Tag: NIH

Welcome to another blog post! ‍ Reference genomes are essential benchmarks of a species’ genome that facilitate the accurate comparison of individual genomes and are crucial tools for identifying genetic variants and diagnosing rare diseases. Here, we will explore the evolution of the human reference genome, focusing on the transition…

TitleSenior Bioinformatics/Data Scientist BELONG. CONNECT. GROW. with KBR. At KBR, we define the future. We are a company of innovators, thinkers, creators, explorers, volunteers, and dreamers. But we all share one goal: to improve the world responsibly and safely. KBR is seeking a Senior Data Scientist with Bioinformatics experience. The…

About the q2-jobs category 0 664 July 5, 2018 MS/PhD/Postdoc position in the Department of Biomedical Informatics at the University of Arkansas for Medical Sciences 0 166 June 7, 2023 Research Software Engineer for microbiome bioinformatics at ETH Zurich 0 406 June 7, 2023 Microbial Ecology Postdoctoral Researcher at Smithsonian,…

Researchers and data enthusiasts are invited to join the celebration by attending a series of workshops beginning Monday (Feb. 12) through Feb. 16 that will offer valuable insight and skill building for those interested in working with data. Whether you are taking the initial steps in working with data or…

The genetic sequence itself doesn’t indicate the origins of the virus that causes Covid-19. (Alissa Eckert/Dan Higgins/CDC) The genetic sequence of SARS-CoV-2, the virus that causes COVID-19, was submitted to a National Institutes of Health database two weeks before its release by the Chinese regime, according to documents that were…

Once again the timeline surrounding the COVID-19 pandemic has shifted – this time with the revelation that a researcher based in Beijing had already mapped the COVID-19 sequence two weeks before the CCP revealed its details to the world, raising questions over what other critical information China may have obscured…

About iPSCs (induced pluripotent stem cells), an inexhaustible source of functional human cells, have enormous potential for biomedical research and health care. They are being used to study genetic disease, new drug development, and treatment of a broad range of disorders — diabetes, cancer, neurological illnesses, and more. This forum…

Sen. Roger Marshall (R-Kan.) speaks on border security and Title 42 during a press conference at the U.S. Capitol in Washington on May 11, 2023. (Kevin Dietsch/Getty Images) It has been four years since patients sickened with unexplained pneumonia started appearing at hospitals in the central Chinese city of Wuhan. But…

The National Institutes of Health appears to be struggling to hide its dirty laundry on COVID-19 origins against a rash of leaks, congressional probes, and Freedom of Information Act requests, even when officials are determined to thwart sunlight. The ongoing exposure of their communications and actions isn’t the only thing…

Florida is currently home to the nation’s second-largest medical device manufacturing industry, second-largest pharmaceuticals manufacturing industry, and the fourth-largest biotech R&D industry, making it a large life sciences hub within the U.S. So, in this article, with more than 2,300 establishments operating within the Florida life sciences industry as a…

Vincerx Pharma, Inc. Investigators from the National Institutes of Health (NIH) report 2 partial responses (PR) in 3 peripheral T-cell lymphoma (PTCL) patients and 1 PR in 2 double-hit diffuse large b-cell lymphoma (DH-DLBCL) patients in ongoing dose-escalation trial of enitociclib in combination with venetoclax and prednisone Vincerx remains on…

Download: pdf | pdf ClinVar RCV Page Survey 2022 Start of Block: Default Question Block OMB Approval Info OMB Control Number: 0925-0648 Expiration Date: 06/30/2024 Public reporting burden for this collection of information is estimated to average 5 minutes per response, including the time for reviewing instructions, searching existing data…

The latest findings from five phase 3 trials on breast cancer were presented at #SABCS23, brimming with crucial insights into the progress and outcomes of these trials. These findings are not only pivotal for understanding the efficacy of new treatments but also their potential impact on patient outcomes. Recruitment for…

Pharmaceutical cell biology Uppsala University Bioinformatics computer lab Student name: 1. Sequence alignment using BLAST You are provided with a file named ‘sequences.txt‘, containing a sequence named ‘Sequence1’, extracted from a viral sample. Your task is to identify the type of virus from which this sequence originates. Visit the NCBI…

Phase 3 RESILIENT study of TNX-102 SL successfully demonstrated daily pain reduction over placebo (primary endpoint, p = 0.00005) All six key secondary endpoints, including patient global impression, fibromyalgia-specific symptoms and dysfunction, fatigue and sleep measures were significantly improved (all p ≤ 0.001) Positive results support planned New Drug Application…

  Editor’s note — the following is a roundup of the news that made headlines at Vanderbilt University Medical Center in 2023.   Whole-genome sequencing agreement Nashville Biosciences LLC, a wholly owned subsidiary of Vanderbilt University Medical Center, and Illumina Inc., a global leader in DNA sequencing and array-based technologies,…

Phase 3 RESILIENT study of TNX-102 SL successfully demonstrated daily pain reduction over placebo (primary endpoint, p = 0.00005) All six key secondary endpoints, including patient global impression, fibromyalgia-specific symptoms and dysfunction, fatigue and sleep measures were significantly improved (all p ≤ 0.001) Positive results support planned New Drug Application…

Tool:Dot_plot_like_in_BLAST, a standalone tool for making dot plots similar to what online BLAST makes 0 The online BLAST (blast.ncbi.nlm.nih.gov) makes dot plots which look like this: Unfortunately, the standalone BLAST lacks the capability of making dot plots. I have made a tool, named Dot_plot_like_in_BLAST, specifically for this purpose. Basically, it…

The Biostar Herald publishes user submitted links of bioinformatics relevance. It aims to provide a summary of interesting and relevant information you may have missed. You too can submit links here. This edition of the Herald was brought to you by contribution from Mensur Dlakic, Istvan Albert, and was edited…

Introduction The incidence and mortality rates of AF are continuously increasing, leading to serious complications such as heart failure and stroke (Fig. 1) (Sagris et al., 2021). The occurrence and development of AF involve different mechanisms and interactions (Kornej et al., 2020). AF often progresses from paroxysmal to persistent (Nattel…

Chromosome 4 is the fourth largest of the 23 pairs of chromosomes in humans. Chromosome 4 is made up of over 186 million base pairs, the building blocks of DNA which are tightly packed and super coiled to from the DNA helix. Chromosome 4 represents around 6% to 6.5% of…

Introduction Sepsis is one of the major diseases that poses a serious threat to human health, and its incidence and in-hospital mortality rates remain high despite the continuous updating of sepsis guidelines.1 Its main clinical manifestations are elevated body temperature, chills, and rapid heart rate, and it is most common…

Alston JM, Sambucci O. Grapes in the world economy. In: Cantu D, Walker MA, editors. The grape genome. Springer International Publishing; 2019. p. 1–24. Google Scholar  Rahemi A, Dodson Peterson JC, Lund KT. Grape rootstocks and related species. Cham: Springer International Publishing; 2022. Walker MA, Heinitz C, Riaz S, Uretsky…

Whole Person Benefit Packages | Relocation Assistance | Research Incentive Plans The Department of Biostatistics and Bioinformatics at Moffitt Cancer Center (MCC), a National Cancer Institute-designated Comprehensive Cancer Center, is seeking a faculty member in the tenure-earning rank of Senior Member (Full Professor equivalent) to be the Chair of the…

Researchers at the National Institutes of Health have published an atlas of zebrafish development, detailing the gene expression programs that are activated within nearly every cell type during the first five days of development, a period in which embryos mature from a single cell into distinct cell types. These diverse…

Description This version is to stay up to date with the improvements and increase in 16S rRNA gene sequences (SSU) added to the GTDB release 214.1.  Please read this post for the stats on the updates. gtdb.ecogenomic.org/stats/r214 . There has been no change to the RDP-RefSeq reference database If anyone…

image:  Zebrafish are model organisms for studying early development. view more  Credit: J. Swan and K. Tabor, NICHD/NIH Researchers at the National Institutes of Health have published an atlas of zebrafish development, detailing the gene expression programs that are activated within nearly every cell type during the first five days…

Dec. 17—Researchers at the National Institutes of Health have mapped the 3D organization of genetic material of key developmental stages of human retinal formation, using intricate models of a retina grown in the lab. The findings lay a foundation for understanding clinical traits in many eye diseases, and reveal a…

First Wave BioPharma, Inc., (NASDAQ: FWBI), (“First Wave BioPharma” or the “Company”), a clinical-stage biopharmaceutical company specializing in the development of targeted, non-systemic therapies for gastrointestinal (GI) diseases, today announced that the company has signed a non-binding term sheet for a business combination with ImmunogenX, a clinical-stage biotherapeutics company developing…

Want to stay on top of the science and politics driving biotech today? Sign up to get our biotech newsletter in your inbox. Today, we see a small biotech on the verge of ending a rare-disease program thanks to FDA difficulties  — and how that impacts patients. We fete the best of…

There’s an air of cautious optimism about 2024, after a difficult few years following the end of the pandemic when investment in pharma and biotech research dropped substantially. After this significant reset, there’s now hope that in 2024, in line with emerging trends, the funds will be there for the…

Summary:Metagenomics, the study of entire microbial communities using genetic sequencing, has gained significant attention in recent years, especially in the LAMEA region (Latin America, Middle East, and Africa). This article explores the fascinating convergence of LAMEA metagenomics and modern technology, highlighting the advancements, challenges, and potential implications for various industries….

Phase 3-ready latiglutenase, a targeted oral biotherapeutic for celiac disease, will expand First Wave BioPharma’s late-stage gastrointestinal (GI) disease clinical pipeline A concurrent institutional investment and a strategic U.S. license agreement with a global pharmaceutical company is anticipated to be completed post-closing BOCA RATON, Fla., Dec. 18, 2023 (GLOBE NEWSWIRE)…

Introduction The Infant Gut Microbiome Untangling what constitutes a healthy gut microbiome is timely, particularly in low- and middle-income (LMIC) settings where problems of infant nutrition, chronic diarrhea, and failure to thrive are high priority.1,2 Studying the infant gut microbiome is also crucial as many of the events capable of…

Researchers at the National Institutes of Health have mapped the 3D organization of the genetic material of the key developmental stages of human retina formation using complex models of the retina grown in the laboratory. The findings lay the foundation for understanding clinical symptoms in many eye diseases, and reveal…

. 2023 Dec 15;133(24):e176406. doi: 10.1172/JCI176406. Affiliations Expand Affiliations 1 Miller School of Medicine, Department of Neurological Surgery, University of Miami, Coral Gables, Florida, USA. 2 National Institute of Neurological Disorders and Stroke, NIH, Bethesda, Maryland, USA. Item in Clipboard Vaidya Govindarajan et al. J Clin Invest. 2023. Show details Display…

GenomeConnect is an online registry designed by the NIH-funded Clinical Genome Resource (ClinGen) for people who are interested in sharing de-identified genetic and health information to improve our understanding of the relationship between genes and human health. Investigators at Geisinger are helping to lead this initiative and invite you to…

Boyi Yu,1– 4 Xuanyi Lu,5 Xianglong Feng,1– 4 Ting Zhao,1– 4 Jiaxin Li,1– 4 Yudie Lu,5 Fei Ye,1– 4 Xiongxiong Liu,1– 4 Xiaogang Zheng,1– 4 Zheyu Shen,5 Xiaodong Jin,1– 4 Weiqiang Chen,1– 4 Qiang Li1– 4 1Biomedical Center, Institute of Modern Physics, Chinese Academy of Sciences, Lanzhou, People’s Republic of…

The National Institutes of Health (NIH) has awarded the Wadsworth Center Health Exposure Analysis Research (HHEAR) laboratory hub $2.4 million to continue studies of the exposome. Exposome studies focus on the totality of human environmental exposures such as chemical and biological exposure to better understand connections between environmental factors and…

image:  LoGoFunc identifies harmful (left) and harmless (right) genetic variations in the Vasopressin V2 receptor protein using a structure predicted by AlphaFold2. This helps explain how genetic changes affect proteins. view more  Credit: Stein et al., Genome Medicine New York, NY [December 14, 2023]—In a novel study, researchers from the…

After six years of exhilarating exploration and the analysis of a whopping 32 million cells, a scientific feat has been unleashed: the unveiling of the very first dazzling, comprehensive cellular map of a mammalian brain! Today, the meticulous mapping of the detailed brain anatomy of the adult mouse was on…

Installation: Tax4Fun2 package are not found and github repository is not maintained anymore 5 Hi everyone! I have tried to find the R package Tax4Fun2 from the paper (pubmed.ncbi.nlm.nih.gov/33902725/) . This R package lets analizes the microbiome in an easy way to predict functional profiles from metagenomic 16S rRNA data….

Mouse breeding and husbandry All experimental procedures related to the use of mice were approved by the Institutional Animal Care and Use Committee of the AIBS, in accordance with NIH guidelines. Mice were housed in a room with temperature (21–22 °C) and humidity (40–51%) control within the vivarium of the AIBS…

‘Country’ will transition to ‘Geographic Location’ effective June 2024 As announced earlier this year, we will begin to systematically gather ‘location of collection’ and ‘date and time of collection’ for sequence data submitted to GenBank and the Sequence Read Archive (SRA). As part of this effort and to make location data more accurate and informative,…

Researchers at the National Institutes of Health have mapped the 3D organization of genetic material of key developmental stages of human retinal formation, using intricate models of a retina grown in the lab. The findings lay a foundation for understanding clinical traits in many eye diseases, and reveal a highly…

Exercise 1:Finding an unknown gene. Your supervisor has conducted a PCR experiment and given you an unknown sequence for analysis. The sequence is as below: >Unknown_sequence_1 AAATGAGTTAATAGAATCTTTACAAATAAGAATATACACTTCTGCTTAGGATGATAATTG GAGGCAAGTGAATCCTGAGCGTGATTTGATAATGACCTAATAATGATGGGTTTTATTT CCAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAAT TAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCAC CATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCA TCAAAGCATGCCAACTAGAAGAGGTAAGAAACTATGTGAAAACTTTTTGATTATGCAT ATGAACCCTTCACACTACCCAAATTATATATTTGGCTCCATATTCAATCGGTTAGTCTA CATATATTTATGTTTCCTCTATGGGTAAGCTACTGTGAATGGATCAATTAATAAAACACA TGACCTATGCTTTAAGAAGCTTGCAAACACATGAA Guidelines to conduct sequence analysis 1. Navigate to the main BLAST page (blast.ncbi.nlm.nih.gov/Blast.cgi) 2. Select…

Cohorts Saliva and/or blood samples were collected from consenting individuals among four NCIG-partnered communities: Tiwi Islands (comprising the Wurrumiyanga, Pirlangimpi and Millikapiti communities), Galiwin’ku, Titjikala and Yarrabah, between 2015 and 2019. Non-Indigenous comparison data, generated from unrelated Australian individuals of European ancestry, was drawn from two existing biomedical research cohorts:…

Putnam, N. H. et al. Sea anemone genome reveals ancestral eumetazoan gene repertoire and genomic organization. Science 317, 86–94 (2007). Article  ADS  CAS  PubMed  Google Scholar  Chapman, J. A. et al. The dynamic genome of Hydra. Nature 464, 592–596 (2010). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  Srivastava, M….

Understanding nanomedicinesNanomedicine in hepatic fibrosis diagnosisNanomedicine in hepatic fibrosis treatmentNanomedicine in drug delivery  Nanomedicine in targeted drug delivery  Future perspectivesReferencesFurther reading Hepatic fibrosis is an abnormal wound-healing response triggered by chronic liver diseases, including non-alcoholic fatty liver disease, viral or alcoholic hepatitis, and Wilson’s disease. The response is characterized by…

How to query NCBI to extract Virus fasta files using BioPython? 1 Hi ! I want to extract the genome fasta files of 30 samples automatically using python script from here www.ncbi.nlm.nih.gov/genomes/GenomesGroup.cgi?taxid=10239&host=bacteria. I want the virusus that have has host bacteria and I am using BioPython Package. Entrez.email = “mail”…

Microbial Gene Editing Services Industry The global microbial gene editing services industry demand is projected to be worth US$ 5.35 billion globally in 2022 and to increase at a CAGR of 19% to US$ 30.5 billion globally from 2022 to 2032. A technique called microbial gene editing allows for the…

Introduction Reproxalap, a novel chemical entity in late-stage clinical development for the treatment of ocular inflammation, chemically sequesters a class of small molecules known as reactive aldehyde species (RASP). Via covalent binding to amine and thiol residues, RASP modulate the structure and function of proteins in an analog manner1 depending…

  Filing marks first NDA submission for any psychedelic-assisted therapy  Submission represents 30 plus years of clinical research into potential use of MDMA-assisted therapy for PTSD NDA includes two Phase 3 trials (MAPP1 and MAPP2) that both met primary and secondary endpoints …

Abstract EDEM2 plays an important role as the first enzyme that acts during mannose trimming of N-glycosylated proteins in the ERAD machinery. Although EDEM2 expression has been reported to be transcriptionally regulated by the IRE1-sXBP1 pathway, very little is known about how endogenous EDEM2 protein expression is regulated. In this…

The Center for Vaccine Development and Global Health (CVD) and the Institute for Genome Sciences (IGS) at the University of Maryland School of Medicine (UMSOM) seek applications for a faculty member with expertise in systems/computational biology and/or bioinformatics and demonstrated knowledge of the application of multiple omics-based approaches to immunology,…

Hello Biostars, I am looking for some guidance on how to merge some files for my rna-bulk sequencing analysis. Let me start by describing the problem: I recieved an mRNA sequence of 4775 characters which I would like to merge with the human reference genome that I download from NCBI…

Lichtenstein P, Yip BH, Bjork C, Pawitan Y, Cannon TD, Sullivan PF, Hultman CM. Common genetic determinants of schizophrenia and bipolar disorder in Swedish families: a population-based study. Lancet. 2009;373(9659):234–9. Article  PubMed  Google Scholar  Maurano MT, Humbert R, Rynes E, Thurman RE, Haugen E, Wang H, Reynolds AP, Sandstrom R,…

Brooks is a rare diseases researcher. Pritchett Clay is a researcher and chemist, and advocate for diversity in STEM. On Friday, the FDA approved two gene therapies to treat patients with sickle cell disease (SCD). One of the therapies, called exagamglogene autotemcel (Casgevy), is the first FDA-approved gene therapy utilizing…

Virani, S. S. et al. Heart disease and stroke statistics-2021 update: a report from the American Heart Association. Circulation 143, e254–e743 (2021). Article  PubMed  Google Scholar  Nauffal, V. et al. Genetics of myocardial interstitial fibrosis in the human heart and association with disease. Nat. Genet. 55, 777–786 (2023). Article  CAS …

50 How many CRISPR systems are there? Probably thousands. And for the most part they can be detected by scanning large quantities of data on the genomes of bacteria considered “rare”, such as those collected in breweries or in the waters of Antarctic lakes. This is illustrated by the authors…

Broaden your search Refine your search Sign up for job alerts Get new jobs for this search by email Found 1 Postdoc job The Delft Technology Fellowship offers high-profile positions to outstanding female academic researchers…

Postdoctoral Position in Genomics: The Tcheandjieu Lab at the Gladstone Institutes/UCSF is inviting applications for a Postdoctoral position in Genomics. This role offers an exciting opportunity to work on diverse biobanks, utilizing genomic and multi-omic approaches to enhance our understanding of cardiovascular diseases. Located in the heart of Silicon Valley,…

Details Posted: 08-Dec-23 Location: Seattle, Washington Type: Full-time Salary: Open Overview Fred Hutchinson Cancer Center is an independent, nonprofit organization providing adult cancer treatment and groundbreaking research focused on cancer and infectious diseases. Based in Seattle, Fred Hutch is the only National Cancer Institute-designated cancer center in Washington. With a…

DOI: 10.18129/B9.bioc.IFAA   This is the development version of IFAA; for the stable release version, see IFAA. Robust Inference for Absolute Abundance in Microbiome Analysis Bioconductor version: Development (3.19) This package offers a robust approach to make inference on the association of covariates with the absolute abundance (AA) of microbiome…

December 7, 2023 Lindsey O’Brien and Victor Hernandez Elizarraga, UMGC Innovation Lab scientists Zebra mussels are a damaging invasive species that are spreading throughout the lakes and rivers of Minnesota and beyond. The UMGC Innovation Lab is building on previous work sequencing the zebra mussel genome and working to develop…

Obesity has been a heated topic in recent years, as the statistics suggest that it is the world’s leading cause of death, brought on by the likes of diabetes, heart disease, stroke, and possible cancers. Naturally, so much money is being invested in this research area to tame the risk…

Given files genes.bed and snps.bed, you could do something like: $ bedmap –echo –echo-map-id –delim ‘\t’ genes.bed snps.bed > answer.bed The file answer.bed will contain the gene annotation and a semi-colon delimited list of SNP identifiers that overlap each gene. In order to get genes.bed, you could use Gencode v44…

Introduction With nearly 2 million new cases and 1 million deaths worldwide in 2020, colorectal cancer is the third-most common cancer and the second leading cause of cancer-related deaths.1 According to data from the US Surveillance, Epidemiology and End Results program and the National Program of Cancer Registries program, the…

Kaiyuan Zhang,1,* Ziyue Luo,1,* Xinchao Zhu,1 Xinyi Yao,1 Dingqi Lu,2 Liying Chen,1 Tao Hong,1 Yating Ren,1 Xinchang Wang3 1Second Clinical Medical College, Zhejiang Chinese Medical University, Hangzhou, Zhejiang Province, 310053, People’s Republic of China; 2First Clinical Medical College, Zhejiang Chinese Medical University, Hangzhou, Zhejiang Province, 310053, People’s Republic of China;…

Body: Hello, Biostars Community, I am working on creating a custom database of variants using the VCF from the latest dbSNP alpha release available at ftp.ncbi.nih.gov/snp/population_frequency/latest_release/. I have encountered a couple of issues that I’m hoping someone might help me resolve. Firstly, the chromosome encoding uses RefSeq IDs (e.g., NC_000007.12)…

datasets download genome accession –inputfile accessions.txt –include gff3,gbff,rna,cds,protein,genome,seq-report Or you simply specify mutliple accessions on the commandline: datasets download genome accession GCF_000001405.40 GCA_003774525.2 GCA_000001635 Edit: Sorry, I overlooked the –inputfile option. This is necessary unless all accessions are from a common taxon or bioproject. In the first case you can…

Enzyme commission number in ncbi Gene database 0 In the browser of www.ncbi.nlm.nih.gov/gene when looking at a gene or gene product, in the section “General protein information”, we can find the EC number. However i am not sure how to find it in the FTP available. Which source file would…

The Electroporation Instruments Market is estimated for 2023 for the forecast period 2023-2030, as highlighted in a new report published by Coherent Market Insights. Market Overview: Electroporation instruments are lab equipment used for transfection of cells through application of brief electrical pulses. They are widely utilized in biological research and…

Posted by flickaj on Monday, December 4, 2023 in featured. By: Sarah Ward Evolutionary Studies graduate communications assistant Picture a thriving marine environment. Perhaps you envision a community as colorful and lively as “Finding Nemo,” where massive schools of fish are flanked by sharks and sea turtles. What about sponges?…

Details Posted: 04-Dec-23 Location: Birmingham, Alabama Salary: Open Categories: Academic/Faculty Medical – Research Position Number: 01008 School/College: School of Medicine Job Description: THE OPPORTUNITY The University of Alabama at Birmingham (UAB) Department of Neurology is recruiting an investigator with expertise using human induced pluripotent cells (iPSCs) in Alzheimer’s disease research….

4 Fastq files for a single run generated by 10X 0 Hello, I have a question about the 10X generated Fastq files. As I know 10X platforms can generate up to 4 Fastq files as R1, R2, I1 and I2. I need to use Fastq files and align them with…

We are seeking a highly motivated bioinformatician to join the Institute on the Biology of Aging and Metabolism (iBAM) and the Department of Genetics, Cell Biology, and Development at the University of Minnesota. Aging is a natural process throughout an entire life course. Focusing on health and well-being, in…

A novel collection of genomes from Cabinda, Angola and Maputo, Mozambique Genomic DNA was extracted using saliva samples collected with informed consent and sequenced using the Illumina HiSeq X™ platform to an average autosomal read depth of ~12X from 300 individuals sampled in Cabinda and 50 individuals sampled in Maputo…

Product Details Description: Anti-XRCC1 (CHICKEN) Antibody – 200-901-MG5 Synonyms: Chicken Anti-X-Ray Repair Cross Complementing 1 Antibody, X-Ray Repair Complementing Defective Repair In Chinese Hamster Cells 1, X-Ray Repair Cross-Complementing Protein 1, DNA Repair Protein XRCC1, SCAR26, RCC Host Species: Chicken Clonality: Polyclonal Format: IgY Target Details Gene Name: XRCC1  – View…

Broaden your search Refine your search Sign up for job alerts Get new jobs for this search by email Found 1 Faculty job Invites applications for a tenure track/ tenured faculty position at the level…

Plant material Five alfalfa plants (stems and leaves) were sampled from each of the four different fields, 10–15 acres in size, located in Yuma Country, Arizona, USA. Geographic coordinates of the alfalfa fields and the adjacent crops are shown in Table 1. Table 1 Geographic locations of alfalfa fields Total…

J Chem Inf Model. Author manuscript; available in PMC 2023 Nov 28. Published in final edited form as: PMCID: PMC10683950 NIHMSID: NIHMS1947068 Jerome Eberhardt aDepartment of Integrative Structural and Computational Biology, Scripps Research, La Jolla, 92037, California, USA Diogo Santos-Martins aDepartment of Integrative Structural and Computational Biology, Scripps Research, La…

Introduction Oxford Nanopore Technologies (ONT) direct RNA sequencing (Fig 1A) enables detection of RNA modifications. A modified base produces an altered electrical current and/or dwell time relative to a canonical base that can be detected with algorithms (Garalde et al, 2018; Smith et al, 2019; Workman et al, 2019). Figure…

Job description A Bioinformatics/Computational biology postdoc position focusing on single or spatial proteogenomics is available in Dr. Chunchao Zhang laboratory at Children’s National Hospital and George Washington University School of Medicine and Health Sciences in Washington, DC. The majority of my research is geared towards interpretation and integration of different…

Introduction In the US, dietary supplements (DS) are not subject to pre-market approval for safety and efficacy by the FDA.1 Post-market surveillance by the FDA has found increasing numbers of supplements to be adulterated or tainted, meaning that they contain undeclared or hidden, unapproved drug ingredients.2,3 These hidden ingredients have…

Image: Siarhei/Adobe Stock eWEEK content and product recommendations are editorially independent. We may make money when you click on links to our partners. Learn More. Neural network software enables the implementation, deployment and training of artificial neural networks. These networks are designed to mimic the behavior of the human brain…

Made with DALL-E 3 Picture a world where expectant parents sit down at a computer screen, and much like a character creator in a video game, design their child. They can modify physical appearance, intelligence, athleticism, and even personality. In this not-so-distant future, gene editing technology may very well transform…

What exactly were the violations at the fifteen sites and how if any way did they affect the results?Some of this seems to backward lookings thinking. When patients showed improvement in the blinded data, the assumption was that they must all be on the drug. But there are other drug…

Postdoctoral Research Associate in Bioinformatics The Department of Physiology and Biophysics at the University of Illinois Chicago is offering a postdoctoral position in the laboratory of Dr. Alexandra Naba. Dr. Naba’s research, supported by NIH HuBMAP funding, focuses on deciphering the roles of the extracellular matrix (ECM) in development, health,…

Introduction Thiopurine S-methyltransferase (TPMT) is a cytoplasmic enzyme that catalyzes the S-methylation of purine analogs, including azathioprine, 6-mercaptopurine (6-MP), and thioguanine.1 The metabolism of these drugs results in two types of metabolites: S-methylmercaptopurine and S-methylthioguanine, which are generally described as inactive metabolites, and S-methyl-thioinosine monophosphate, an inhibitor of de novo…

In order to support the inclusion of submitted somatic variation data, we are updating the ClinVar website. In early 2024, you will begin to see some changes. What will change? Variant (VCV) record pages will have an updated look and feel: Simpler layout with no tabs New sections will display…

Introduction During each heartbeat, the intracellular calcium concentration ([Ca2+]i) cycles dynamically between low resting diastolic and high active systolic levels within cardiomyocytes (Bers, 2002; Eisner et al, 2017; Sankaranarayanan et al, 2017): upon electrical excitation, Ca2+ influx via voltage-gated CaV1.2 channels activates Ca2+-induced Ca2+ release via SR ryanodine receptor type…

SEATTLE, Nov. 28, 2023 /PRNewswire/ — Orlance, Inc., a Seattle biotech developing next-generation DNA and RNA vaccines and therapeutics, has been awarded a National Institutes of Health (NIH) Phase I Small Business Innovation Research (SBIR) grant to use its needle-free MACH-1™ platform for creating a vaccine regimen that induces strong…

A. Bioinformatics analyzes Search strategy and study selection From April to June 2021, we read relevant and related publications in Medline, EMBASE, Web of Science, and Wanfang. The search term “NOX4” have been used. The articles that fit specified criteria were all added at once: (1) Participants were split into…

CRISPR has a problem: an embarrassment of riches. Ever since the gene editing system rocketed to fame, scientists have been looking for variants with better precision and accuracy. One search method screens for genes related to CRISPR-Cas9 in the DNA of bacteria and other creatures. Another artificially evolves CRISPR components…

The Biostar Herald publishes user submitted links of bioinformatics relevance. It aims to provide a summary of interesting and relevant information you may have missed. You too can submit links here. This edition of the Herald was brought to you by contribution from Istvan Albert, and was edited by Istvan…

SAN FRANCISCO—November 27, 2023—The gene-editing technology CRISPR shows early promise as a therapeutic strategy for the aggressive and difficult-to-treat brain cancer known as primary glioblastoma, according to findings of a new study from Gladstone Institutes. Using a novel technique they’ve dubbed “cancer shredding,” the researchers programmed CRISPR to zero-in on…

CRISPR systems are powerful tools for genetic engineering, but they have their limitations. Now, scientists have discovered almost 200 new CRISPR systems in their native habitat of bacteria, and found that some can edit human cells even more precisely than existing ones. The CRISPR-Cas9 gene-editing tool is one of the…

Hi Biostars, I am currently trying to build a Eukaryote version of the NCBI NR database and I am not really sure that I fully understand how the NR is implemented. Here is the code that I’m using to do so : #!/usr/bin/bash ############## # DOWNLOAD FULL NR ############## baseURL=”https://ftp.ncbi.nlm.nih.gov/blast/db/”…

The model combines a non-contrast computed tomography (CAT) scan with an AI algorithm. In a paper published by the peer-reviewed journal Nature Medicine on Monday, the team said the specificity of the early screening model reached 99.9 per cent, implying there is only one false-positive case in every 1,000 tests….