Tag: orf

A graph-based genome and pan-genome variation of the model plant Setaria

Variation and evolution in Setaria We collected genome-wide resequencing data for 630 wild (S. viridis), 829 landrace and 385 modern cultivated accessions from the Setaria genus with an average sequencing depth of ~15×, of which 1,004 were newly generated and 840 were from previous studies16,21 (Supplementary Table 1). After aligning…

Continue Reading A graph-based genome and pan-genome variation of the model plant Setaria

A set of vectors and strains for chromosomal integration in fission yeast

Isolation of amino acid auxotrophic mutants using the CRISPR/Cas9 system To allow pDUAL-type single crossover chromosomal integration, strains having a point mutation in genes preferably encoding proteins functioning in the amino acid or nucleotide biosynthesis pathway are needed. There are several such auxotrophic mutants in fission yeast. However, the mutation…

Continue Reading A set of vectors and strains for chromosomal integration in fission yeast

Gene prediction software

Tool:Gene prediction software 1 Hi, I need to predict pseudogenes from the assembled genome of a catfish. For this, I need to predict the genes from the genome and make a parent protein set for finding similarity in intergenic regions of the genome. There is possibility of processed pseudogene being…

Continue Reading Gene prediction software

Exploring the potential role of defensins in differential vector competence of body and head lice for Bartonella quintana | Parasites & Vectors

Amino acid alignments and phylogenetic analysis of defensins 1 and 2 of body and head lice Defensins 1 and 2 of the body and head lice were aligned using the CLC Main Workbench 8 (Qiagen, Hilden, Germany) (Fig. 1). The open reading frame (ORF) sequences of body louse defensin 1 (BLDef1)…

Continue Reading Exploring the potential role of defensins in differential vector competence of body and head lice for Bartonella quintana | Parasites & Vectors

Lack of Cas13a inhibition by anti-CRISPR proteins from Leptotrichia prophages

Summary CRISPR systems are prokaryotic adaptive immune systems that use RNA-guided Cas nucleases to recognize and destroy foreign genetic elements. To overcome CRISPR immunity, bacteriophages have evolved diverse families of anti-CRISPR proteins (Acrs). Recently, Lin et al. (2020) described the discovery and characterization of 7 Acr families (AcrVIA1–7) that inhibit…

Continue Reading Lack of Cas13a inhibition by anti-CRISPR proteins from Leptotrichia prophages

Pancreatic cancer microbiome discovery holds treatment hope

iNtRON Biotechnology has announced the identification of prophage and (non-) ORF-jamphage from the microbiome frequently observed in long-term pancreatic cancer survivors.  The company said the ‘significant identification’ was achieved as part of its ongoing PHAGERIARUS development project conducted by the new drug part of the company. The PHAGERIARUS development project…

Continue Reading Pancreatic cancer microbiome discovery holds treatment hope

Highly lethal genotype I and II recombinant African swine fever viruses detected in pigs

Recombinant ASFVs with mosaic genomes of genotype I and II viruses detected from field samples in China During our surveillance in China, we isolated three ASFVs from pig samples collected in Jiangsu province, Henan province, and Inner Mongolia Autonomous Region, respectively, and designated them Pig/Jiangsu/LG/2021 (JS/LG/21), Pig/Henan/123014/2022 (HeN/123014/22), and Pig/Inner…

Continue Reading Highly lethal genotype I and II recombinant African swine fever viruses detected in pigs

Occurrence and genetic diversity of prophage sequences identified in the genomes of L. casei group bacteria

Occurrence of prophage sequences in L. casei group genomes The first stage of the analysis involved the identification of prophage-like sequences in 439 genomic sequences of bacterial strains belonging to the following 5 species: L. casei (27), L. paracasei (200), L. rhamnosus (204), L. zeae (6) and L. chiayiensis (2)….

Continue Reading Occurrence and genetic diversity of prophage sequences identified in the genomes of L. casei group bacteria

How do you add an ORF that overlaps the two regions where a circular genome is cut in Genbank?

How do you add an ORF that overlaps the two regions where a circular genome is cut in Genbank? 1 Dear Biostars community, I had a question regarding the BankIt (Genbank) submission for circularized genomes. Let’s say I have a circularized genome from 1 to 100000 bp. And I also…

Continue Reading How do you add an ORF that overlaps the two regions where a circular genome is cut in Genbank?

uridine-derived ribose as an alternative energy source

In a recent study published in Nature Metabolism, researchers attempted to identify new genes and molecular pathways that might supply energy when the availability of glucose or other nutrients is limited. Study: Salvage of ribose from uridine or RNA supports glycolysis in nutrient-limited conditions. Image Credit: Irina Anosova/Shutterstock.com Background In…

Continue Reading uridine-derived ribose as an alternative energy source

How to pass from DNA to AA fasta

How to pass from DNA to AA fasta 0 Hi, I hope you are well. I am trying to figure out how can I pass a eukaryotic gene that has introns to aa sequence. The only way that I have thought is to transcribe all the gene then translate it…

Continue Reading How to pass from DNA to AA fasta

$3m boost for Equine herpesvirus vaccine development

Image by Frohe Weihnachten Research into equine herpesvirus (EHV) has received a major boost with funding for two projects from the Grayson-Jockey Club Research Foundation. Equine herpesvirus (EHV-1) and Equid Herpesvirus Myeloencephalopathy (EHM) are highly contagious, affecting horses of every breed and discipline, and they continue to cause significant economic…

Continue Reading $3m boost for Equine herpesvirus vaccine development

Rising Trends of Molecular Pharming Market will Witness Substantial Growth With in-detailed Competitor Analysis Forecast to 2023-2030

“Stratagem Market Insights offers a 70% discount on Molecular Pharming Market Reports on Single User Access and Unlimited User Access“ The Molecular Pharming Market research study is a professional report with premium insights into the size of the business, current patterns, drivers, risks, potential outcomes, and major segments. The Industry…

Continue Reading Rising Trends of Molecular Pharming Market will Witness Substantial Growth With in-detailed Competitor Analysis Forecast to 2023-2030

ttc30a gene cDNA ORF clone, Xenopus tropicalis(tropical clawed frog)

The following ttc30a gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ttc30a cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or…

Continue Reading ttc30a gene cDNA ORF clone, Xenopus tropicalis(tropical clawed frog)

TTC30A gene cDNA ORF clone, Macaca mulatta(Rhesus monkey)

The following TTC30A gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the TTC30A cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or…

Continue Reading TTC30A gene cDNA ORF clone, Macaca mulatta(Rhesus monkey)

Mosquito densovirus significantly reduces the vector susceptibility to dengue virus serotype 2 in Aedes albopictus mosquitoes (Diptera: Culicidae) | Infectious Diseases of Poverty

Identification of MDV presence using open access sequencing data Metagenomic next-generation sequencing (NGS) data for field mosquitoes in China were searched from the NCBI SRA database (www.ncbi.nlm.nih.gov/sra) and CNGB Sequence Archive database (db.cngb.org/cnsa/) using the keywords “mosquito OR Anopheles OR Aedes OR Culex”. Followed by removing the datasets with less…

Continue Reading Mosquito densovirus significantly reduces the vector susceptibility to dengue virus serotype 2 in Aedes albopictus mosquitoes (Diptera: Culicidae) | Infectious Diseases of Poverty

Introduction to Computational Evolutionary Biology

R is a very flexible programming language, and it allows developers to create their own data structures (called classes) for their packages. Over the years, some packages have become so popular that the classes they use to store data are now used the “standard” representations for particular types of data….

Continue Reading Introduction to Computational Evolutionary Biology

Hybrids of RNA viruses and viroid-like elements replicate in fungi

Ribozyme search of the Sequence Read Archive Observing that ribozymes are sufficiently short to be captured on a short sequence read (less than 100 nt), we reasoned it will be possible to screen large volumes of sequencing data to identify libraries potentially containing ribozyme agents. To this end we adapted…

Continue Reading Hybrids of RNA viruses and viroid-like elements replicate in fungi

The association of prokaryotic antiviral systems and symbiotic phage communities in drinking water microbiomes

The abundance and composition of prokaryotes carrying antiviral system in DWDS microbiome Prokaryotes have evolved various defense systems to prevent virus infection and prophage activation [8]. DefenseFinder revealed various prokaryotic antiviral systems harbored by the drinking water microbiome [9], and PCoA analysis showed that prokaryotic antiviral systems clustered separately in…

Continue Reading The association of prokaryotic antiviral systems and symbiotic phage communities in drinking water microbiomes

IJMS | Free Full-Text | A Split-Marker System for CRISPR-Cas9 Genome Editing in Methylotrophic Yeasts

1. Introduction The discovery of prokaryotic adaptive defense systems, which consist of the clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR-associated (cas) genes [1,2,3], has led to the development of efficient tools for genome editing in different organisms. Type II CRISPR-Cas systems include the Cas9 protein, which forms an…

Continue Reading IJMS | Free Full-Text | A Split-Marker System for CRISPR-Cas9 Genome Editing in Methylotrophic Yeasts

Midwest PRRSV L1C variant heads east

In 2020, porcine reproductive and respiratory syndrome virus Lineage 1C variant RFLP 1-4-4 emerged in Minnesota and quickly spread across neighboring states, causing severe losses in the swine industry (Kikuti et al. 2021; Trevisan et al. 2021). Known as a highly virulent variant with severe clinical outcomes in pigs, this…

Continue Reading Midwest PRRSV L1C variant heads east

Using the 27-primates UCSC Multiz Alignment

Using the 27-primates UCSC Multiz Alignment 0 Hello, I am attempting to use the 27-primates UCSC multiz alignment data so that I can find an orthogonal sequence (across different mammals) to a human reference sequence (whether an ORF, a transcript, etc). I downloaded all the data in the maf folders…

Continue Reading Using the 27-primates UCSC Multiz Alignment

A ferritin-based COVID-19 nanoparticle vaccine that elicits robust, durable, broad-spectrum neutralizing antisera in non-human primates

IgG plasmids Antibody sequences and Fc-tagged ACE2 were cloned into the CMV/R plasmid backbone for expression under a CMV promoter. The antibodies with variable HC/LC were cloned between the CMV promoter and the bGH poly(A) signal sequence of the CMV/R plasmid to facilitate improved protein expression. The variable region was…

Continue Reading A ferritin-based COVID-19 nanoparticle vaccine that elicits robust, durable, broad-spectrum neutralizing antisera in non-human primates

Optimization of Cas12a for multiplexed genome-scale transcriptional activation

Abstract Cas12a CRISPR technology, unlike Cas9, allows for multiplexing guide RNAs from a single transcript, simplifying combinatorial perturbations. While Cas12a has been implemented for multiplexed knockout genetic screens, it has yet to be optimized for CRISPR activation (CRISPRa) screens in human cells. Here we develop a new Cas12a-based transactivation domain…

Continue Reading Optimization of Cas12a for multiplexed genome-scale transcriptional activation

Clarification on conceptual question regarding ORF-calling

Clarification on conceptual question regarding ORF-calling 1 Hello, I have a conceptual question that I think I may have the answer to, but would appreciate feedback. There are many ORF-calling tools out there, and many of them take in a fasta file as input (such as orfipy). My question is:…

Continue Reading Clarification on conceptual question regarding ORF-calling

tool that reports *every* ORF, including from nested starts?

tool that reports *every* ORF, including from nested starts? 2 (I am defining ORF as, between an ATG start and a downstream stop codon) Given a situation like this: showing a ~1kb region, forward strand, 3 frame prediction of starts (green) and stops (red), for the frame 3 span between…

Continue Reading tool that reports *every* ORF, including from nested starts?

Associate toxin-antitoxin with CRISPR-Cas to kill multidrug-resistant pathogens

Search for creTA elements associating with I-F CRISPR-Cas Previously identified creTA genes all surround the cas6 gene of a type I or III CRISPR-Cas19. Yet, within the I-F CRISPR-Cas loci of Acinetobacter species, we did not find any creTA-like elements by searching the sequences surrounding csy4 (a subtype-specific cas6 gene)….

Continue Reading Associate toxin-antitoxin with CRISPR-Cas to kill multidrug-resistant pathogens

Anaerobic thiosulfate oxidation by the Roseobacter group is prevalent in marine biofilms

Novel Roseobacter strains isolated from marine biofilms We isolated and cultured bacterial strains from biofilms on natural rocks immersed in coastal waters. After preliminary analyses of 16S rRNA gene sequences generated by Sanger sequencing, more than 500 non-redundant strains were identified, including 54 distant strains affiliated with Roseobacter (hereafter referred…

Continue Reading Anaerobic thiosulfate oxidation by the Roseobacter group is prevalent in marine biofilms

Is mRNA decoding in humans structurally and kinetically distinct from bacteria?

In a recent study published in the journal Nature, researchers examined molecular-level differences in ribosomal translational fidelity between humans and bacteria. Study: mRNA decoding in human is kinetically and structurally distinct from bacteria. Image Credit: MattL_Images/Shutterstock.com Background Protein synthesis by ribosomes requires decoding messenger ribonucleic acid (mRNA) nucleotide (nt) sequences. The mechanisms…

Continue Reading Is mRNA decoding in humans structurally and kinetically distinct from bacteria?

The box H+ACA snoRNAs carry Cbf5p, the putative rRNA pseudouridine synthase

 Genetic depletion of Cbf5p. (A) Schematic representation of the GAL::cbf5 allele. (B) Growth of the GAL::cbf5 (•) and CBF5 (○) strains following transfer to glucose medium. Cell density was measured at regular intervals, and the cultures were periodically diluted to be continuously kept in exponential growth. (C) Northern hybridization of…

Continue Reading The box H+ACA snoRNAs carry Cbf5p, the putative rRNA pseudouridine synthase

Efficient CRISPR-Cas13d-Based Antiviral Strategy to Combat SARS-CoV-2

Affiliations Expand Affiliations 1 Laboratory of Experimental Virology, Department of Medical Microbiology, Amsterdam UMC, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands. 2 Department of Molecular and Cell Biology, National Center of Biotechnology (CNB-CSIC), Campus Universidad Autónoma de Madrid, 28049 Madrid, Spain. Free PMC article Item in…

Continue Reading Efficient CRISPR-Cas13d-Based Antiviral Strategy to Combat SARS-CoV-2

Toxins | Free Full-Text | Metagenome Analysis Identifies Microbial Shifts upon Deoxynivalenol Exposure and Post-Exposure Recovery in the Mouse Gut

1. Introduction Fusarium fungi are world-wide producers of a range of mycotoxins. Deoxynivalenol (DON) belonging to the group B trichothecenes, is one of the most prevalent food-associated mycotoxins mainly produced by Fusarium graminearum and Fusarium culmorum, and frequently contaminates cereals and cereal products [1,2]. Almost half of a total of…

Continue Reading Toxins | Free Full-Text | Metagenome Analysis Identifies Microbial Shifts upon Deoxynivalenol Exposure and Post-Exposure Recovery in the Mouse Gut

Rickettsial DNA and a trans-splicing rRNA group I intron in the unorthodox mitogenome of the fern Haplopteris ensiformis

Our choice of the shoestring fern H. ensiformis as a leptosporangiate fern for complete assembly of both organelle genomes was based on pronounced variability in mitochondrial RNA editing and intron (co-)evolution in the monilophyte family Pteridaceae and the sub-family Vittarioideae in particular22. We used next-generation sequencing (NGS) data to assemble…

Continue Reading Rickettsial DNA and a trans-splicing rRNA group I intron in the unorthodox mitogenome of the fern Haplopteris ensiformis

Mac program for DNA analysis and cloning.

Tool:BioLabDNA – Mac program for DNA analysis and cloning. 0 BioLabDNA is one time purchase program with lifetime updates including new features. This program is aimed at researches in the molecular biology field. BioLabDNA is the document based app focused on the analysis and manipulation of DNA sequences. The user…

Continue Reading Mac program for DNA analysis and cloning.

A male-killing gene encoded by a symbiotic virus of Drosophila

Collection and maintenance of Drosophila biauraria We used laboratory stocks of Drosophila biauraria (Diptera; Drosophilidae), which were originally collected at the Field Science Center for Northern Biosphere, Hokkaido University located at Tomakomai, Hokkaido in 2011 and 2015 using standard banana traps and sweeping22. Females were brought into the lab and…

Continue Reading A male-killing gene encoded by a symbiotic virus of Drosophila

Solved Examine the following DNA sequence:

Examine the following DNA sequence: 5’-AATGCGGGCAGTAGGCCCGTTTATACCAAAAATGACAGAAATGGGCCAT-3’ A. Write the reverse complement of this sequence in 5’ to 3’ direction (1 point) B. The open reading frame (ORF) of the sequence starts with the first ATG and in red is a sgRNA target sequence):….ATGCGGGCAGTAGGCCCGTTTATACCAAAAATGACAGAAATGGGCTTGATC…. i. What is the protospacer sequence of…

Continue Reading Solved Examine the following DNA sequence:

Viruses | Free Full-Text | Efficient CRISPR-Cas13d-Based Antiviral Strategy to Combat SARS-CoV-2

Figure 1. Replication cycle of SARS-CoV-2 and genome organization. (A) The SARS-CoV-2 replication cycle. Binding of the viral S protein to the ACE-2 receptor triggers SARS-CoV-2 infection and the plus genomic RNA (+gRNA) is translated into polyprotein (pp)1a and pp1ab. These proteins are proteolytically cleaved to generate 16 non-structural proteins…

Continue Reading Viruses | Free Full-Text | Efficient CRISPR-Cas13d-Based Antiviral Strategy to Combat SARS-CoV-2

Population-level impacts of antibiotic usage on the human gut microbiome

A comprehensive catalogue of ARGs from the human microbiome We created a catalogue of ARGs across both the human microbiome and reference genomes by locating open reading frames (ORFs) on metagenomic assemblies from 8972 human microbiome samples spanning gut (7589), oral cavity (746), skin (380), airway (118), nasal cavity (55),…

Continue Reading Population-level impacts of antibiotic usage on the human gut microbiome

Mitochondrial phylogenomics provides conclusive evidence that the family Ancyrocephalidae is deeply paraphyletic | Parasites & Vectors

Perkins EM, Donnellan SC, Bertozzi T, Whittington ID. Closing the mitochondrial circle on paraphyly of the Monogenea (Platyhelminthes) infers evolution in the diet of parasitic flatworms. Int J Parasitol. 2010;40:1237–45. Article  CAS  PubMed  Google Scholar  Zhang D, Li WX, Zou H, Wu SG, Li M, Jakovlić I, et al. Homoplasy…

Continue Reading Mitochondrial phylogenomics provides conclusive evidence that the family Ancyrocephalidae is deeply paraphyletic | Parasites & Vectors

Grouper cGAS is a negative regulator of STING-mediated interferon response

doi: 10.3389/fimmu.2023.1092824. eCollection 2023. Luhao Zhang  1 , Xin Zhang  1 , Jiaming Liao  1 , Linting Xu  1 , Shaozhu Kang  1 , Hong Chen  1 , Mengshi Sun  1 , Siting Wu  1 , Zhuqing Xu  1 , Shina Wei  1   2 , Qiwei Qin  1   3   4   5 , Jingguang Wei  1   6…

Continue Reading Grouper cGAS is a negative regulator of STING-mediated interferon response

Ribo-Seq Analysis

Ribo-Seq Analysis 1 Hi everyone, What are some of the latest/advanced tools for ribo-seq analysis? If anyone here with experience in ribo-seq can guide me through or recommend me some tutorials that would be really helpful. I’m particularly interested in annotation of small ORFs (smORFs) in my data. Thank you…

Continue Reading Ribo-Seq Analysis

MMseqs error: Filter prefilter died

MMseqs error: Filter prefilter died 0 Hi all, I’m testing MMseqs to assign taxonomy, everything runs smoothly until the specific point of taxonomy assignation where I get: “Error: orf filter prefilter died”. Has anyone experienced this and knows a workaround? I posted this issue on MMseqs’ Github page but got…

Continue Reading MMseqs error: Filter prefilter died

Researchers report the circulation of a novel MERS-like coronavirus in Malayan pangolins

In a recent study published in Cell, researchers reported the circulation of a novel Middle East respiratory syndrome (MERS)-like coronavirus (CoV) among Malayan pangolins, Manis javanica HKU4-associated CoV (MjHKU4r-CoV). Study: A bat MERS-like coronavirus circulates in pangolins and utilizes human DPP4 and host proteases for cell entry. Image Credit: Binturong-tonoscarpe/Shutterstock…

Continue Reading Researchers report the circulation of a novel MERS-like coronavirus in Malayan pangolins

rna seq – Which candida albicans fasta and gff file should I use for alignment?

The refseq is Candida albicans SC5314. I assume you are performing a fasta reference based assembly. Its 8 chromosomes are NC_032089.1 to NC_032096.1 inclusively from chromosome 1 to chromosome 7 (NC_032095.1) to chromosome R. Its here. Most of the files you downloaded are SC5314. So I dunno it depends what…

Continue Reading rna seq – Which candida albicans fasta and gff file should I use for alignment?

Solved Instructions: – Work through Object-Oriented

Transcribed image text: Instructions: – Work through Object-Oriented Programming \& Biopython and Practice Finding Open Reading Frames to gain the building blocks to complete this assignment – Review the spec below for the script we would like you to create – Review the automated tests in the folder to understand…

Continue Reading Solved Instructions: – Work through Object-Oriented

Solved question6. Using the ExPASy translate tool, provide a

question6. Using the ExPASy translate tool, provide a protein translation of the transcript sequence, and indicate the size in nucleotides of: 1) the complete nucleotide sequence; 2) the 5’ untranslated region (UTR); 3) the 3’ UTR; and 4) the open reading frame (ORF; indicate which reading frame you selected) ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA…

Continue Reading Solved question6. Using the ExPASy translate tool, provide a

SMARTchoice Lentiviral shRNA – ABO

SMARTvector Lentiviral shRNA offers maximum flexibility for vector-based RNAi experiments Because efficient gene silencing depends on both the design and level of expression of the shRNA, it is critical to choose silencing reagents where both the targeting sequence and the specific promoter driving expression are taken into consideration. SMARTvector Lentiviral…

Continue Reading SMARTchoice Lentiviral shRNA – ABO

Characterization of antibiotic resistomes by reprogrammed bacteriophage-enabled functional metagenomics in clinical strains

This research complies with all relevant ethical regulations approved by the Human Investigation Review Board of Albert Szent-Györgyi Clinical Centre of the University of Szeged and the National Biodiversity Authority (NBA) of India. Permission for the faecal sample collection was obtained from the Human Investigation Review Board of Albert Szent-Györgyi…

Continue Reading Characterization of antibiotic resistomes by reprogrammed bacteriophage-enabled functional metagenomics in clinical strains

Genetic mapping of microbial and host traits reveals production of immunomodulatory lipids by Akkermansia muciniphila in the murine gut

Animal studies Animal care and study protocols were approved by the AAALAC-accredited Institutional Animal Care and Use Committee of the College of Agricultural Life Sciences at the University of Wisconsin-Madison (UW-Madison). All experiments with mice were performed under protocols approved by the UW-Madison Animal Care and Use Committee (Protocol number…

Continue Reading Genetic mapping of microbial and host traits reveals production of immunomodulatory lipids by Akkermansia muciniphila in the murine gut

warning message after HTSeq

warning message after HTSeq 0 I have analyzed RNA-seq data with HTSeq. My command that I used is python -m HTSeq.scripts.count -f bam -r pos -s reverse -t ORF -i group -m union input.bam my.gff > output.txt Warning message is Warning: Mate records missing for 3752 records; first such record:…

Continue Reading warning message after HTSeq

Novel Food Information: Herbicide Tolerant and Pest Resistant Maize line 4114

On this page Background Health Canada has notified Pioneer Hi-Bred Production LP that it has no objection to the food use of herbicide tolerant and pest resistant maize line 4114. The Department conducted a comprehensive assessment of this variety according to its Guidelines for the Safety Assessment of Novel Foods….

Continue Reading Novel Food Information: Herbicide Tolerant and Pest Resistant Maize line 4114

Barrier-to-autointegration factor 1 promotes gammaherpesvirus reactivation from latency

Biosafety statement All experiments with cell lines and viral infections were carried out in a Biosafety Level 2 facility under the approval of the Biosafety Office in the Department of Environment, Health and Safety and the Institutional Biosafety Committee at the University of North Carolina at Chapel Hill. The laboratory…

Continue Reading Barrier-to-autointegration factor 1 promotes gammaherpesvirus reactivation from latency

New Dielis species and structural dichotomy of the mitochondrial cox2 gene in Scoliidae wasps

New species account Taxonomy: Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita; Aculeata; Scolioidea; Scoliidae; Scoliinae, sensu Raznitsyn27; Campsomerini; Dielis Saussure & Sichel, 186428. Dielis tejensis sp. nov. urn:lsid:zoobank.org:act:7E4E00DB-180B-427A-886A-13FB4DF53F6D. Habitus: Fig. 1, Supplementary Fig. S1. Figure 1 D. tejensis sp. nov. and its mitochondrial genome. Open arrows indicate the location of…

Continue Reading New Dielis species and structural dichotomy of the mitochondrial cox2 gene in Scoliidae wasps

Bioinformatics Analysis of Viral Metagenomic Sequencing

Viral metagenomics is the study of viruses in environmental and biological samples by utilizing next generation sequencing that generates very large data sets. Viral metagenomics analyzes viral sequences to deduce the impact of viruses on the environment of human health. Unlike amplicon sequencing, metagenomics obtains and investigates genetic material directly…

Continue Reading Bioinformatics Analysis of Viral Metagenomic Sequencing

Seqlengths of x contains NA values!

Hello, I would like to use ORFik to determine the coverage of the different ORFs across the maize genome. I have ribo-seq data, the latest annotation file (a GFF3), and the v5 genome fasta file for B73. After running my code, three Large CompressedGRangesLists are created and none of them…

Continue Reading Seqlengths of x contains NA values!

What kinase phosphorylates WNK2 at site s49 (and s45) ? And how to deal with chatGPT with such questions ?

I need to translate a nucleotide sequence into amino acid sequence, can you do that? Yes, I can help you translate a nucleotide sequence into an amino acid sequence. The process is called “protein translation” and it occurs in cells through the process of transcription and translation. The genetic code…

Continue Reading What kinase phosphorylates WNK2 at site s49 (and s45) ? And how to deal with chatGPT with such questions ?

The Rad52 SSAP superfamily and new insight into homologous recombination

Mortensen, U. H., Lisby, M. & Rothstein, R. Rad52. Curr. Biol. 19, R676–R677 (2009). Article  CAS  Google Scholar  Newing, T. et al. Redβ177 annealase structure reveals details of oligomerization and λ Red-mediated homologous DNA recombination. Nat. Commun. 13, 5649 (2022). Article  CAS  Google Scholar  Caldwell, B. J. et al. Structure…

Continue Reading The Rad52 SSAP superfamily and new insight into homologous recombination

Solved Using the ExPASy translate tool, provide a protein

Using the ExPASy translate tool, provide a protein translation of the following transcript sequence and indicate the size in nucleotides of: 1) the complete nucleotide sequence; 2) the 5’ untranslated region (UTR); 3) the 3’ UTR; and 4) the open reading frame (ORF; indicate which reading frame you selected). AATCTCTAGCTCGCTCGCGCTCCCTCTCCCCGGGCCGTGGAAAGGATCCCACTTCCGGTGGGGTGTCATG…

Continue Reading Solved Using the ExPASy translate tool, provide a protein

Alternative splicing and genetic variation of mhc-e: implications for rhesus cytomegalovirus-based vaccines

The gene expression of Mamu-E is regulated by extensive alternative splicing that is conserved among HLA-E isoforms To accurately define Mamu-E transcript structures, we aimed to use high-quality, full-length transcript sequences obtained by long-read transcriptome sequencing41. Since the sequences of MHC genes are very similar, it was critical that we…

Continue Reading Alternative splicing and genetic variation of mhc-e: implications for rhesus cytomegalovirus-based vaccines

Versatile and efficient genome editing with Neisseria cinerea Cas9

PAM identification of NcCas9 by PAM-DOSE The type II-C Cas9 orthologue NcCas9 is of small size (1082 aa) and is closely related to conventional Neisseria meningitidis Cas9 (NmeCas9)11 (Fig. 1a). The NcCas9 is 94% identical to Nme1Cas9, and the divergences lie mainly in the C-terminal PAM-interacting domain (PID) (Fig. 1a and S1)….

Continue Reading Versatile and efficient genome editing with Neisseria cinerea Cas9

Metagenomic analysis of viromes in tissues of wild Qinghai vole from the eastern Tibetan Plateau

Overview of the viromes In all, 41 wild Qinghai voles were collected from pasture habitats located on the eastern Tibetan Plateau, China (Fig. 1). Tissue samples from liver, lung, spleen, small intestine (with content), and feces (large intestinal content) of each vole were disrupted, and viral RNA was extracted. The RNA…

Continue Reading Metagenomic analysis of viromes in tissues of wild Qinghai vole from the eastern Tibetan Plateau

Home page

Home page The store will not work correctly in the case when cookies are disabled. JavaScript seems to be disabled in your browser. For the best experience on our site, be sure to turn on Javascript in your browser. Pioneer in Engineered Nucleases technologies from ZFNs and TALENs to CRISPRs…

Continue Reading Home page

Uncharted genetic territory offers insight into human-specific proteins

When researchers working on the Human Genome Project completely mapped the genetic blueprint of humans in 2001, they were surprised to find only around 20,000 genes that produce proteins. Could it be that humans have only about twice as many genes as a common fly? Scientists had expected considerably more….

Continue Reading Uncharted genetic territory offers insight into human-specific proteins

Potential SARS-CoV-2 antivirals based on host miRNAs

A recent research paper posted to the bioRxiv* preprint server demonstrated micro ribonucleic acids (miRNAs) as potential antiviral options against various coronaviruses (CoVs), including severe acute respiratory syndrome CoV 2 (SARS-CoV-2). Study: Deciphering inhibitory mechanism of coronavirus replication through host miRNAs-RNA-dependent RNA polymerase (RdRp) interactome. Image Credit: ART-ur / Shutterstock Background Despite what…

Continue Reading Potential SARS-CoV-2 antivirals based on host miRNAs

SARS-CoV-2 ORF8 protein binds to dendritic cells and induces a hyper-inflammatory cytokine storm

In a recent study posted to the bioRxiv* pre-print server, researchers examined how the interaction of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) open reading frame 8 (ORF8) protein with host dendritic cells (DCs) induced cytokine storm. ​​​​​​​Study: The unique ORF8 protein from SARS-CoV-2 binds to human dendritic cells…

Continue Reading SARS-CoV-2 ORF8 protein binds to dendritic cells and induces a hyper-inflammatory cytokine storm

Roles of circRNAs | CMAR

Introduction Hepatocellular carcinoma (HCC) is the most common type of primary liver cancer, with an increasing global incidence, and a leading cause of cancer-related mortality.1 Although hepatitis B and C virus infections, cirrhosis, alcohol intake, and non-alcoholic fatty liver disease (NAFLD) are the main risk factors contributing to HCC.1,2 Approximately…

Continue Reading Roles of circRNAs | CMAR

Biogenesis, biology and characterization of circular RNAs

Biogenesis, biology and characterization of circular RNAs Kristensen LS et al. The biogenesis, biology and characterization of circular RNAs. Nat Rev Genet. (2019) Summary text Biogenesis and properties of circRNAs Biogenesis of cirRNA Characteristics of circRNAs Discover and analyze circRNAs circRNA genome-wide analysis CircRNA site-specific analysis circRNA visualization Biological functions…

Continue Reading Biogenesis, biology and characterization of circular RNAs

Shrna Lentiviral Particles Recipes

Lentiviral Clone&Lentivirus packaging services – GeneCopoeia Recipes Details: Advantages of lentiviral ORF cDNA, promoters, shRNA, and microRNA clones High efficiency of gene delivery to virtually all cell types and whole model organisms. A lentiviral system is very effective at delivering genetic material to whole model organisms and almost all mammalian…

Continue Reading Shrna Lentiviral Particles Recipes

Separate exogenous from endogenous transcripts using Salmon RNAseq DTU

Dear friends, We are trying to use Salmon for DTU analysis. We want to separate exogenous from endogenous transcripts by following this post www.biostars.org/p/443701/ and this paper f1000research.com/articles/7-952 We are focusing on a gene called ASCL1 (endo-ASCL1). We transduced cells with lentiviral vector containing ASCL1 ORF only (Lenti-ASCL1). There should…

Continue Reading Separate exogenous from endogenous transcripts using Salmon RNAseq DTU

Mitogenome of a stink worm (Annelida: Travisiidae) includes degenerate group II intron that is also found in five congeneric species

Tan, M. H. et al. Comparative mitogenomics of the Decapoda reveals evolutionary heterogeneity in architecture and composition. Sci. Rep. 9, 1–16 (2019). ADS  Google Scholar  Zhang, Y. et al. Phylogeny, evolution and mitochondrial gene order rearrangement in scale worms (Aphroditiformia, Annelida). Mol. Phylogenet. Evol. 125, 220–231 (2018). CAS  PubMed  Google…

Continue Reading Mitogenome of a stink worm (Annelida: Travisiidae) includes degenerate group II intron that is also found in five congeneric species

Frontiers | Machine Learning and Deep Learning Applications in Metagenomic Taxonomy and Functional Annotation

Introduction The study of the microbial environments has benefited from the sequencing revolution, where technology improvement decreased the DNA sequencing cost and increased the number of sequenced nucleic bases. For approximately 20 years (depending on how we define the term metagenomics), it has allowed the decryption of the microbial composition…

Continue Reading Frontiers | Machine Learning and Deep Learning Applications in Metagenomic Taxonomy and Functional Annotation

TargetScanHuman 7.1

TargetScanHuman 7.1 * broadly conserved = conserved across most vertebrates, usually to zebrafish  conserved = conserved across most mammals, but usually not beyond placental mammals TargetScan predicts biological targets of miRNAs by searching for the presence of conserved 8mer, 7mer, and 6mer sites that match the seed region of each…

Continue Reading TargetScanHuman 7.1

GPP Web Portal – Transcript Details

Transcript: Human XR_933717.2 PREDICTED: Homo sapiens uncharacterized LOC105371334 (LOC105371334), ncRNA. Source: NCBI, updated 2019-09-08 Taxon: Homo sapiens (human) Gene: LOC105371334 (105371334) Length: 321 CDS: (non-coding) sgRNA constructs matching this transcript (CRISPRko, NGG PAM) This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of…

Continue Reading GPP Web Portal – Transcript Details

A cell-based phenotypic library selection and screening approach for the de novo discovery of novel functional chimeric antigen receptors

Cell lines and culture Unless stated otherwise, all tumor target cell lines were sourced from the ATCC via LGC Standards. Human endogenous mesothelin (MSLN)-positive target cell lines H-226 (lung carcinoma, MSLN+, ATCC® CRL-5826™) and AsPC-1 (ATCC CRL-1682), and MSLN-negative Raji control cells (ATCC CCL-86) were cultured in RPMI-1640 Glutamax (Life Technologies,…

Continue Reading A cell-based phenotypic library selection and screening approach for the de novo discovery of novel functional chimeric antigen receptors

New bioinformatics method to analyze viral sgRNA

Single guide ribonucleic acid (sgRNA) molecules are produced by discontinuous transcription, in which viral RNA-dependant RNA polymerase pauses early negative-sense RNA synthesis and then jumps to the other end of the genome. The specifics of this process are still not fully understood. Since sgRNAs can play an important role in…

Continue Reading New bioinformatics method to analyze viral sgRNA

AAV ShRNA Cloning Service – CD Biospeeds

AAV ShRNA Cloning Service AAV ShRNA Cloning Service Adeno-associated virus (AAV) is a type of parvovirus. Its genome is single-stranded DNA and has the ability to infect both dividing and non-dividing cells. Adenovirus or herpes virus is usually needed to help it replicate and expand in the…

Continue Reading AAV ShRNA Cloning Service – CD Biospeeds

Human microRNA inhibits expression of pathogenic gene underlying facioscapulohumeral muscular dystrophy

Fig. 1: miR-675 targets the DUX4 ORF and 3′UTR. a RenLuc-DUX4-FL dual-luciferase reporter and CMV.H19 constructs, and U6.MIR675, H1.MIR675, U6.MIR675-3p, and U6.MIR675-5p miRNAs. RenLuc-DUX4-FL contains DUX4 ORF and 3′UTR sequences fused to Renilla luciferase after the stop codon. Exons 1–3 are indicated (Ex1,2,3). *SD5 indicates silent mutation of a cryptic…

Continue Reading Human microRNA inhibits expression of pathogenic gene underlying facioscapulohumeral muscular dystrophy

ncRNA | Free Full-Text | Common Features in lncRNA Annotation and Classification: A Survey

CONC 2006 SVM Eukaryotes (both protein-coding and non-coding genes) peptide length, amino acid composition, predicted secondary structure content, mean hydrophobicity, percentage of residues exposed to solvent, sequence compositional entropy, number of homologues, alignment entropy 10-fold CV on protein-coding: F1-score: 97.4% ☼ Precision: 97.1% ☼ Recall: 97.8% ◙ On non-coding: F1-score:…

Continue Reading ncRNA | Free Full-Text | Common Features in lncRNA Annotation and Classification: A Survey

How to find the longest orf from a transcriptome

How to find the longest orf from a transcriptome 0 Hello, good day, sorry for the simplicity but, I have a super basic question. I have been trying to identify the longest ORF of a transcriptome for a long time, but from the previous failed attempts it seems that it…

Continue Reading How to find the longest orf from a transcriptome

How to get the nucleotide sequence through ORF information?

How to get the nucleotide sequence through ORF information? 0 I have a file with ORF information, including the start position and end position on the chromosome. At first I wanted to create a bed file, and then use the getFastaFromBed of bedtools to get the sequence. But I found…

Continue Reading How to get the nucleotide sequence through ORF information?

EMBOSS transeq lines with “(REVERSE SENSE)” in not reverse sence translations(?)

EMBOSS transeq lines with “(REVERSE SENSE)” in not reverse sence translations(?) 0 Hi good day. Sorry, I have a silly doubt, if someone could help me I would really appreciate it. You see, I’m using EMBOSS’s transeq tool (something new for me) to translate an ORF file. When translating the…

Continue Reading EMBOSS transeq lines with “(REVERSE SENSE)” in not reverse sence translations(?)

Emergence and expansion of highly infectious spike protein D614G mutant SARS-CoV-2 in central India

COVID-19 laboratory screening Nasopharyngeal/Nasal/Oropharyngeal swabs in viral transport medium (VTM) received from acute phase patients with defined symptoms, asymptomatic cases with contact history with positive patients/ travel history were processed for laboratory confirmation of SARS-CoV-2 at Defence Research and Development Establishment, (DRDE) Gwalior, M.P., India. These samples were referred for…

Continue Reading Emergence and expansion of highly infectious spike protein D614G mutant SARS-CoV-2 in central India

High-purity production and precise editing of DNA base editing ribonucleoproteins

Abstract Ribonucleoprotein (RNP) complex–mediated base editing is expected to be greatly beneficial because of its reduced off-target effects compared to plasmid- or viral vector–mediated gene editing, especially in therapeutic applications. However, production of recombinant cytosine base editors (CBEs) or adenine base editors (ABEs) with ample yield and high purity in…

Continue Reading High-purity production and precise editing of DNA base editing ribonucleoproteins

DESeq2 with a small number of genes

DESeq2 with a small number of genes 1 Dear all, I am writing a program in order to study the coverage of only one sequence. To sum up the pipeline: Detect ORFs in the input sequence Align all reads on the sequence (bowtie), reads come from RNA-seq Count the number…

Continue Reading DESeq2 with a small number of genes

New Mac program for molecular biologists

Tool:New Mac program for molecular biologists 12 I would like to present here a program – BioLabDonkey – for molecular biologists who are Mac users. This program is written from scratch in a language native for Mac – Swift. The program can be downloaded from mac App Store – apps.apple.com/us/app/biolabdonkey/id1470827582?ls=1&mt=12…

Continue Reading New Mac program for molecular biologists