Tag: Nucleosome

Sperm-specific histone H1 in highly condensed sperm nucleus of Sargassum horneri

Cho, C. et al. Haploinsufficiency of protamine-1 or-2 causes infertility in mice. Nat. Genet. 28, 82–86 (2001). Article  CAS  PubMed  Google Scholar  Oliva, R. Protamines and male infertility. Hum. Reprod. Update 12, 417–435 (2006). Article  CAS  PubMed  Google Scholar  Balhorn, R. The protamine family of sperm nuclear proteins. Genome Biol….

Continue Reading Sperm-specific histone H1 in highly condensed sperm nucleus of Sargassum horneri

Helio Genomics Collaborates with University of California, Irvine, to Study Effectiveness of Multimodal Epigenetic Sequencing for Enhancing Early Cancer Detection

Findings published in open-access journal Genome Medicine. IRVINE, Calif., Jan. 18, 2024 /PRNewswire/ — Helio Genomics, an AI-driven healthcare company specializing in diagnostics technology and test development for cancer detection, today announced that results from an important new research study have been published in the peer-reviewed journal, Genome…

Continue Reading Helio Genomics Collaborates with University of California, Irvine, to Study Effectiveness of Multimodal Epigenetic Sequencing for Enhancing Early Cancer Detection

Clinical algorithm model based on cfDNA to predict SLE disease activity

Background: Circulating cell-free DNA (cfDNA) has been widely used as a new liquid-biopsy marker. Dysregulation of cfDNA has been found in patients with systemic lupus erythematosus (SLE). However, the detailed association between cfDNA and SLE has not been thoroughly studied. Methods: Plasma samples were collected from 88 patients with active…

Continue Reading Clinical algorithm model based on cfDNA to predict SLE disease activity

Sci-Hub | Anti-nucleosome, anti-chromatin, anti-dsDNA and anti-histone antibody reactivity in systemic lupus erythematosus. Clinical Chemistry and Laboratory Medicine (CCLM), 42(3)

Sci-Hub | Anti-nucleosome, anti-chromatin, anti-dsDNA and anti-histone antibody reactivity in systemic lupus erythematosus. Clinical Chemistry and Laboratory Medicine (CCLM), 42(3) | 10.1515/cclm.2004.049 ◂ ↓ save donate to Sci-Hub from 1 USD and more González, C., Garcia-Berrocal, B., Herráez, O., Navajo, J. A., & ManuelGonzález-Buitrago, J. (2004). Anti-nucleosome, anti-chromatin, anti-dsDNA and…

Continue Reading Sci-Hub | Anti-nucleosome, anti-chromatin, anti-dsDNA and anti-histone antibody reactivity in systemic lupus erythematosus. Clinical Chemistry and Laboratory Medicine (CCLM), 42(3)

Human CD26 (DPP4) activation kit by CRISPRa Clinisciences

Kit Components GA101256G1, CD26 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACGTCATTTTTAGCTAAG GA101256G2, CD26 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCCGTGGGGGAGGGGAAA GA101256G3, CD26 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACCTCACGTGGACAGGCGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 Disclaimer These products are manufactured and supplied…

Continue Reading Human CD26 (DPP4) activation kit by CRISPRa Clinisciences

Sequential deregulation of histone marks, chromatin accessibility and gene expression in response to PROTAC-induced degradation of ASH2L

Loss of ASH2L prevents cell proliferation We have studied the molecular and cellular consequences of Ash2l loss in mouse embryo fibroblasts (MEFs) with floxed Ash2l alleles and an inducible Cre-ER recombinase (iMEF-Ash2lfl/fl-Cre-ER). While the knockout of Ash2l was rapid, the downstream effects, including the decrease in promoter-associated H3K4me3, altered gene…

Continue Reading Sequential deregulation of histone marks, chromatin accessibility and gene expression in response to PROTAC-induced degradation of ASH2L

Plasma cell-free DNA 5-hydroxymethylcytosine and whole-genome sequencing signatures for early detection of esophageal cancer

Waters JK, Reznik SI. Update on management of squamous cell esophageal cancer. Curr Oncol Rep. 2022;24:375–85. Article  PubMed  Google Scholar  Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185…

Continue Reading Plasma cell-free DNA 5-hydroxymethylcytosine and whole-genome sequencing signatures for early detection of esophageal cancer

Human TIA1 activation kit by CRISPRa Clinisciences

Product Data Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) Symbol TIA1 Locus ID 7072 Kit Components GA104875G1, TIA1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa GA104875G2, TIA1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa GA104875G3, TIA1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa 1 CRISPRa-Enhancer vector, SKU GE100056 1…

Continue Reading Human TIA1 activation kit by CRISPRa Clinisciences

The BAF chromatin remodeler synergizes with RNA polymerase II and transcription factors to evict nucleosomes

Kornberg, R. D. & Lorch, Y. Primary role of the nucleosome. Mol. Cell 79, 371–375 (2020). Article  CAS  PubMed  Google Scholar  Zhu, F. et al. The interaction landscape between transcription factors and the nucleosome. Nature 562, 76–81 (2018). Article  CAS  PubMed  PubMed Central  Google Scholar  Lee, C. K., Shibata, Y.,…

Continue Reading The BAF chromatin remodeler synergizes with RNA polymerase II and transcription factors to evict nucleosomes

Precise base editing without unintended indels in human cells and mouse primary myoblasts

Base editors cause unintended indels at the target sites Several types of evolved base editors based on the CRISPR system have been developed for more accurate and efficient genome engineering21,37. Among these, AncBE4max and ABEmax were evolved by modifying codon usage, NLSs, and ancestral deaminase reconstructions21. These modifications greatly improve…

Continue Reading Precise base editing without unintended indels in human cells and mouse primary myoblasts

Identification and characterization of ARID1A-interacting proteins in renal tubular cells and their molecular regulation of angiogenesis | Journal of Translational Medicine

Centore RC, Sandoval GJ, Soares LMM, Kadoch C, Chan HM. Mammalian SWI/SNF chromatin remodeling complexes: emerging mechanisms and therapeutic strategies. Trends Genet. 2020;36:936–50. Article  CAS  PubMed  Google Scholar  Pagliaroli L, Trizzino M. The Evolutionary conserved SWI/SNF subunits ARID1A and ARID1B Are Key modulators of pluripotency and cell-fate determination. Front Cell…

Continue Reading Identification and characterization of ARID1A-interacting proteins in renal tubular cells and their molecular regulation of angiogenesis | Journal of Translational Medicine

Genetic manipulation of giant viruses and their host, Acanthamoeba castellanii

Rayamajhee, B., Willcox, M. D., Henriquez, F. L., Petsoglou, C. & Carnt, N. Acanthamoeba keratitis: an increasingly common infectious disease of the cornea. Lancet Microbe 2, e345–e346 (2021). PubMed  Google Scholar  Guimaraes, A. J., Gomes, K. X., Cortines, J. R., Peralta, J. M. & Peralta, R. H. Acanthamoeba spp. as…

Continue Reading Genetic manipulation of giant viruses and their host, Acanthamoeba castellanii

Circulating cell-free DNA fragmentation is a stepwise and conserved process linked to apoptosis | BMC Biology

DNA fragmentation of apoptotic cells is a two-step process which gives rise to major and minor peaks at different places DNA ladder formation is the most well-known characteristic of apoptosis. Since the 1990s, the HL60 cell line has been regarded as an ideal model for studying cell apoptosis [15]. We therefore took advantage of…

Continue Reading Circulating cell-free DNA fragmentation is a stepwise and conserved process linked to apoptosis | BMC Biology

Predicting cancer subtypes from nucleosome profiling of cell-free DNA

Abstract Modern cancer treatments take advantage of genomic differences between tumors to kill cancer cells using targeted approaches. Typically, this requires a tumor biopsy in order to get tissue for phenotypic and genotypic analysis. However, in late-stage cancer, surgical biopsies of metastases may not be part of the standard of…

Continue Reading Predicting cancer subtypes from nucleosome profiling of cell-free DNA

Real-time analysis of the cancer genome and fragmentome from plasma and urine cell-free DNA using nanopore sequencing

doi: 10.15252/emmm.202217282. Online ahead of print. Ymke van der Pol #  1   2 , Normastuti Adhini Tantyo #  1   2 , Nils Evander  1   2 , Anouk E Hentschel  1   3 , Birgit Mm Wever  1   2 , Jip Ramaker  1   2 , Sanne Bootsma  4   5   6 , Marieke F…

Continue Reading Real-time analysis of the cancer genome and fragmentome from plasma and urine cell-free DNA using nanopore sequencing

TNRC18 engages H3K9me3 to mediate silencing of endogenous retrotransposons

Padeken, J., Methot, S. P. & Gasser, S. M. Establishment of H3K9-methylated heterochromatin and its functions in tissue differentiation and maintenance. Nat. Rev. Mol. Cell Biol. 23, 623–640 (2022). Article  CAS  PubMed  PubMed Central  Google Scholar  Tchasovnikarova, I. A. et al. Epigenetic silencing by the HUSH complex mediates position-effect variegation…

Continue Reading TNRC18 engages H3K9me3 to mediate silencing of endogenous retrotransposons

Mapping Mammalian 3D Genome Interactions with Micro-C-XL

A protocol for mapping the three-dimensional genome organization with nucleosome resolution using the genome-wide chromosome conformation capture method Micro-C-XL is presented here. This protocol is significant as it shows high resolution chromosome loops and other short-range interaction features. The main advantage of this technique is the mapping of the 3D…

Continue Reading Mapping Mammalian 3D Genome Interactions with Micro-C-XL

Genetics and epidemiology of mutational barcode-defined clonal hematopoiesis

Identification of CH cases from WGS in ISL and UKB We used WGS from 45,510 Icelanders and 130,709 British ancestry participants from the UKB17,18. Average sequencing depth was 33× for UKB and 38× for ISL. Participants with prior diagnoses of hematological disorders or grossly abnormal hematology measurements on entry were…

Continue Reading Genetics and epidemiology of mutational barcode-defined clonal hematopoiesis

Genomic disturbance of vitellogenin 2 (vtg2) leads to vitellin membrane deficiencies and significant mortalities at early stages of embryonic development in zebrafish (Danio rerio)

A large deletion mutation of 2811 bp of gDNA was introduced into zebrafish vtg2 via CRISPR/Cas9 genome editing. A schematic representation of the general strategy for CRISPR target design and application is given in Fig. 1A–C. The introduced deletion involved 1692 bp of the vtg2 transcript, encoding 564 aa of its respective protein, and…

Continue Reading Genomic disturbance of vitellogenin 2 (vtg2) leads to vitellin membrane deficiencies and significant mortalities at early stages of embryonic development in zebrafish (Danio rerio)

cGAS-STING triggers inflammaging-associated neurodegeneration | Molecular Neurodegeneration

cGAS-STING triggers inflammaging-associated neurodegeneration In their recent article in Nature, Gulen et al. [1] established the cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) pathway as a regulatory driver of inflammaging-associated neurodegeneration in mice. Pharmacological blockade of this pathway in aged mice prevented inflammaging and improved cognitive and motor performance….

Continue Reading cGAS-STING triggers inflammaging-associated neurodegeneration | Molecular Neurodegeneration

Volition Presents Breakthrough Liquid Biopsy Blood Test Method for Early-stage Cancer

  HENDERSON, Nev., Oct. 23, 2023 /PRNewswire/ —VolitionRX Limited (NYSE AMERICAN: VNRX) (“Volition”), a multi-national epigenetics company, has unveiled what it believes to be an entirely new cancer detection method at ESMO 2023¹, the annual congress of the European Society for Medical Oncology. In early-stage…

Continue Reading Volition Presents Breakthrough Liquid Biopsy Blood Test Method for Early-stage Cancer

Volition Presents Three Cancer Detection Abstracts at ESMO 2023

HENDERSON, Nev., Oct. 16, 2023 /PRNewswire/ — VolitionRx Limited (NYSE AMERICAN: VNRX) (“Volition”), a multi-national epigenetics company, is presenting three scientific abstracts at ESMO 2023, the annual congress of the European Society for Medical Oncology. Dr. Jake Micallef, Chief Scientific Officer at Volition, said: “We are delighted to be attending ESMO…

Continue Reading Volition Presents Three Cancer Detection Abstracts at ESMO 2023

Introduction to cfDNA; The Difference Between cfDNA and ctDNA

cfDNA is a DNA fragment released by various cells into the blood or other body fluids. cfDNA can serve as a biomarker for various diseases, especially cancer, reflecting the genomic variation and gene expression of tumor cells. cfDNA analysis has become a promising method for cancer diagnosis, treatment selection, and…

Continue Reading Introduction to cfDNA; The Difference Between cfDNA and ctDNA

Genome-wide chromatin interaction map for Trypanosoma cruzi

Johnson, P. J., Kooter, J. M. & Borst, P. Inactivation of transcription by UV irradiation of T. brucei provides evidence for a multicistronic transcription unit including a VSG gene. Cell 51, 273–281 (1987). Article  CAS  PubMed  Google Scholar  Matthews, K. R., Tschudi, C. & Ullu, E. A common pyrimidine-rich motif…

Continue Reading Genome-wide chromatin interaction map for Trypanosoma cruzi

Multi-faceted attributes of salivary cell-free DNA as liquid biopsy biomarkers for gastric cancer detection | Biomarker Research

Nonaka T, Wong DTW. Saliva Diagnostics. Annual Rev Anal Chem. 2022;15(1):107–21. Article  Google Scholar  Gardner A, Carpenter G, So PW. Salivary metabolomics: from Diagnostic Biomarker Discovery to investigating biological function. Metabolites 2020, 10(2). Koopaie M, Ghafourian M, Manifar S, Younespour S, Davoudi M, Kolahdooz S, Shirkhoda M. Evaluation of CSTB…

Continue Reading Multi-faceted attributes of salivary cell-free DNA as liquid biopsy biomarkers for gastric cancer detection | Biomarker Research

Transcriptomic landscape of the interaction between the entomopathogenic fungus Beauveria bassiana and its tolerant host Tribolium castaneum revealed by dual RNA-seq

Fungal infection To test a natural way of interaction between adult T. castaneum with B. bassiana conidia, insects were maintained feeding on conidia-covered corn kernels during different short time periods (i.e., 3, 6, 12, and 24h), and then separated and maintained in rearing conditions. At all time periods assayed, T….

Continue Reading Transcriptomic landscape of the interaction between the entomopathogenic fungus Beauveria bassiana and its tolerant host Tribolium castaneum revealed by dual RNA-seq

IJMS | Free Full-Text | CRISPR-Cas9 Direct Fusions for Improved Genome Editing via Enhanced Homologous Recombination

Over the past decade, CRISPR-Cas9 has found widespread application in loss-of-function mutations, but precise genetic engineering for gene correction or gene replacement therapies has lagged behind. In vivo correction using CRISPR-Cas9 to replace genetic mutations by HR is highly challenging, and very few studies have managed to achieve this [31,32]….

Continue Reading IJMS | Free Full-Text | CRISPR-Cas9 Direct Fusions for Improved Genome Editing via Enhanced Homologous Recombination

Into the Multi-ome: Four high-quality ‘omes from a single Revio SMRT Cell run

 As Marvel superheroes traverse the multiverse to save the day, genomics researchers are our superheroes as they navigate the daunting multiverse that is biology. The complex and dynamic interactions between the genome sequence, its epigenetic regulation, and their combined effects on transcript expression and splicing are fundamental to our understanding…

Continue Reading Into the Multi-ome: Four high-quality ‘omes from a single Revio SMRT Cell run

How-to: Profile the epigenome

The epigenome regulates the expression of genes without altering their underlying DNA sequence. Comprising a dynamic landscape of chemical modifications and structural changes to DNA and its associated histone proteins, the epigenome wields profound influence over cellular identity and function. Epigenetic mechanisms, such as DNA methylation and histone modifications, form…

Continue Reading How-to: Profile the epigenome

How To Read Chip-Seq Data

Source: Youtube.com The era of big data has revolutionized the way we analyze and interpret complex biological systems. In the field of genomics, Chip-Seq (Chromatin Immunoprecipitation Sequencing) data has become a valuable resource for understanding gene regulation and the functionality of the genome. Chip-Seq data provides insights into the binding…

Continue Reading How To Read Chip-Seq Data

a retrospective pilot study [PeerJ]

Introduction Coronavirus disease 2019 (COVID-19) is the greatest worldwide pandemic of the 21st century caused by the highly infectious SARS-CoV-2. According to the World Health Organization (WHO), SARS-CoV-2 has caused more than 768.2 million cases worldwide to date (WHO, 2022b). Although COVID-19 vaccines are being developed rapidly, compared to traditional…

Continue Reading a retrospective pilot study [PeerJ]

Paired ATAC- and RNA-seq offer insight into the impact of HIV on alveolar macrophages: a pilot study

Fitzpatrick, M. E., Kunisaki, K. M. & Morris, A. Pulmonary disease in HIV-infected adults in the era of antiretroviral therapy. AIDS 32, 277–292. https://doi.org/10.1097/qad.0000000000001712 (2018). Article  PubMed  Google Scholar  Brown, J. & Lipman, M. Community-acquired pneumonia in HIV-Infected individuals. Curr. Infect. Dis. Rep. 16, 397. https://doi.org/10.1007/s11908-014-0397-x (2014). Article  PubMed  PubMed…

Continue Reading Paired ATAC- and RNA-seq offer insight into the impact of HIV on alveolar macrophages: a pilot study

Bioconductor – ChIPsim

DOI: 10.18129/B9.bioc.ChIPsim     Simulation of ChIP-seq experiments Bioconductor version: Release (3.5) A general framework for the simulation of ChIP-seq data. Although currently focused on nucleosome positioning the package is designed to support different types of experiments. Author: Peter Humburg Maintainer: Peter Humburg <Peter.Humburg at gmail.com> Citation (from within R,…

Continue Reading Bioconductor – ChIPsim

Human Metabotropic Glutamate Receptor 4 (GRM4) activation

Product Data Format 3gRNAs, 1 scramble ctrl and 1 enhancer vector Symbol GRM4 Locus ID 2914 Kit Components GA101969G1, Metabotropic Glutamate Receptor 4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa GA101969G2, Metabotropic Glutamate Receptor 4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa GA101969G3, Metabotropic Glutamate Receptor 4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa 1 CRISPRa-Enhancer…

Continue Reading Human Metabotropic Glutamate Receptor 4 (GRM4) activation

Novel non-invasive model may help predict preeclampsia before symptoms

In a recent study published in the journal Nature Medicine, researchers developed a novel clinical diagnostic screening test to identify pregnancies at risk of developing preeclampsia (PE), a potentially life-threatening complication characterized by hypertension. Study: Cell-free DNA methylome analysis for early preeclampsia prediction. Image Credit: Petrovich Nataliya/Shutterstock.com They used methylation…

Continue Reading Novel non-invasive model may help predict preeclampsia before symptoms

A highly efficient scheme for library preparation from single-stranded DNA

Vector construction The gene encoding VTopoI (GenBank: L13447.1) was synthesized by Eurofins Genomics Inc (Tokyo, Japan), with codon optimization for Escherichia coli K-12, exclusion of internal BamHI and EcoRI sites, and their inclusion at the 5′- and 3′-ends of the DNA, respectively (Supplementary Sequences). The BamHI-EcoRI fragment of the gene…

Continue Reading A highly efficient scheme for library preparation from single-stranded DNA

Single-molecule targeted accessibility and methylation sequencing of centromeres, telomeres and rDNAs in Arabidopsis

Lloyd, J. P. B. & Lister, R. Epigenome plasticity in plants. Nat. Rev. Genet. 23, 55–68 (2022). Article  CAS  PubMed  Google Scholar  Lu, Z., Hofmeister, B. T., Vollmers, C., DuBois, R. M. & Schmitz, R. J. Combining ATAC-seq with nuclei sorting for discovery of cis-regulatory regions in plant genomes. Nucleic…

Continue Reading Single-molecule targeted accessibility and methylation sequencing of centromeres, telomeres and rDNAs in Arabidopsis

A genome-wide association study of blood cell morphology identifies cellular proteins implicated in disease aetiology

INTERVAL study The INTERVAL study was a randomised trial of approximately 45,000 blood donors aged eighteen years or older who were recruited at 25 NHSBT (National Health Service Blood and Transplant) static donor centres across England21. The study was approved by the Cambridge East Research Ethics Committee and we complied…

Continue Reading A genome-wide association study of blood cell morphology identifies cellular proteins implicated in disease aetiology

Spike-in normalization via deepTools multiBamSummary –scalingFactors: What’s an appropriate –binSize?

To normalize ChIP-seq data with a separate-species spike-in, I’m following the advice described in this GitHub issue: Align to spiked-in species. Compute scaling factor (e.g., multiBamSummary … –scalingFactors). Note, you should have a look at some of the samples to ensure that the spiked-in species has vaguely uniform coverage. If…

Continue Reading Spike-in normalization via deepTools multiBamSummary –scalingFactors: What’s an appropriate –binSize?

Identifying novel regulatory effects for clinically relevant genes through the study of the Greek population | BMC Genomics

Oikonomou EK, Antoniades C. The role of adipose tissue in cardiovascular health and disease. Nat Rev Cardiol. 2019;16(2):83–99. Article  PubMed  Google Scholar  Sakers A, De Siqueira MK, Seale P, Villanueva CJ. Adipose-tissue plasticity in health and disease. Cell. 2022;185(3):419–46. Article  CAS  PubMed  Google Scholar  Sun W, von Meyenn F, Peleg-Raibstein…

Continue Reading Identifying novel regulatory effects for clinically relevant genes through the study of the Greek population | BMC Genomics

The master growth regulator DELLA binding to histone H2A is essential for DELLA-mediated global transcription regulation

Peng, J. et al. ‘Green revolution’ genes encode mutant gibberellin response modulators. Nature 400, 256–261 (1999). Article  CAS  PubMed  Google Scholar  Eshed, Y. & Lippman, Z. B. Revolutions in agriculture chart a course for targeted breeding of old and new crops. Science 366, eaax0025 (2019). Article  CAS  PubMed  Google Scholar …

Continue Reading The master growth regulator DELLA binding to histone H2A is essential for DELLA-mediated global transcription regulation

Landscape of mSWI/SNF chromatin remodeling complex perturbations in neurodevelopmental disorders

Bailey, M. H. et al. Comprehensive characterization of cancer driver genes and mutations. Cell 173, 371–385 (2018). Article  CAS  PubMed  PubMed Central  Google Scholar  Gabriele, M., Tobon, A. L., D’Agostino, G. & Testa, G. The chromatin basis of neurodevelopmental disorders: Rethinking dysfunction along the molecular and temporal axes. Prog. Neuropsychopharmacol….

Continue Reading Landscape of mSWI/SNF chromatin remodeling complex perturbations in neurodevelopmental disorders

Dynamic network-guided CRISPRi screen identifies CTCF-loop-constrained nonlinear enhancer gene regulatory activity during cell state transitions

Luo, Y. et al. New developments on the Encyclopedia of DNA Elements (ENCODE) data portal. Nucleic Acids Res. 48, D882–D889 (2020). Article  CAS  PubMed  Google Scholar  Korkmaz, G. et al. Functional genetic screens for enhancer elements in the human genome using CRISPR–Cas9. Nat. Biotechnol. 34, 192–198 (2016). Article  CAS  PubMed …

Continue Reading Dynamic network-guided CRISPRi screen identifies CTCF-loop-constrained nonlinear enhancer gene regulatory activity during cell state transitions

Transcription and FACT facilitate the restoration of replication-coupled chromatin assembly defects

Struhl, K. & Segal, E. Determinants of nucleosome positioning. Nat. Struct. Mol. Biol. 20, 267–273 (2013). Article  CAS  PubMed  PubMed Central  Google Scholar  Chereji, R. V. & Clark, D. J. Major determinants of nucleosome positioning. Biophys. J. 114, 2279–2289 (2018). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  Morgan, M….

Continue Reading Transcription and FACT facilitate the restoration of replication-coupled chromatin assembly defects

Help with an ATAC-seq cartoon

Help with an ATAC-seq cartoon 1 Hi all, Would you please explain why we don’t observe peaks in open chromatin region in this cartoon (The blue ATAC line in the bottom)? I mean the region between chromosomes. Meanwhile the regions have DNA wrap around chromosome have peaks. Thank you so…

Continue Reading Help with an ATAC-seq cartoon

PARP inhibitors: enhancing efficacy through rational combinations

Bai P. Biology of poly(ADP-Ribose) polymerases: the factotums of cell maintenance. Mol Cell. 2015;58:947–58. Article  CAS  PubMed  Google Scholar  Ray U, Raghavan SC. Understanding the DNA double-strand break repair and its therapeutic implications. DNA Repair. 2021;106:103177. Article  CAS  PubMed  Google Scholar  Wright WD, Shah SS, Heyer WD. Homologous recombination and…

Continue Reading PARP inhibitors: enhancing efficacy through rational combinations

G4access identifies G-quadruplexes and their associations with open chromatin and imprinting control regions

Jiang, C. & Pugh, B. F. Nucleosome positioning and gene regulation: advances through genomics. Nat. Rev. Genet. 10, 161–172 (2009). Article  CAS  PubMed  PubMed Central  Google Scholar  Fenouil, R. et al. CpG islands and GC content dictate nucleosome depletion in a transcription-independent manner at mammalian promoters. Genome Res. 22, 2399–2408…

Continue Reading G4access identifies G-quadruplexes and their associations with open chromatin and imprinting control regions

SMCHD1 and LRIF1 converge at the FSHD-associated D4Z4 repeat and LRIF1 promoter yet display different modes of action

Somatic loss of LRIF1 or SMCHD1 in control myocytes leads to insufficient DUX4 derepression We have previously shown that SMCHD1 and LRIF1L aid in transcriptional repression of the D4Z4 repeat as short-term depletion of either LRIF1L or SMCHD1 in muscle cells having a D4Z4 repeat of <20 units on a…

Continue Reading SMCHD1 and LRIF1 converge at the FSHD-associated D4Z4 repeat and LRIF1 promoter yet display different modes of action

Advancing Cancer Diagnosis: Integrated Model Utilizing Genomic and Epigenomic Features for Accurate cfDNA-Based Detection

According to statistics, cancer is the number one cause of death for patients under the age of 70. The earlier cancer is diagnosed and treated, the better the prognosis and survival rate of patients will be. Therefore, improving the efficiency and accuracy of early detection of cancer is crucial to…

Continue Reading Advancing Cancer Diagnosis: Integrated Model Utilizing Genomic and Epigenomic Features for Accurate cfDNA-Based Detection

Postdoctoral positions job with Helsinki University

The Taipale lab (Medical Systems Biology, https://www2.helsinki.fi/en/researchgroups/medical-systems-biology) in the University of Helsinki (Faculty of Medicine) has opened two postdoctoral positions. The research group is part of the Academy of Finland’s Centre of Excellence in Tumour Genetics Research and  focuses on the study of transcriptional control of cell growth using functional…

Continue Reading Postdoctoral positions job with Helsinki University

Distinctive Participation of Transcription-Coupled and Global Genome Nucleotide Excision Repair of Pyrimidine Dimers in the Transcribed Strand of Yeast rRNA Genes

journal contribution posted on 2023-06-22, 15:36 authored by Audrey Paillé, François Peyresaubes, Thomas Gardrat, Carlos Zeledon, Antonio Conconi UV light causes the formation of pyrimidine dimers (PDs). Transcription-coupled (TC) nucleotide excision repair (NER) and global genome (GG) NER remove PDs from the transcribed strand (TS) of active genes and the…

Continue Reading Distinctive Participation of Transcription-Coupled and Global Genome Nucleotide Excision Repair of Pyrimidine Dimers in the Transcribed Strand of Yeast rRNA Genes

Chonluten and Gene Expression – Universe News Network

Studies suggest that Chonluten, also known as EDG tripeptide, comprises a natural peptide complex that, by strengthening the production of proteins, may return the normal physiological functions of the respiratory system to their pre-damaged state. It may be essential to both anabolic and catabolic functions. Research suggests Chonluten is a…

Continue Reading Chonluten and Gene Expression – Universe News Network

Structural and functional analysis of a plant nucleolar RNA chaperone-like protein

Martinez-Seidel, F., Beine-Golovchuk, O., Hsieh, Y. C. & Kopka, J. Systematic review of plant ribosome heterogeneity and specialization. Front. Plant. Sci. 11, 948 (2020). Article  PubMed  PubMed Central  Google Scholar  Saez-Vasquez, J. & Delseny, M. Ribosome biogenesis in plants: From functional 45S ribosomal DNA organization to ribosome assembly factors. Plant…

Continue Reading Structural and functional analysis of a plant nucleolar RNA chaperone-like protein

Nucleosome Patterns in Circulating Tumor DNA Reveal Transcriptional Regulation of Advanced Prostate Cancer Phenotypes

Read the Full Video Transcript Andrea Miyahira: Welcome. I’m Andrea Miyahira and I’m the senior director of Global Research and Scientific Communications at the Prostate Cancer Foundation. Today I’m joined by Dr. Gavin Ha, an assistant professor at Fred Hutchinson Cancer Center and the PCF 2019 Young Investigator. Dr. Ha’s…

Continue Reading Nucleosome Patterns in Circulating Tumor DNA Reveal Transcriptional Regulation of Advanced Prostate Cancer Phenotypes

Adipocyte-Specific ATAC-Seq with Adipose Tissues Using Fluorescence-Activated Nucleus Sorting

We present a protocol for assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) specifically on adipocytes using nucleus sorting with adipose tissues isolated from transgenic reporter mice with nuclear fluorescence labeling. ATAC-seq is a powerful technique to understand gene expression regulatory mechanisms. However, adipose tissue is difficult using this technique…

Continue Reading Adipocyte-Specific ATAC-Seq with Adipose Tissues Using Fluorescence-Activated Nucleus Sorting

Histone modifications regulate pioneer transcription factor cooperativity

Protein expression, mutagenesis and purification Xenopus laevis histones for nucleosome assembly were overexpressed in the Escherichia coli BL21(DE3) pLysS strain and purified from inclusion body as previously described48. The cells were grown in LB medium at 37 °C and induced with 1 mM IPTG when OD600 reached 0.6. After 3 h of expression,…

Continue Reading Histone modifications regulate pioneer transcription factor cooperativity

Transcriptomic analysis of benznidazole-resistant and susceptible Trypanosoma cruzi populations | Parasites & Vectors

Overview of sample sequencing We compared the transcriptomes of BZ-resistant (17LER) and wild-type (17WTS) T. cruzi populations. cDNA libraries were constructed, sequenced and analysed for identifying the DE transcripts associated with resistance to BZ. The following parameters were evaluated using the read-quality analysis: (i) quantity of the sequenced reads; (ii)…

Continue Reading Transcriptomic analysis of benznidazole-resistant and susceptible Trypanosoma cruzi populations | Parasites & Vectors

G4 Structures in Control of Replication and Transcription of rRNA Genes

Description Genes encoding 45S ribosomal RNA (rDNA) are known for their abundance within eukaryotic genomes and for their unstable copy numbers in response to changes in various genetic and epigenetic factors. Commonly, we understand as epigenetic factors (affecting gene expression without a change in DNA sequence), namely…

Continue Reading G4 Structures in Control of Replication and Transcription of rRNA Genes

Scientists looking at the human genome have a new “game”. Accuracy up to 100 times higher!

Research by MIT scientists was published in normal genetics, indicating that many genes interact with dozens of different regulators. Identification of the regulatory elements that influence genes can help unravel the mysteries of the development of specific diseases, as well as develop approaches to treat them. The genome is 100…

Continue Reading Scientists looking at the human genome have a new “game”. Accuracy up to 100 times higher!

Streamlined quantitative analysis of histone modification abundance at nucleosome-scale resolution with siQ-ChIP version 2.0

In this section, we derive a simplified expression for the proportionality constant \(\alpha\) that enables quantitative ChIP-seq and we introduce some consequences for track building. This new expression is more intuitive to understand, easier to evaluate, and more accurate to sequencing outcomes than the previous expression. While values derived from…

Continue Reading Streamlined quantitative analysis of histone modification abundance at nucleosome-scale resolution with siQ-ChIP version 2.0

Plants | Free Full-Text | ChIP-Based Nuclear DNA Isolation for Genome Sequencing in Pyropia to Remove Cytosol and Bacterial DNA Contamination

1. Introduction Pyropia is a representative genus in the rhodophyte order Bangiales. It is of fundamental commercial and social importance as the edible seaweed “nori” [1]. Pyropia species, particularly Pyropia yezoensis (also referred to as Neopyropia yezoensis) and Pyropia haitanensis (also referred to as Neoporphyra haitanensis), are widely cultivated in…

Continue Reading Plants | Free Full-Text | ChIP-Based Nuclear DNA Isolation for Genome Sequencing in Pyropia to Remove Cytosol and Bacterial DNA Contamination

H2BNTac Represents a Novel Marker of Active Enhancers

Science has moved on since William Shakespeare put quill to parchment around 1600 to write the Tragedy of Hamlet, Prince of Denmark, but his legacy has survived to influence a new manuscript that describes the quest to discover histone modifications that better distinguish active enhancers. “H2B, or not H2B, that…

Continue Reading H2BNTac Represents a Novel Marker of Active Enhancers

How an enzyme aids in regulation of ageing: Study

PENNSYLVANIA: New research by the research team at Penn State sheds light on how an enzyme that aids in the regulation of ageing and other metabolic processes accesses our genetic material to modify gene expression within the cell. A team led by Penn State researchers created images of a sirtuin…

Continue Reading How an enzyme aids in regulation of ageing: Study

A multi-omics integrative analysis based on CRISPR screens re-defines the pluripotency regulatory network in ESCs

Genome-scale CRISPR screen to identify regulators that maintain mESC pluripotency To establish a function-based PGRN, we first performed a CRISPR-Cas9 mediated genome-wide screen to detect genes essential for self-renewal. mESCs were cultured under Leukaemia inhibitory factors (LIF)/serum condition (L/S), which was commonly used in similar tasks and confer a naïve…

Continue Reading A multi-omics integrative analysis based on CRISPR screens re-defines the pluripotency regulatory network in ESCs

ATAC-seq peak calling with MACS

ATAC-seq peak calling with MACS 3 I am trying to call peaks in ATAC-seq data. Not surprisingly, MACS is a popular option. According to the MACS documentation: To find enriched cutting sites such as some DNAse-Seq datasets. In this case, all 5′ ends of sequenced reads should be extended in…

Continue Reading ATAC-seq peak calling with MACS

Establishment and function of chromatin organization at replication origins

Bell, S. P. & Labib, K. Chromosome duplication in Saccharomyces cerevisiae. Genetics 203, 1027–1067 (2016). Article  CAS  PubMed  PubMed Central  Google Scholar  Eaton, M. L., Galani, K., Kang, S., Bell, S. P. & MacAlpine, D. M. Conserved nucleosome positioning defines replication origins. Genes Dev. 24, 748–753 (2010). Article  CAS  PubMed …

Continue Reading Establishment and function of chromatin organization at replication origins

Which ATAC-seq SAM/BAM fields are required for bigwig generation by deeptools bamCoverage?

Which ATAC-seq SAM/BAM fields are required for bigwig generation by deeptools bamCoverage? 0 Hi, I plan to convert SAM file into BED file using bedops sam2bed tool and perform “chr start and end coordinates” data points manipulation to break di-nucleosome and tri-nucleosome data points into mono-nucleosome data points, then convert…

Continue Reading Which ATAC-seq SAM/BAM fields are required for bigwig generation by deeptools bamCoverage?

Researchers identify the mSWI/SNF chromatin remodeling complex as a host-directed drug target for SARS-CoV-2 infection

In a recent article published in Nature Genetics, researchers showed that mammalian SWItch/Sucrose Non-Fermentable (mSWI/SNF) chromatin remodeling complexes represent a potential class of host-directed broad-acting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) therapeutic target. Study: Pharmacological disruption of mSWI/SNF complex activity restricts SARS-CoV-2 infection. Image Credit: Kateryna Kon/Shutterstock Background Chromatin…

Continue Reading Researchers identify the mSWI/SNF chromatin remodeling complex as a host-directed drug target for SARS-CoV-2 infection

Significance of co-positivity for anti-dsDNA, -nucleosome, and -histone antibodies in patients with lupus nephritis

Objective: The aim of this study was to define the clinical, histopathologic, and prognostic features associated with simultaneous positivity for anti-dsDNA, -nucleosome, and -histone antibodies (3-pos) in Korean patients with biopsy-proven lupus nephritis (LN). Methods: The 102 patients included in the study had undergone kidney biopsy prior to the start…

Continue Reading Significance of co-positivity for anti-dsDNA, -nucleosome, and -histone antibodies in patients with lupus nephritis

Pharmacological disruption of mSWI/SNF complex activity restricts SARS-CoV-2 infection

Bergwerk, M. et al. Covid-19 breakthrough infections in vaccinated health care workers. N. Engl. J. Med. 385, 1474–1484 (2021). Article  CAS  PubMed  Google Scholar  V’Kovski, P., Kratzel, A., Steiner, S., Stalder, H. & Thiel, V. Coronavirus biology and replication: implications for SARS-CoV-2. Nat. Rev. Microbiol. 19, 155–170 (2021). Article  PubMed …

Continue Reading Pharmacological disruption of mSWI/SNF complex activity restricts SARS-CoV-2 infection

ChIP-Seq Strategy to Identify Z-DNA-Forming Sequences in the Human Genome

doi: 10.1007/978-1-0716-3084-6_12. Affiliations Expand Affiliation 1 Department of Life Sciences, Pohang University of Science and Technology (POSTECH), Pohang, South Korea. tyroh@postech.edu. Item in Clipboard Tae-Young Roh. Methods Mol Biol. 2023. Show details Display options Display options Format AbstractPubMedPMID doi: 10.1007/978-1-0716-3084-6_12. Affiliation 1 Department of Life Sciences, Pohang University of Science…

Continue Reading ChIP-Seq Strategy to Identify Z-DNA-Forming Sequences in the Human Genome

A cartography of human histology is in the making

What gets hyped, and what remains neglected, often depends on good storytelling. When the Human Genome Project began, in 1990, it had a simple story, well told. From a standing start, American taxpayers would pay for an exhaustive map of the DNA that makes up the 24 sorts of chromosomes…

Continue Reading A cartography of human histology is in the making

JoF | Free Full-Text | Yeast Chromatin Mutants Reveal Altered mtDNA Copy Number and Impaired Mitochondrial Membrane Potential

Received: 24 January 2023 / Revised: 2 March 2023 / Accepted: 4 March 2023 / Published: 7 March 2023 Round 1 Reviewer 1 Report In this manuscript, Staneva et al. study mitochondrial dynamics of ageing in budding yeast chromatin mutants. In particular, the authors investigated arp4, hho1 and double mutants….

Continue Reading JoF | Free Full-Text | Yeast Chromatin Mutants Reveal Altered mtDNA Copy Number and Impaired Mitochondrial Membrane Potential

Dual specificity and target gene selection by the MADS-domain protein FRUITFULL

Ludwig, L. S. et al. Transcriptional states and chromatin accessibility underlying human erythropoiesis. Cell Rep. 27, 3228–3240.e7 (2019). Article  CAS  PubMed  PubMed Central  Google Scholar  Argelaguet, R. et al. Multi-omics profiling of mouse gastrulation at single-cell resolution. Nature 576, 487–491 (2019). Article  CAS  PubMed  PubMed Central  Google Scholar  Pawlak, M….

Continue Reading Dual specificity and target gene selection by the MADS-domain protein FRUITFULL

Bridging biological cfDNA features and machine learning approaches: Trends in Genetics

Early detection (pancreatic cancer) cfMeDIP-seq, 5hmC sequencing LR elastic-net Hierarchical clustering, t-SNE, LR with elastic-net penalization Methylation (5mC-5hmC) 208 (72/136) 24-feature 5mC, 27-features 5hmC, 51-features combined model SML, UML Combined 5mC and 5hmC AUC of 0.997 (sensitivity 0.938, specificity 0.955) Median total reads: 17.4 M, 0.8 nonduplicate mapping rate https://pms.cd120.com/PDAC/index.html…

Continue Reading Bridging biological cfDNA features and machine learning approaches: Trends in Genetics

Bioconductor – NuPoP (development version)

DOI: 10.18129/B9.bioc.NuPoP     This is the development version of NuPoP; for the stable release version, see NuPoP. An R package for nucleosome positioning prediction Bioconductor version: Development (3.17) NuPoP is an R package for Nucleosome Positioning Prediction.This package is built upon a duration hidden Markov model proposed in Xi…

Continue Reading Bioconductor – NuPoP (development version)

Dynamically reorganized chromatin is the key for the reprogramming of somatic cells to pluripotent cells

Citation: Kaimeng Huang*, Xiaobai Zhang*, Jiejun Shi*, Mingze Yao, Jiannan Lin, Jiao Li, He Liu, Huanhuan Li, Guang Shi, Zhibin Wang, Biliang Zhang, Jiekai Chen, Guangjin Pan, Cizhong Jiang, Duanqing Pei, and Hongjie Yao. 12/7/2015. “Dynamically reorganized chromatin is the key for the reprogramming of somatic cells to pluripotent cells.”…

Continue Reading Dynamically reorganized chromatin is the key for the reprogramming of somatic cells to pluripotent cells

AI analysis of cancer mutations may improve t

image: DNA bits view more  Credit: alengo Cancer has many faces – no wonder, then, that the range of cancer-causing mutations is huge as well. The totality of such genomic alterations in an individual is what experts call a “mutational landscape.” These landscapes differ from one another depending on the type…

Continue Reading AI analysis of cancer mutations may improve t

TRIM24 controls induction of latent HIV-1 by stimulating transcriptional elongation

Finzi, D. Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy. Science 278, 1295–1300 (1997). Article  CAS  Google Scholar  Wong, J. K. Recovery of replication-competent HIV despite prolonged suppression of plasma viremia. Science 278, 1291–1295 (1997). Article  CAS  Google Scholar  Joos, B. et al. HIV rebounds…

Continue Reading TRIM24 controls induction of latent HIV-1 by stimulating transcriptional elongation

New computational tools widen horizons for liquid biopsies

Griffin: Getting more information from cell-free DNA Early liquid biopsy strategies focused on the sequence of the fragments of cell-free DNA released by tumors. The DNA of cancer cells can be rearranged or mutated in characteristic ways, allowing scientists to detect the presence of cancer or important mutations that could…

Continue Reading New computational tools widen horizons for liquid biopsies

Cancer Detection Method Developed From DNA Fragment Patterns, Ends

NEW YORK – A University of Wisconsin at Madison-led team has tapped into tumor DNA fragment and nucleotide frequency profiles in blood samples to come up with an approach that could be used to detect or monitor early-stage cancer. “Genome-wide fragmentation patterns in cell-free DNA (cfDNA) in plasma are strongly…

Continue Reading Cancer Detection Method Developed From DNA Fragment Patterns, Ends

BOMIPROT

1 Bomi8228 Probetacellulin Q9TTC5 2 Bomi5121 Dimethylaniline monooxygenase [N-oxide-forming] 3/Dimethylaniline oxidase 3/Hepatic flavin-containing monooxygenase 3/Trimethylamine monooxygenase Q8HYJ9 3 Bomi10437 Uterine milk protein P46201 4 Bomi9179 Signal transducer and activator of transcription 5A/Mammary gland factor Q95115 5 Bomi9003 Selenoprotein P P49907 6 Bomi3613 Acetyl-CoA carboxylase 1 Q9TTS3 7 Bomi5003 Cytoskeleton-associated protein…

Continue Reading BOMIPROT

The Efficiency of Gene Activation Using CRISPR/dCas9-Based Transactivation Systems Depends on the System Run Time

Zhang H., Qin C., An C., Zheng X., Wen S., Chen W., Liu X., Lv Z., Yang P., Xu W., Gao W., Wu Y. 2021. Application of the CRISPR/Cas9-based gene editing technique in basic research, diagnosis, and therapy of cancer. Mol. Cancer. 20 (1), 126. https://doi.org/10.1186/s12943-021-01431-6 Article  CAS  Google Scholar …

Continue Reading The Efficiency of Gene Activation Using CRISPR/dCas9-Based Transactivation Systems Depends on the System Run Time

Single-cell transcriptome analysis reveals cellular heterogeneity in mouse intra- and extra articular ligaments

Amiel, D., Frank, C., Harwood, F., Fronek, J. & Akeson, W. Tendons and ligaments: a morphological and biochemical comparison. J. Orthop. Res. 1, 257–265 (1984). PubMed  CAS  Google Scholar  Lipps, D. B., Wojtys, E. M. & Ashton-Miller, J. A. Anterior cruciate ligament fatigue failures in knees subjected to repeated simulated…

Continue Reading Single-cell transcriptome analysis reveals cellular heterogeneity in mouse intra- and extra articular ligaments

Comprehensive Analysis of NPSR1-AS1 as a Novel Diagnostic and Prognostic Biomarker Involved in Immune Infiltrates in Lung Adenocarcinoma

The incidence of lung adenocarcinoma (LUAD), the most common subtype of lung cancer, continues to make lung cancer the largest cause of cancer-related deaths worldwide. Long noncoding RNAs (lncRNAs) have been shown to have a significant role in both the onset and progression of lung cancer. In this study, we…

Continue Reading Comprehensive Analysis of NPSR1-AS1 as a Novel Diagnostic and Prognostic Biomarker Involved in Immune Infiltrates in Lung Adenocarcinoma

Long-range phasing of dynamic, tissue-specific and allele-specific regulatory elements

Baylin, S. B. & Jones, P. A. A decade of exploring the cancer epigenome – biological and translational implications. Nat. Rev. Cancer 11, 726–734 (2011). CAS  PubMed  PubMed Central  Article  Google Scholar  Greenberg, M. V. C. & Bourc’his, D. The diverse roles of DNA methylation in mammalian development and disease….

Continue Reading Long-range phasing of dynamic, tissue-specific and allele-specific regulatory elements

Single-cell multi-omics of human clonal hematopoiesis reveals that DNMT3A R882 mutations perturb early progenitor states through selective hypomethylation

Martincorena, I. et al. Somatic mutant clones colonize the human esophagus with age. Science 362, 911–917 (2018). CAS  PubMed  PubMed Central  Google Scholar  Yizhak, K. et al. RNA sequence analysis reveals macroscopic somatic clonal expansion across normal tissues. Science 364, eaaw0726 (2019). CAS  PubMed  PubMed Central  Google Scholar  Yokoyama, A….

Continue Reading Single-cell multi-omics of human clonal hematopoiesis reveals that DNMT3A R882 mutations perturb early progenitor states through selective hypomethylation

Differential enrichment of H3K9me3 in intrahepatic cholangiocarcinoma | BMC Medical Genomics

Sia D, Tovar V, Moeini A, Llovet JM. Intrahepatic cholangiocarcinoma: pathogenesis and rationale for molecular therapies. Oncogene. 2013;32(41):4861–70. CAS  Article  Google Scholar  Sungwan P, Lert-Itthiporn W, Silsirivanit A, Klinhom-On N, Okada S, Wongkham S, Seubwai W. Bioinformatics analysis identified CDC20 as a potential drug target for cholangiocarcinoma. PeerJ. 2021;9:e11067. Article …

Continue Reading Differential enrichment of H3K9me3 in intrahepatic cholangiocarcinoma | BMC Medical Genomics

SMARCE1 deficiency generates a targetable mSWI/SNF dependency in clear cell meningioma

Clapier, C. R., Iwasa, J., Cairns, B. R. & Peterson, C. L. Mechanisms of action and regulation of ATP-dependent chromatin-remodelling complexes. Nat. Rev. Mol. Cell Biol. 18, 407–422 (2017). CAS  PubMed  PubMed Central  Article  Google Scholar  Mashtalir, N. et al. Modular organization and assembly of SWI/SNF family chromatin remodeling complexes….

Continue Reading SMARCE1 deficiency generates a targetable mSWI/SNF dependency in clear cell meningioma

Prediction of histone post-translational modification patterns based on nascent transcription data

Allfrey, V. G., Faulkner, R. & Mirsky, A. E. Acetylation and methylation of histones and their possible role in the regulation of RNA synthesis. Proc. Natl Acad. Sci. USA 51, 786–794 (1964). CAS  PubMed  PubMed Central  Google Scholar  Ho, J. W. K. et al. Comparative analysis of metazoan chromatin organization….

Continue Reading Prediction of histone post-translational modification patterns based on nascent transcription data

Dissertations.se: CHIP-SEQ

Showing result 1 – 5 of 34 swedish dissertations containing the word ChIP-Seq. Author : Ola Wallerman; Claes Wadelius; Jussi Taipale; Uppsala universitet; []Keywords : MEDICAL AND HEALTH SCIENCES; MEDICIN OCH HÄLSOVETENSKAP; MEDICIN OCH HÄLSOVETENSKAP; MEDICAL AND HEALTH SCIENCES; ChIP; ChIP-chip; ChIP-seq; transcription factors; motif discovery; nucleosome positioning; HepG2; genome-wide;…

Continue Reading Dissertations.se: CHIP-SEQ

Q9Y265 | SWISS-MODEL Repository

Cryo-Em structure of the hexameric RUVBL1-RUVBL2 in complex with ZNHIT2 HeteromerQ9Y230; 3×ADP; 7p6x SMTL PDBe PDBe-KB PDBj PDBsum RCSB 1-456 Assess Truncated human R2TP complex, structure 3 (ADP-filled) HeteromerQ9Y230; 6×ADP; 6qi8 SMTL PDBe PDBe-KB PDBj PDBsum RCSB 2-456 Assess Truncated human R2TP complex, structure 4 (ADP-empty) HeteromerQ9Y230; 5×ADP; 6qi9 SMTL…

Continue Reading Q9Y265 | SWISS-MODEL Repository

RNA polymerase II trapped on a molecular treadmill: Structural basis of persistent transcriptional arrest by a minor groove DNA binder

Significance Hairpin pyrrole-imidazole (Py-Im) polyamides can be programmed to bind a broad repertoire of DNA sequences. Py-Im small molecules can be used to target cancer-specific coding regions and block transcription elongation. This transcription blockage by Py-Im cannot be rescued by transcription elongation factors, such as TFIIS. The mechanism by which…

Continue Reading RNA polymerase II trapped on a molecular treadmill: Structural basis of persistent transcriptional arrest by a minor groove DNA binder

An intronic transposon insertion associates with a trans-species color polymorphism in Midas cichlid fishes

Conflicting results suggest a missing variant In order to narrow down candidates for the causal genetic variant, we performed genome-wide association mapping separately in individual lake populations (previously, association mapping was only performed across the whole species flock5). Interestingly, despite clear association peaks in the crater lakes (Fig. 1a, b), the…

Continue Reading An intronic transposon insertion associates with a trans-species color polymorphism in Midas cichlid fishes

Louisiana Tech to host graduate webinar in multiscale genome research

Sept. 22, Louisiana Tech University will host a multiscale genome organization research webinar in which graduate students and postdoctoral researchers will share their work in the field. The webinar, which will begin at 10 a.m. Central Standard Time, will feature five speakers from universities around the world: Stephanie Protillo, a…

Continue Reading Louisiana Tech to host graduate webinar in multiscale genome research

3D-Beacons Network: protein structure data, all in one place

3D-Beacons Network acts as a one-stop shop for protein structures by combining and standardising data from several providers Cryo-EM structure of the BRCA1-UbcH5c/BARD1 E3-E2 module bound to a nucleosome. Image obtained from PDBe A new platform called 3D-Beacons Network brings together experimentally determined and predicted protein structure models and related…

Continue Reading 3D-Beacons Network: protein structure data, all in one place

MYO10 drives genomic instability and inflammation in cancer

INTRODUCTION Genomic instability often refers to the existence of a variety of DNA alterations, ranging from single nucleotide changes (such as base substitution, deletion, and insertion) to chromosomal rearrangements (e.g., gain or loss of a segment or the whole chromosome) (1). Loss of genome stability can lead to early onset…

Continue Reading MYO10 drives genomic instability and inflammation in cancer