23b, Stockholm, Sweden This workshop will introduce the best practice bioinformatics methods for processing and analyses of single cell RNA-seq data via a series of online lectures and computer practicals. The total course duration is 45 hours, including the online lectures (15 hours)…

Continue Reading Single cell RNAseq data analysis

Sr. Manager of Manufacturing – Resumetojobs.com

NuProbe USA is seeking an experienced Sr. Manager, In-Vitro Diagnostics Operations who will be responsible for all aspects of manufacturing, including design transfer of newly developed products from research & development. The successful candidate will control production planning, scheduling and forecasting. The candidate will lead continuous improvements in manufacturing as…

Continue Reading Sr. Manager of Manufacturing – Resumetojobs.com

What is SNP array testing?

What is SNP array testing? The SNP array test looks for changes in specific areas of a person’s chromosomes, such as gains (duplications) or losses (deletions). These gains or losses result in extra or missing copies of genetic material. How does SNP array work? SNP array is a type of…

Continue Reading What is SNP array testing?

Postdoctoral Scholar – Bioinformatics/Biomedical Data Science

The University of Nevada, Reno (UNR) appreciates your interest in employment at our growing institution. We want your application process to go smoothly and quickly. Final applications must be submitted prior to the close of the recruitment. If you need assistance or have questions regarding the application process, please contact…

Continue Reading Postdoctoral Scholar – Bioinformatics/Biomedical Data Science

Postdoc Position in Bioinformatics in Stem Cell Neurobiology

DepartmentDepartment of Histology and Embryology  – Faculty of MedicineDeadline 28 Feb 2022Start date Jully 2022Job type full-timeJob field Science and research Medical Faculty of Masaryk University, Brno, Czech Republic, invites excellent scientists to apply for Postdoc position in Bioinformatics in Stem Cell Neurobiology   Description: The Department of Histology and Embryology is…

Continue Reading Postdoc Position in Bioinformatics in Stem Cell Neurobiology

New bioinformatics method to analyze viral sgRNA

Single guide ribonucleic acid (sgRNA) molecules are produced by discontinuous transcription, in which viral RNA-dependant RNA polymerase pauses early negative-sense RNA synthesis and then jumps to the other end of the genome. The specifics of this process are still not fully understood. Since sgRNAs can play an important role in…

Continue Reading New bioinformatics method to analyze viral sgRNA

Postdoc Position in Bioinformatics in Stem Cell Neurobiology job with MASARYK UNIVERSITY

Department Department of Histology and Embryology – Faculty of Medicine Deadline 28 Feb 2022 Start date Jully 2022 Job type full-time Job field Science and research Medical Faculty of Masaryk University, Brno, Czech Republic, invites excellent scientists to apply for Postdoc position in Bioinformatics in Stem Cell Neurobiology   Description: The Department of…

Continue Reading Postdoc Position in Bioinformatics in Stem Cell Neurobiology job with MASARYK UNIVERSITY

Clinical Bioinformatics Analyst (m/w/d) – Foundation Medicine GmbH – Biology & Life Sciences

Clinical Bioinformatics Analyst (m/w/d) PENZBERG, GERMANY Foundation Medicine is leading a transformation in cancer care, where each patient’s treatment is informed by a deep understanding of the molecular changes that contribute to their disease. As a molecular information company, we are focused on fundamentally changing the way in which patients…

Continue Reading Clinical Bioinformatics Analyst (m/w/d) – Foundation Medicine GmbH – Biology & Life Sciences

ddPCR allows 16S rRNA gene amplicon sequencing of very small DNA amounts from low-biomass samples | BMC Microbiology

1. Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML, Pace NR. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc Natl Acad Sci U S A. 1985;82(20):6955–9. PubMed  PubMed Central  CAS  Google Scholar  2. Vos M, Quince C, Pijl AS, de Hollander M, Kowalchuk GA. A…

Continue Reading ddPCR allows 16S rRNA gene amplicon sequencing of very small DNA amounts from low-biomass samples | BMC Microbiology

Bioinformatics Core Facility staff position at IMB in Mainz, Germany

www.imb.de/jobs/jobdetail/bioinformatician Bioinformatician (m/f/d) (#CFBIO17) IMB (www.imb.de) is a research centre on the campus of Mainz University, Germany. It is generously funded by the Boehringer Ingelheim Foundation and the state of Rhineland-Palatinate. Our research focuses on the biology of the cell nucleus and ranges from the molecular level to organismic, systems…

Continue Reading Bioinformatics Core Facility staff position at IMB in Mainz, Germany