Tag: NLS

Termy February 8, 2024, 10:59am 1 Hi there,i’m finally coming around to update to 23.05 and just want to make sure to not F* up something I want to keep TLS1.3 and thus openSSL. Of course, the image build fails if i just include libustream-openssl.It build successfully if i also…

I am interested in testing the relationship between two genes, assuming I have the activities of the two genes of interest (or proxy by transcriptomics, though I understood it is imperfect). More specifically, I have around 50 data points (randomly sampled, which can be deemed as sampling at different time…

Analysis of the multisegmented nature of BcssDV1 genome B. cinerea field isolates were previously obtained from infected grapes of vineyards of Italy and Spain and their mycovirome was determined [8]. A new ssDNA virus (BcssDV1, Genbank accession no. MN625247) was discovered and characterized. The sequence previously characterized of BcssDV1 (from…

mitoARCUS localizes to the mitochondrial matrix To evaluate the ability of mitoARCUS to specifically cleave m.3243G mutant mtDNA, cell lines containing varying levels of the mutation were generated. All of these cell lines were isolated from the same parental m.3243A>G cybrid cell line. Levels of the m.3243G mutation of each…

So, your goal is to estimate only the parameters � a and FM FM in the regression model. The simplified regression model focuses only on these two parameters: tan(δ) = (a*ΔF/(2F1+FM+ΔF)) Your data table contains observations for δ,F1, and DF. Using these observations, you want to estimate the optimal values…

Description High Efficiency Electroporation– Deliver to hard to transfect cell lines and primary cells Compatible with Most Conventional Electroporation Devices – Use your existing system including the Ingenio® EZporator®, Lonza-Amaxa®, Bio-Rad® or Harvard BTX® Save Money and Reduce Research Costs Without Sacrificing Performance – Ingenio® Electroporation Solution is available as a stand-alone solution or…

Concentrating on ataxin-2 with RfxCas13d Due to its potential to affect TDP-43-associated toxicity20,25,26, ataxin-2 has emerged as a doubtlessly broadly relevant goal for ALS-FTD, as TDP-43 pathology is noticed in ~97% of ALS instances1,4,5 and ~45% FTD occurrences1,2,4. Given this, we sought to find out if RNA-targeting CRISPR effector proteins…

library(minpack.lm) E=matrix(0,7,1) f1 =function(x){ a=x[1] b=x[2] c=x[3] # Apr # Q = (a*DA^b)*(RF^c) E[1,1]=4.4-a*1118.98^b*60.55^c E[2,1]=1.4-a*115^b*46.99^c E[3,1]=0.3-a*414.49^b*69.03^c E[4,1]=1-a*103.83^b*52.87^c E[5,1]=0.6-a*760.23^b*69.99^c E[6,1]=2.1-a*2199.16^b*70.35^c E[7,1]=5.3-a*5089^b*70.65^c D=E return(D) } Q1 =nls.lm(par =c(0,0,0),lower =c(0,0,0),fn = f1)# aba >0 Q2 =nls.lm(par =c(0,0,0),fn = f1) #unbound Q2[1] i try to derive final coefficient by Generalized Least Square regression in…

Strong correlation exists between recombination rate and abundance and proportion of indels Whole-genome sequence data of many C. elegans wild isolates now exist. These include Illumina paired-end data of over 600 wild isolates by CeNDR, which also obtained first-generation PacBio long-read data of 14 wild isolates. Second-generation PacBio HiFi data20…

EnGen® Lba Cas12a from Lachnospiraceae bacterium ND2006 is a site-specific DNA endonuclease guided by a single 41-44 nucleotide guide RNA (gRNA) (1). Targeting requires a gRNA complementary to the target site as well as a 5’ TTTV protospacer adjacent motif (PAM) on the DNA strand opposite the target sequence. Cleavage…

You will need the following materials: 1. Purified Cas9-NLS protein, 40 µM in 1x Cas9 buffer 2. Purified sgRNA from in vitro transcription, >48 µM or synthetic 3. Single-stranded DNA HDR donor, 100 µM (as an IDT Ultramer) (optional) 4. Lonza 4D Nucleofector with X Unit 5. Lonza kit: electroporation…

Morphological observation of continuous in vitro cultured B. gibsoni (Wuhan isolate) Babesia gibsoni was successfully cultured in vitro in 20% serum. After splitting, parasitemia reached 10% ± 1.5% on day 3 (Fig. 1A). Fig. 1 Changes in parasitemia and morphology of in vitro cultured B. gibsoni (Wuhan isolate). A Changes in parasitemia of…

Two rare variations of KIF1C were identified by WES and RNA-seq Eighteen PBMCs samples and sixteen myxoma tissue samples were included in the research. A flowchart showing the experimental design, sample details, and distribution of variations is shown in Fig. 1a. Sanger sequencing for the exons of PRKAR1A was carried out…

Recent research has revealed that in addition to RNA, COVID vaccines also contain DNA fragments, which should not be present and indicate a contamination problem. This discovery has also exposed the proprietary blueprint for RNA production. Microbiologist Kevin McKernan and his team have identified SV40 promoters in the bivalent mRNA…

NLS Pharmaceutics Ltd. announced that the U.S. Food and Drug Administration (FDA) has reviewed the full protocol for the NLS-1031 study, part of the Phase 3 program for Mazindol ER, called AMAZE. In addition, the Company announced that the Phase 3 clinical trial protocol to evaluate the safety and efficacy…

On July 3, 2023, NLS Pharmaceutics announced that it has received the green light from the FDA and IRB to commence the Phase 3 Clinical Program for Mazindol ER, a potential breakthrough treatment for narcolepsy. This exciting development marks a significant milestone in the company’s journey towards addressing this debilitating…

ZÜRICH, SWITZERLAND / ACCESSWIRE / July 3, 2023 / NLS Pharmaceutics Ltd. (Nasdaq:NLSP)(Nasdaq:NLSPW) (“NLS” or the “Company”), a Swiss clinical-stage biopharmaceutical company focused on the discovery and development of innovative therapies for patients with rare and complex central nervous system disorders, today announced that the U.S. Food and Drug Administration…

Plasmid construction For U6+27 gRNA-expressing constructs, the DNA sequences including the hU6+27 promoter, a gRNA scaffold, and a gRNA insert site were synthesized and cloned into the pBluSKM vector. For Pre gRNA-expressing constructs, a second gRNA scaffold was inserted downstream of the gRNA insert site in the U6+27 gRNA-expressing constructs….

Members of Executive Leadership Team to Discuss initiation of Phase 3, Pipeline updates, Key Financials, Corporate Development, and the other topics NLS to Webcast its Event Friday, June 30 at 11:00am ET ZURICH, SWITZERLAND / ACCESSWIRE / June 19, 2023 / NLS Pharmaceutics Ltd. (Nasdaq: NLSP, NLSPW)…

peopleimages.com/AdobeStock New positive data was recently released from 5 in vitro studies investigating the potential for drug-drug interaction (DDI) of mazindol, which is a triple monoamine reuptake inhibitor and partial orexin-2 agonist, as well as its hydrolyzed metabolite (M6).1 Mazindol ER is in the process of development for the treatment…

Zell R. Global climate change and the emergence/re-emergence of infectious diseases. Int J Med Microbiol IJMM. 2004;293:16–26. PubMed  Google Scholar  Gage KL, Burkot TR, Eisen RJ, Hayes EB. Climate and vectorborne diseases. Am J Prev Med. 2008;35:436–50. Article  PubMed  Google Scholar  Elbers ARW, Koenraadt CJM, Meiswinkel R. Mosquitoes and Culicoides…

Intel Xeon E5-2666 v4 testing with a Supermicro X10DRL-CT v0123456789 (3.2 BIOS) and NVIDIA GeForce GTX 1080 Ti 11GB on Ubuntu 20.04 via the Phoronix Test Suite. Compare your own system(s) to this result file with the Phoronix Test Suite by running the command: phoronix-test-suite benchmark 2306074-NE-E52666V4X88 Intel Xeon E5-2666…

Assembly of T4 artificial viral vectors T4-AVVs were assembled by sequential incorporation of purified biomaterials to generate a virus structural mimic (Fig. 2a and Supplementary Movie 1). Starting with an empty capsid shell purified from E. coli infected by the neck-minus and tail-minus T4 phage mutant (10-amber.13-amber.HocΔ.SocΔ T4) (Supplementary Fig. 1a), a pentameric…

I have a dataset www.dropbox.com/s/qemmepoq105rth2/sample_data_trasport.csv?dl=0 using code shapes <- c(5, 16, 18, 3, 15, 4, 6, 8, 17, 13, 2) trasport_time %>% filter(PM2.5 > 25) %>% ggplot(aes(x = Transport_time_hrs, y = mac_405, shape=(Fire_Name), color=(day))) + geom_point( alpha=1, size = 4)+ scale_shape_manual(values = shapes)+ xlim(0,25)+ ylim(0,1.5) + #geom_smooth(aes(group = 1),method=nls, se=F)+…

Data collection for HRD prediction model training and validation For the development of the HRD prediction model, 1854 samples (WGS data) from the pan-cancer analysis of whole genomes9 (PCAWG) and 560 breast cancer samples (SNP array data)16 are collected. To obtain a high-confidence training dataset of HRD, samples with BRCA1/2…

Overview of the isoform-specific determination of dUTPase gene expression Our aim was to determine the mRNA expression level of the dUTPase isoforms specifically. First, we investigated the Ensemble, the UniProt, and the NCBI Reference Sequences (RefSeq) databases and also took into account the Consensus CDS (CCDS) project. In the Ensemble…

Nopp140 is thought to shuttle between nucleolus and cytoplasm. However, the predominant nucleolar localization of Nopp140 homologues from different species suggests that Nopp140 is also involved in events occurring within the nucleolus. In this study, we demonstrated that the largest subunit of RNA polymerase I, RPA194, was coimmunoprecipitated with the…

On May 2, 2023, NLS Pharmaceutics announced that it has received authorization from the U.S. Food and Drug Administration (FDA) to move forward with the Phase 3 program for Quilience® (Mazindol ER), a proprietary extended-release formulation of mazindol, for the treatment of narcolepsy. The AMAZE Program will consist of two…

ZURICH, SWITZERLAND / ACCESSWIRE / May 2, 2023 / NLS Pharmaceutics Ltd. (Nasdaq:NLSP, NLSPW) (“NLS” or the “Company”), a Swiss clinical-stage biopharmaceutical company focused on the discovery and development of innovative therapies for patients with rare and complex central nervous system disorders, today announced that the U.S. Food and Drug…

NEW YORK – Aptorum Group Limited (Nasdaq: APM, Euronext Paris: APM) (‘Aptorum Group‘ or ‘Company’), today announced that its wholly owned subsidiary Aptorum Therapeutics Limited (‘ATL’) has entered into a non-binding Letter of Intent and Term Sheet to merge its 100% subsidiary, Paths Innovation Limited and its underlying business with…

NEW YORK & LONDON & PARIS, May 01, 2023–(BUSINESS WIRE)–Regulatory News: Aptorum Group Limited (Nasdaq: APM, Euronext Paris: APM) (“Aptorum Group” or “Company”), today announced that its wholly owned subsidiary Aptorum Therapeutics Limited (“ATL”) has entered into a non-binding Letter of Intent and Term Sheet (“Term Sheet”) to merge (“Transaction”)…

Plasmids LentiCRISPRv2 (Addgene; 52961) was purchased from Addgene (Cambridge, MA, USA). For HTT gene suppression, LentiCRISPR v2 plasmid with U6 promoter driving sgRNA expression and EF-1 alpha promoter driving the expression of Puromycin-T2A-HA-NLS-dCas9-NLS (or Puromycin-T2A-Flag-NLS-Cas9-NLS) was used. The sgRNA-Cas9 and sgRNA-dCas9 constructs were generated by cloning the CAG repeat-targeting sgRNA…

Chemicals Dimethyl sulfoxide (DMSO) was purchased from Sigma-Aldrich (St. Louis, MO, USA), and 5-aza-2′-deoxycytidine (5-aza-dc), trichostatin A (TSA), bisphenol A, benzo[a]pyrene (BaP), benzo[c]fluorene (BcF), and beryllium sulfate (BeSO4) were obtained from Wako Pure Chemical Industries, Ltd. (Osaka, Japan). The SCREEN-WELL Cardiotoxicity Library was purchased from Enzo LifeScience Inc. (Supplementary Table…

Transcribed image text: Explain in your own words what is going on in this R code. Provide explanations for every line of code. library(‘ggplot2’) data(‘mtcars’) ggplot(mtcars, aes(mpg, disp)) + geom_point ()+ theme_classic() + geom_text(data = subset(mtcars, mpg>30), nudge_ x=0, nudge_ y=7, check_overlap = TRUE, color = ‘green’, size =2.5, aes…

AMD Ryzen Threadripper 1950X 16-Core testing with a ASUS PRIME X399-A (1203 BIOS) and llvmpipe on Linuxmint 20.3 via the Phoronix Test Suite. Compare your own system(s) to this result file with the Phoronix Test Suite by running the command: phoronix-test-suite benchmark 2304201-NE-VAILAMMPS89 Threadripper 1950X lammps Processor: AMD Ryzen Threadripper…

> Addgene NGS Result GTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGA AAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTCCTGCAG GCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGT GAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCTCTAGACTCGA GGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATA TATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCA TTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGG AGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGA CGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGG CAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTG GATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCA CCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGT GTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTACCGGTGCCACCATGGCCCCAAAGAAGA AGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCAAGCGGAACTACATCCTGGGCCTGGACATCGGCAT CACCAGCGTGGGCTACGGCATCATCGACTACGAGACACGGGACGTGATCGATGCCGGCGTGCGGCTGTTC AAAGAGGCCAACGTGGAAAACAACGAGGGCAGGCGGAGCAAGAGAGGCGCCAGAAGGCTGAAGCGGCGGA GGCGGCATAGAATCCAGAGAGTGAAGAAGCTGCTGTTCGACTACAACCTGCTGACCGACCACAGCGAGCT GAGCGGCATCAACCCCTACGAGGCCAGAGTGAAGGGCCTGAGCCAGAAGCTGAGCGAGGAAGAGTTCTCT GCCGCCCTGCTGCACCTGGCCAAGAGAAGAGGCGTGCACAACGTGAACGAGGTGGAAGAGGACACCGGCA ACGAGCTGTCCACCAAAGAGCAGATCAGCCGGAACAGCAAGGCCCTGGAAGAGAAATACGTGGCCGAACT GCAGCTGGAACGGCTGAAGAAAGACGGCGAAGTGCGGGGCAGCATCAACAGATTCAAGACCAGCGACTAC GTGAAAGAAGCCAAACAGCTGCTGAAGGTGCAGAAGGCCTACCACCAGCTGGACCAGAGCTTCATCGACA CCTACATCGACCTGCTGGAAACCCGGCGGACCTACTATGAGGGACCTGGCGAGGGCAGCCCCTTCGGCTG GAAGGACATCAAAGAATGGTACGAGATGCTGATGGGCCACTGCACCTACTTCCCCGAGGAACTGCGGAGC GTGAAGTACGCCTACAACGCCGACCTGTACAACGCCCTGAACGACCTGAACAATCTCGTGATCACCAGGG ACGAGAACGAGAAGCTGGAATATTACGAGAAGTTCCAGATCATCGAGAACGTGTTCAAGCAGAAGAAGAA GCCCACCCTGAAGCAGATCGCCAAAGAAATCCTCGTGAACGAAGAGGATATTAAGGGCTACAGAGTGACC AGCACCGGCAAGCCCGAGTTCACCAACCTGAAGGTGTACCACGACATCAAGGACATTACCGCCCGGAAAG AGATTATTGAGAACGCCGAGCTGCTGGATCAGATTGCCAAGATCCTGACCATCTACCAGAGCAGCGAGGA CATCCAGGAAGAACTGACCAATCTGAACTCCGAGCTGACCCAGGAAGAGATCGAGCAGATCTCTAATCTG AAGGGCTATACCGGCACCCACAACCTGAGCCTGAAGGCCATCAACCTGATCCTGGACGAGCTGTGGCACA CCAACGACAACCAGATCGCTATCTTCAACCGGCTGAAGCTGGTGCCCAAGAAGGTGGACCTGTCCCAGCA GAAAGAGATCCCCACCACCCTGGTGGACGACTTCATCCTGAGCCCCGTCGTGAAGAGAAGCTTCATCCAG AGCATCAAAGTGATCAACGCCATCATCAAGAAGTACGGCCTGCCCAACGACATCATTATCGAGCTGGCCC GCGAGAAGAACTCCAAGGACGCCCAGAAAATGATCAACGAGATGCAGAAGCGGAACCGGCAGACCAACGA GCGGATCGAGGAAATCATCCGGACCACCGGCAAAGAGAACGCCAAGTACCTGATCGAGAAGATCAAGCTG CACGACATGCAGGAAGGCAAGTGCCTGTACAGCCTGGAAGCCATCCCTCTGGAAGATCTGCTGAACAACC CCTTCAACTATGAGGTGGACCACATCATCCCCAGAAGCGTGTCCTTCGACAACAGCTTCAACAACAAGGT GCTCGTGAAGCAGGAAGAAAACAGCAAGAAGGGCAACCGGACCCCATTCCAGTACCTGAGCAGCAGCGAC AGCAAGATCAGCTACGAAACCTTCAAGAAGCACATCCTGAATCTGGCCAAGGGCAAGGGCAGAATCAGCA AGACCAAGAAAGAGTATCTGCTGGAAGAACGGGACATCAACAGGTTCTCCGTGCAGAAAGACTTCATCAA CCGGAACCTGGTGGATACCAGATACGCCACCAGAGGCCTGATGAACCTGCTGCGGAGCTACTTCAGAGTG AACAACCTGGACGTGAAAGTGAAGTCCATCAATGGCGGCTTCACCAGCTTTCTGCGGCGGAAGTGGAAGT TTAAGAAAGAGCGGAACAAGGGGTACAAGCACCACGCCGAGGACGCCCTGATCATTGCCAACGCCGATTT CATCTTCAAAGAGTGGAAGAAACTGGACAAGGCCAAAAAAGTGATGGAAAACCAGATGTTCGAGGAAAAG CAGGCCGAGAGCATGCCCGAGATCGAAACCGAGCAGGAGTACAAAGAGATCTTCATCACCCCCCACCAGA…

Intel Xeon Gold 6414U testing with a Supermicro X13SET-G v1.02 and ASPEED on Ubuntu 22.04 via the Phoronix Test Suite. Compare your own system(s) to this result file with the Phoronix Test Suite by running the command: phoronix-test-suite benchmark 2301271-NE-GROMACSTE28 27 january Gromacs Processor: Intel Xeon Gold 6414U @ 2.00GHz…

Intel Xeon Gold 6414U testing with a Supermicro X13SET-G v1.02 and ASPEED on Ubuntu 22.04 via the Phoronix Test Suite. Compare your own system(s) to this result file with the Phoronix Test Suite by running the command: phoronix-test-suite benchmark 2301275-NE-LAMMPSTES54 Test 2 Processor: Intel Xeon Gold 6414U @ 2.00GHz (32…

Viral strains utilized in this work The following viral strains have been used in this study: Pandoravirus neocaledonia3, Pandoravirus macleodensis3, Pandoravirus kuranda (this study, ON887157), Mollivirus kamchatka26, Pithovirus sibericum27 and Mimivirus reunion28. Cloning of DNA constructs All primers used in this study are listed in Table S1. All vectors used in…

The Patent Trial and Appeal Board (like its predecessor, the Board of Patent Appeals and Interferences or BPAI) occasionally renders an opinion having the tendency to raise an eyebrow or two, which on occasion has led the Federal Circuit, like its predecessor the Court of Claims and Patent Appeals, to…

Screening of efficient mCherry-binding protein (MBP) pairs to design Cre recombinase dependent on RFPs First, we aimed to construct Cre recombinase dependent on RFPs based on the reported tool named Cre-DOG30. In this system, N-terminal and C-terminal split Cre recombinase fragments are fused with specific nanobodies for target proteins, and…

Introduction The clustered regularly interspaced short palindromic repeats (CRISPR)–CRISPR-associated (Cas) protein systems naturally exist in prokaryotes. They are RNA-mediated defense mechanisms to protect bacteria and archaea from invading nucleic acids (Barrangou et al., 2007). CRISPR–Cas systems are classified into two classes (1 and 2). Class 2 CRISPR–Cas require a single…

On December 3rd, Senior Party Sigma-Aldrich filed its Substantive Preliminary Motion No. 1 in Interference No. 106,133 (which names the Broad Institute, Harvard University, and MIT (collectively, Broad) as Junior Party), asking the Patent Trial and Appeal Board to deny Broad benefit of its U.S. Provisional Application No. 61/736,527, filed…

On December 3rd, Junior Party the Broad Institute, Harvard University, and MIT (collectively, Broad) filed its Contingent Preliminary Motion No. 3 in Interference No. 106,133 (which names Sigma-Aldrich as Senior Party), asking the Patent Trial and Appeal Board to designate certain claims deemed in the Declaration as corresponding to the…

On June 21st,* the Patent Trial and Appeal Board declared two new interferences involving CRISPR technology.  The first, Interference No. 106,132, named Sigma-Aldrich as Senior Party and the University of California/Berkeley, the University of Vienna, and Emmanuelle Charpentier (collectively, “CVC”) as Junior Party, while the second, Interference No. 106,133 named…

On July 15th, Junior Party the University of California/Berkeley, the University of Vienna, and Emmanuelle Charpentier (collectively, “CVC”) filed its Opposition to Senior Party ToolGen’s Substantive Motion No. 1 for benefit of priority to U.S. Provisional Application No. 61/837,481, filed June 20, 2013 (“P3” or “ToolGen P3”), or alternatively, International…

Mitochondrial diseases are a major genetic disease. The prevalence rate among newborns in the United States is about 1 in 5000. China currently lacks complete epidemiological data on mitochondrial diseases. At present, nearly 300 genes that cause mitochondrial diseases are known, including both mitochondrial DNA (mtDNA) coding and nuclear DNA…

On May 28th, Junior Party the Broad Institute, Harvard University, and MIT (collectively, “Broad”) filed its Substantive Preliminary Motion No. 3 in CRISPR Interference No. 106,126 (where ToolGen is the Senior Party).  This motion, pursuant to 37 C.F.R. §§ 41.121(a)(1)(iii) and 41.208(a)(1) requested that the Board de-designate Broad claims in these…

Find NLS in list of proteins. 1 Like the question said. I am clueless. I have list of NLS (nuclear localization signal ) and list of proteins. I am interested to see whether any of my list proteins have my listed NLS. localization nuclear signal • 27 views • link…

On May 20th, Junior Party the University of California, Berkeley; the University of Vienna; and Emmanuelle Charpentier (collectively, “CVC”) filed its Substantive Preliminary Motion No. 2 in Interference No. 106,127 (which names ToolGen as Senior Party), asking the Patent Trial and Appeal Board to deny ToolGen benefit of priority to…

In June, Senior Party ToolGen filed its Substantive Preliminary Motion No. 2 to deny Junior Party the University of California, Berkeley; the University of Vienna; and Emmanuelle Charpentier (collectively, “CVC”) priority benefit to its U.S. Provisional Application No. 61/757,640, filed January 28, 2013 (“Provisional 3”), pursuant to 37 C.F.R. §§…

On May 28th, Junior Party the Broad Institute, Harvard University, and MIT (collectively, “Broad”) filed its Substantive Preliminary Motion No. 3 in CRISPR Interference No. 106,126 (where ToolGen is the Senior Party).  This motion, pursuant to 37 C.F.R. §§ 41.121(a)(1)(iii) and 41.208(a)(1) requests that the Board de-designate Broad claims in…