Tag: PASS

Tutorial on Box Plot in ggplot2 with Examples – MLK

Introduction Boxplots are a useful visualization technique to understand the distribution and outliers in a dataset. In this article, we will go through the tutorial for box plot in ggplot2 function of R which is a popular visualization package. We will first understand the syntax of ggplot2 function geom_boxplot() for…

Continue Reading Tutorial on Box Plot in ggplot2 with Examples – MLK

Optical Coherence Tomography Based Biomechanical Fluid-Structure Interaction Analysis of Coronary Atherosclerosis Progression

There is a need to determine which atherosclerotic lesions will progress in the coronary vasculature to guide intervention before myocardial infarction occurs. This article outlines the biomechanical modeling of arteries from Optical Coherence Tomography using fluid-structure interaction techniques in a commercial finite element solver to help predict this progression. Atherosclerosis…

Continue Reading Optical Coherence Tomography Based Biomechanical Fluid-Structure Interaction Analysis of Coronary Atherosclerosis Progression

Cell-free DNA for the detection of emerging treatment failure in relapsed/ refractory multiple myeloma

Interrogation of cell-free DNA (cfDNA) represents an emerging approach to non-invasively estimate disease burden in multiple myeloma (MM). Here, we examined low-pass whole genome sequencing (LPWGS) of cfDNA for its predictive value in relapsed/ refractory MM (RRMM). We observed that cfDNA positivity, defined as ≥10% tumor fraction by LPWGS, was…

Continue Reading Cell-free DNA for the detection of emerging treatment failure in relapsed/ refractory multiple myeloma

Process Development for the Production and Purification of Adeno-Associated Virus (AAV)2 Vector using Baculovirus-Insect Cell Culture System

In this protocol, AAV2 vector is produced by co-culturing Spodoptera frugiperda (Sf9) insect cells with baculovirus (BV)-AAV2-green fluorescent protein (GFP) or therapeutic gene and BV-AAV2-rep-cap infected Sf9 cells in suspension culture. AAV particles are released from the cells using detergent, clarified, purified by affinity column chromatography, and concentrated by tangential…

Continue Reading Process Development for the Production and Purification of Adeno-Associated Virus (AAV)2 Vector using Baculovirus-Insect Cell Culture System

Plink Alternative Phenotype File Columns not being Read

Plink Alternative Phenotype File Columns not being Read 0 Hi, I have a plink alternative phenotype file with the following format: FID IID Phenotype 1 2 1 1 3 0 etc. As outlined in the plink documentation. zzz.bwh.harvard.edu/plink/data.shtml#pheno However, when I run the following command : plink –bfile ../Plink_Files/plink –logistic…

Continue Reading Plink Alternative Phenotype File Columns not being Read

Bug#1003563: aide: autopkgtest regression: unexpected character: ‘@’ in /etc/aide/aide.conf.d/31_aide_spamassassin

Source: aide Version: 0.17.3-6 X-Debbugs-CC: debi…@lists.debian.org Severity: serious User: debi…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of aide the autopkgtest of aide fails in testing when that autopkgtest is run with the binary packages of aide from unstable. It passes when run with only packages from testing. In…

Continue Reading Bug#1003563: aide: autopkgtest regression: unexpected character: ‘@’ in /etc/aide/aide.conf.d/31_aide_spamassassin

Getting number of arguments error with scikit rfe ( Python, Scikit Learn )

Problem : ( Scroll to solution ) I am learning machine learning and came across this error. I think it is an issue with my local setup. # Importing RFE and LinearRegression from sklearn.feature_selection import RFE from sklearn.linear_model import LinearRegression # Running RFE with the output number of the variable…

Continue Reading Getting number of arguments error with scikit rfe ( Python, Scikit Learn )

Microtubule Plus-End Dynamics Visualization in Huntington’s Disease Model based on Human Primary Skin Fibroblasts

This protocol is dedicated to the microtubule plus-end visualization by EB3 protein transfection to study their dynamic properties in primary cell culture. The protocol was implemented on human primary skin fibroblasts obtained from Huntington’s disease patients. The Huntington’s disease, HD, is an incurable, neurodegenerative pathology caused by a mutation in…

Continue Reading Microtubule Plus-End Dynamics Visualization in Huntington’s Disease Model based on Human Primary Skin Fibroblasts

swagger – How to define this array of objects in OpenAPI?

How to write an OpenAPI definition for the following JSON? Bazically it is an array consisting of two objects with similar attributes but different fields. [ { “studentname”: “somename”, “studentrollno”: “somerollno”, “studentsubjects”: [ { “level”: “third”, “physics”: “xyz”, “maths”: “somevalue” }, { “level”: “second”, “physics”: “abc”, “maths”: “somevalue11” } ],…

Continue Reading swagger – How to define this array of objects in OpenAPI?

Bug#1003017: dulwich: autopkgtest regression: src/debian/tests/testsuite3: 10: -m: not found

Source: dulwich Version: 0.20.26-1 X-Debbugs-CC: debian…@lists.debian.org Severity: serious User: debian…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of dulwich the autopkgtest of dulwich fails in testing when that autopkgtest is run with the binary packages of dulwich from unstable. It passes when run with only packages from testing. In…

Continue Reading Bug#1003017: dulwich: autopkgtest regression: src/debian/tests/testsuite3: 10: -m: not found

Stan vs PyMC3 vs Bean Machine

I have been a light user of Stan and RStan for some time and while there are a lot of things I really like about the language (such as the awesome community you can turn to for support and ShinyStan for inspecting Stan output) there are also a few things…

Continue Reading Stan vs PyMC3 vs Bean Machine

Columntransformer & pipeline with ohe – is the ohe encoded field retained or removed after ct is performed? ( Python, Scikit Learn )

Problem : ( Scroll to solution ) Doc on CT: remainder{‘drop’, ‘passthrough’} or estimator, default=’drop’ By default, only the specified columns in transformers are transformed and combined in the output, and the non-specified columns are dropped. (default of ‘drop’). By specifying remainder=”passthrough”, all remaining columns that were not specified in…

Continue Reading Columntransformer & pipeline with ohe – is the ohe encoded field retained or removed after ct is performed? ( Python, Scikit Learn )

Auto updating website that tracks closed & open issues/PRs on scikit-learn/scikit-learn.

Live webpage Auto updating website that tracks closed & open issues/PRs on scikit-learn/scikit-learn. Running locally Setup a virtual environment. Install requirements pip install -r requirements Create a personal access token and set it to GITHUB_TOKEN. Run the following to call the GitHub API for repo information and cache the results…

Continue Reading Auto updating website that tracks closed & open issues/PRs on scikit-learn/scikit-learn.

clusterExport, environment and variable scoping

You’re getting the error when calling clusterExport(cl, list(“a”, “b”, “data”)) because clusterExport is trying to find the variables in .GlobalEnv, but fn1 isn’t setting them in .GlobalEnv but in its own local environment. An alternative is to pass the local environment of fn1 to fn2, and specify that environment to…

Continue Reading clusterExport, environment and variable scoping

Bug#1002588: wurlitzer: autopkgtest regression on ppc64el: AssertionError: assert 65536 == 32768

Source: wurlitzer Version: 3.0.2-3 X-Debbugs-CC: debian…@lists.debian.org Severity: serious User: debian…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of wurlitzer the autopkgtest of wurlitzer fails in testing when that autopkgtest is run with the binary packages of wurlitzer from unstable on ppc64el. It passes when run with only packages from…

Continue Reading Bug#1002588: wurlitzer: autopkgtest regression on ppc64el: AssertionError: assert 65536 == 32768

Delightful code generation for OpenAPI specs for Swift written in Swift

Delightful code generation for OpenAPI specs for Swift written in Swift. Fast: processes specs with 100K lines of YAML in less than a second Smart: generates Swift code that looks like it’s written by hand Reliable: tested on 500K lines of publically available OpenAPI specs producing correct code every time…

Continue Reading Delightful code generation for OpenAPI specs for Swift written in Swift

Science snapshots from Berkeley Lab

image: 3D image of melanin in a zebrafish sample captured by micro-computed tomography. view more  Credit: Spencer R. Katz and Daniel J. Vanselow, Penn State College of Medicine) Adapted from a UC Berkeley news release To date, CRISPR enzymes have been used to edit the genomes of one type of cell…

Continue Reading Science snapshots from Berkeley Lab

Harvard University hiring Bioinformatics Engineer in Boston, Massachusetts, United States

Job-Specific ResponsibilitiesWe are looking for a motivated bioinformatics engineer to join the Department of Biomedical Informatics at Harvard Medical School, to build platforms for genome analysis. Genome sequencing is becoming a routine approach for diagnosing genetic diseases. As the number of patients referred to genetic screening is increasing, there is…

Continue Reading Harvard University hiring Bioinformatics Engineer in Boston, Massachusetts, United States

Bug#1001735: node-trust-keyto: autopkgtest regression: Cannot find module ‘@trust/keyto’

Source: node-trust-keyto Version: 2.0.0~alpha1-1 X-Debbugs-CC: debian…@lists.debian.org Severity: serious User: debian…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of node-trust-keyto the autopkgtest of node-trust-keyto fails in testing when that autopkgtest is run with the binary packages of node-trust-keyto from unstable. It passes when run with only packages from testing. In…

Continue Reading Bug#1001735: node-trust-keyto: autopkgtest regression: Cannot find module ‘@trust/keyto’

bcftools merge of over 9000+ vcf files

Hi all, I have around 9000+ vcf files that I’m trying to merge using bcftools merge. They are all located in their own folder so essentially I have a folder containing 9000+ separate folders, each containing one vcf.gz file. I have tried out the following code via this tutorial bcftools…

Continue Reading bcftools merge of over 9000+ vcf files

How does the new SageMaker Studio Lab compare to Colab and Kaggle?

Taken from benjaminwarner.dev Machine Heart Compilation SageMaker Studio Lab will be a strong competitor in the field of free computing resources. A week ago, Amazon launched the free simplified version of SageMaker Studio SageMaker Studio Lab, providing a CPU instance with a time limit of 12 hours and a GPU…

Continue Reading How does the new SageMaker Studio Lab compare to Colab and Kaggle?

[BUG] (python-fastapi) OneOf class not generated

Bug Report Checklist Description For oneOf fields, the python-fastapi server generator creates a function that returns a OneOf* class, but that class itself is not generated. For example, for an API like /status: get: summary: Get the status of the upstream server responses: 200: description: successful operation content: application/json: schema:…

Continue Reading [BUG] (python-fastapi) OneOf class not generated

Pytorch implementation of Bert (super detailed)

B Station video explanation This article mainly introduces how to use PyTorch Reappear BERT. Please spend it first 10 Minutes to read my article BERT Detailed explanation ( Incidental ELMo、GPT Introduce ), Let’s look at this article , In order to achieve enlightenment , Get twice the result with half…

Continue Reading Pytorch implementation of Bert (super detailed)

Swagger Routes Express – Open Source Agenda

Connect Express route controllers to restful paths using a Swagger v2 or OpenAPI v3 definition file. Assumptions This library assumes you are using: NodeJS version 6.4.0 or better, expressjs any version, and swagger version 2, or OpenAPI version 3. Install Add swagger-routes-express as a dependency: npm i swagger-routes-express Examples A…

Continue Reading Swagger Routes Express – Open Source Agenda

Fairring (FAIR + Herring) is a plug-in for PyTorch that provides a process group for distributed training that outperforms NCCL at large scales

TL;DR: Using a variation on Amazon’s “Herring” technique, which leverages reduction servers, we can perform the all-reduce collective faster than NCCL: up to 2x as fast as NCCL in microbenchmarks up to 50% speedup in end-to-end training workloads You can use it right away in your project, with no code…

Continue Reading Fairring (FAIR + Herring) is a plug-in for PyTorch that provides a process group for distributed training that outperforms NCCL at large scales

Easy OpenAPI specs and Swagger UI for your Flask API

Easy Swagger UI for your Flask API Flasgger is a Flask extension to extract OpenAPI-Specification from all Flask views registered in your API. Flasgger also comes with SwaggerUI embedded so you can access localhost:5000/apidocs and visualize and interact with your API resources. Flasgger also provides validation of the incoming data,…

Continue Reading Easy OpenAPI specs and Swagger UI for your Flask API

How to clear Cuda memory in PyTorch

Hello Guys, How are you all? Hope You all Are Fine. Today We Are Going To learn about How to clear Cuda memory in PyTorch in Python. So Here I am Explain to you all the possible Methods here. Without wasting your time, Let’s start This Article. How to clear Cuda…

Continue Reading How to clear Cuda memory in PyTorch

Bioinformatics Librarian job with University of Pennsylvania

Bioinformatics Librarian University Overview The University of Pennsylvania, the largest private employer in Philadelphia, is a world-renowned leader in education, research, and innovation. This historic, Ivy League school consistently ranks among the top 10 universities in the annual U.S. News & World Report survey. Penn has 12 highly-regarded schools that…

Continue Reading Bioinformatics Librarian job with University of Pennsylvania

Implementing a low level function – C++

Hi, I would like to work on this issue: github.com/pytorch/pytorch ## 🚀 Feature This is an operation that is almost the inverse of `where`. Let’…s call it `sieve`. It takes as input a tensor `A` and a boolean tensor `B` of the same shape and a “fill” value `c`. It…

Continue Reading Implementing a low level function – C++

Extracting Number of SNPs via parsing MD tags

Hello all, I’m having a bit of difficulty wrapping my head around a task involving extracting the total number of SNPs from an alignment via creating a string parser/grep command which would be able to extract only the SNPs and ignoring indels. I am currently using a python script utilising…

Continue Reading Extracting Number of SNPs via parsing MD tags

Scientists Discover How mRNA Therapeutics Are Delivered Into Cells

An LNP is located on a long endosomal tubule (green), together with a perpendicular disperse mRNA signal (cyan), and likely representing an instance of mRNA (purple) escape. Credit: Marino Zerial / MPI-CBG Researchers have found where and how mRNA arrives in a cell to modify or deliver genetic information, a…

Continue Reading Scientists Discover How mRNA Therapeutics Are Delivered Into Cells

How do I access inflection points in Seurat object?

How do I access inflection points in Seurat object? 0 I ran the following code below to calculate inflection points for the UMI counts for my single cell data using Seurat. seurat_obj <- CalculateBarcodeInflections(seurat_obj,barcode.column = “nCount_RNA”,group.column = “orig.ident”,threshold.low = NULL,threshold.high = NULL) I want to obtain the inflection points so…

Continue Reading How do I access inflection points in Seurat object?

Aligning large sets of sequences

Hello folks, I am seeking an advice on Multiple Sequence Alignment that I am trying to get. The fasta file i am trying to align belongs to Sars-Cov-2 Spike protein, it has nearly 600k sequences and ranges from 1270-1275 aa. I have aligned with clustalo and mafft with default parameters….

Continue Reading Aligning large sets of sequences

Package – koa2-oas3-x

Requirements Node.js Version 8+ OpenAPI 3 Koa2 Usage const koa2OA3 = require(‘@overspeed/koa2-oas3’); const _ = require(‘koa-route’); const Koa = require(‘koa’); const app = new Koa(); const specUri = ‘https://api.swaggerhub.com/apis/overspeedio/Koa2Oas3Example/1.0.0’; // default options const koa2OA3Options = { mergeRemoteRefs: false, renderDocs: true, docsPath: ‘/docs’ }; // apply middleware koa2OA3(app, specUri, koa2OA3Options) .then(()…

Continue Reading Package – koa2-oas3-x

docker – JupyterHub “400 : Bad Request OAuth state missing from cookies” generic authentication

I am trying to deploy a jupyterhub service behind a NGINX reverse proxy on OpenStack and using the generic authentication class to authenticate users from an external OIDC provider. After redirecting from the authentication server I get a “400: Bad Request OAuth state missing from cookies” error message. Here are…

Continue Reading docker – JupyterHub “400 : Bad Request OAuth state missing from cookies” generic authentication

increasing word size extremely slows down the search

standalone blastp: increasing word size extremely slows down the search 1 Hello, I need to blastp a genome (15,000 seqs) against genome (12,000 seqs) using Biopython. I decided to use local blast and query genome 1 fasta file against genome 2 database ( made by makeblastdb command with second genome…

Continue Reading increasing word size extremely slows down the search

How to handle VCFs from the same sample but using different aligners and variant callers?

Hi, I’m using whole-exome sequencing (WES) for somatic variant calling. During the process, I tried to follow the approach described here: pubmed.ncbi.nlm.nih.gov/28420412/ Basically my workflow is as follows: FASTQ preprocessing: Using 2 aligners (BWA-MEM, Bowtie2) BAM calibration Variant calling: Using 3 software (Mutect2, Strelka2, Lancet) Variant filtering: I keep just…

Continue Reading How to handle VCFs from the same sample but using different aligners and variant callers?

Alchemy skill — a skill from kaggle silver medal to gold medal.

Alchemy notes dry goods author :RSJ & Devo , Alchemy notes Three gold data expansion skills brief introduction stay Kaggle Google Brain In the series competition , The third player integrates three data expansion strategies on the basis of Feature Engineering, which greatly improves the prediction effect of the model…

Continue Reading Alchemy skill — a skill from kaggle silver medal to gold medal.

add gene names to ‘isec’ output files of bcftools’

add gene names to ‘isec’ output files of bcftools’ 1 I had two vcf files and I used isec from bcftools software to find typical and common mutations between samples. The output of isec function were four vcf.gz file showing like below: isec_output/0000.vcf.gz would be variants unique to 1.vcf.gz isec_output/0001.vcf.gz…

Continue Reading add gene names to ‘isec’ output files of bcftools’

I can’t get a dossage file using PLINK

Hi, I have been trying to get a dosage file from vcf, map and fam files. For that, I have written this bash script : plink –fam plink.fam –map plink.map –dosage one.vcf –write-dosage However, I got this error: –dosage: Reading from one.vcf. Error: Line 1 of one.vcf has fewer tokens…

Continue Reading I can’t get a dossage file using PLINK

Dissemination of Mycobacterium abscessus via global transmission networks

Dataset construction, cluster identification and definition of DCCs Whole genome sequencing of two collections of isolates from Manchester, UK, and the Netherlands was carried out as previously described2. Briefly, DNA was extracted from colony sweeps of subcultured samples before to paired-end sequencing using the Illumina HiSeq platform. These samples were…

Continue Reading Dissemination of Mycobacterium abscessus via global transmission networks

CVC Files Opposition to ToolGen Substantive Motion No. 1 | McDonnell Boehnen Hulbert & Berghoff LLP

On July 15th, Junior Party the University of California/Berkeley, the University of Vienna, and Emmanuelle Charpentier (collectively, “CVC”) filed its Opposition to Senior Party ToolGen’s Substantive Motion No. 1 for benefit of priority to U.S. Provisional Application No. 61/837,481, filed June 20, 2013 (“P3” or “ToolGen P3”), or alternatively, International…

Continue Reading CVC Files Opposition to ToolGen Substantive Motion No. 1 | McDonnell Boehnen Hulbert & Berghoff LLP

gmod animation commands

Intensity of magnade’s attraction to a hunter. Learn how your comment data is processed. Find key bound to specified command string. Insomnia65 August 12, 2019 – TF2 Team. if you find this, don’t go around enabling it and then complaining about issues. The “size in K” is the block size…

Continue Reading gmod animation commands

PacBio’s $600 million Omniome acquisition brings together long and short DNA sequencing

Nearly three years ago, when Pacific Biosciences agreed to be acquired by Illumina, the acquisition was positioned as a pair of companies with complementary DNA sequencing technologies. Antitrust regulators believe that this is not the case, causing these companies to abandon the deal. PacBio now has another deal that aims…

Continue Reading PacBio’s $600 million Omniome acquisition brings together long and short DNA sequencing

Native plants of Cayman – Cayman Compass

Solanum havanense Jacq. is a rare find, but worth the discovery. Solanum havanense Jacq.SOLANACEAE DescriptionNot to be mistaken for the spineless Solanum nitidum with long narrow leaves that can be found between Central Ecuador to Chili, our compact woody shrub is also a spineless Solanum and is considered rare in…

Continue Reading Native plants of Cayman – Cayman Compass

Pop’s Surprising Influence on Mom’s DNA | Science

Women have struggled to gain equality in society, but biologists have long thought that females wield absolute power in a sphere far from the public eye: in the mitochondria, cellular organelles whose DNA is thought to pass intact from mother to child with no paternal influence. A study in tomorrow’s…

Continue Reading Pop’s Surprising Influence on Mom’s DNA | Science

How to pipe awk of bed file into samtools to extract fasta sequences?

How to pipe awk of bed file into samtools to extract fasta sequences? 1 I have a bed file (seq.bed) that contains “queryID queryStart queryEnd”. Following is the example (the content of seq.bed file). SRR5892231.6 28 178 SRR5892231.7 4 307 SRR5892231.7 16 307 SRR5892231.9 216 408 I would like to…

Continue Reading How to pipe awk of bed file into samtools to extract fasta sequences?

gnomAD v3 link not working for download

gnomAD v3 link not working for download 1 your URL is wrong. $ wget -q -O – “https://storage.googleapis.com/gcp-public-data–gnomad/release/3.1.1/vcf/genomes/gnomad.genomes.v3.1.1.sites.chr1.vcf.bgz” | gunzip -c | head ##fileformat=VCFv4.2 ##hailversion=0.2.64-1ef70187dc78 ##FILTER=<ID=AC0,Description=”Allele count is zero after filtering out low-confidence genotypes (GQ < 20; DP < 10; and AB < 0.2 for het calls)”> ##FILTER=<ID=AS_VQSR,Description=”Failed VQSR filtering…

Continue Reading gnomAD v3 link not working for download

De-extinction Could Reverse Species Loss. But Should We Do It?

THE MOST BELOVED BIRD IN HISTORY may very well have been a 29-year-old pigeon by the name of Martha. It was the early 1900s, shortly before the United States entered the First World War, and Martha was at the height of her fame. Perched on her humble roost at the Cincinnati…

Continue Reading De-extinction Could Reverse Species Loss. But Should We Do It?

Is a variant worse than Delta on the way? Viral evolution offers clues.

Somewhere in India last October, a person—likely immunocompromised, perhaps taking drugs for rheumatoid arthritis or with an advanced case of HIV/AIDS—developed COVID-19. Their case might have been mild, but because of their body’s inability to clear the coronavirus it lingered and multiplied. As the virus replicated and moved from one…

Continue Reading Is a variant worse than Delta on the way? Viral evolution offers clues.

Question about ROH analysis by Plink 1.9

Hi all, I have recently tried to estimate runs of homozygosity (ROH) from my vcf file by using plink 1.9. I ran following code to generate binary files that plink required: plink –vcf myfile.vcf –make-bed –out out_name –no-sex –no-parents –no-fid –no-pheno –allow-extra-chr This vcf file only contains one individual and…

Continue Reading Question about ROH analysis by Plink 1.9

Install alphafold on the local machine, get out of docker.

AlphaFold This package provides an implementation of the inference pipeline of AlphaFold v2.0. This is a completely new model that was entered in CASP14 and published in Nature. For simplicity, we refer to this model as AlphaFold throughout the rest of this document. Any publication that discloses findings arising from…

Continue Reading Install alphafold on the local machine, get out of docker.

How to Find Healthcare Data Scientist Jobs Remote | Branded Voices

Details A remote healthcare data scientist works for designing programs and software that are helpful in the analysis of healthcare information, and medical records. Remote healthcare data science jobs allow workers to execute their exterior to conventional office settings. Instead of computing and analysis on the office and hospital desks,…

Continue Reading How to Find Healthcare Data Scientist Jobs Remote | Branded Voices

New publication in European Urology demonstrates value of PredicineCARE liquid biopsy test for monitoring PD-L1 immunotherapy in patients with metastatic prostate cancer | News

HAYWARD, Calif., Sept. 16, 2021 /PRNewswire-PRWeb/ — Predicine, Inc. announced today results from a liquid biopsy study demonstrating the clinical application of utilizing the PredicineCARE liquid biopsy NGS assay to serially monitor changes in ctDNA levels in patients with metastatic castration-resistant prostate cancer (mCRPC). The European Urology study evaluated the effects…

Continue Reading New publication in European Urology demonstrates value of PredicineCARE liquid biopsy test for monitoring PD-L1 immunotherapy in patients with metastatic prostate cancer | News

Cracking the code | The West Australian

Advances in technology have helped harness the power of genomic sequencing, offering new hope in the fight against genetic diseases. Katie Hampson reports. What was once a pipe dream to early genetics researchers is now a reality as the genomic age brings new ways to detect and treat disease, and…

Continue Reading Cracking the code | The West Australian

Oxford Nanopore ready to go public

Oxford Nanopore, UK-based Genomics Company, is preparing to list on the London Stock Exchange. The company’s DNA sequencing devices have been crucial in identifying and tracking the spread of Covid-19 variants around the world, and it said its revenues had risen 22 per cent to £59 million ($81 million) in…

Continue Reading Oxford Nanopore ready to go public

Intersecting compressed gVCF with bed file

Intersecting compressed gVCF with bed file 1 This may be a ridiculously simple question to ask but, I have a compressed genomic VCF file generated by the Strelka germline variant caller, with lines like the following, where no variation was detected: chr1 27394730 . T . . PASS END=27394756;BLOCKAVG_min30p3a GT:GQX:DP:DPF:MIN_DP…

Continue Reading Intersecting compressed gVCF with bed file

Mosquitoes Sterilized by CRISPR Powered Precision System

Each year millions around the world are infected by dengue, chikungunya, and Zika viruses. The principal culprit behind the transmission of these deadly diseases is the mosquito vector, Aedes aegypti. Conventional methods of pest control have so far fallen short. To curb the spread of A. aegypti, researchers at the…

Continue Reading Mosquitoes Sterilized by CRISPR Powered Precision System

The taxonomy of two uncultivated fungal mammalian pathogens is revealed through phylogeny and population genetic analyses

After 90 years of taxonomic uncertainties, using phenotypic, phylogenetic, and population genetics analyses, the two uncultivated fungi causing skin disease in humans and dolphins, long known as Lacazia loboi8, are now placed as separate species within the genus Paracoccidioides. Early studies using phenotypic or phylogenetic data alone erroneously placed these two…

Continue Reading The taxonomy of two uncultivated fungal mammalian pathogens is revealed through phylogeny and population genetic analyses

Embrace WDNA as BioRevolution Gains Momentum

Investors looking for innovative companies and disruptive growth opportunities without excessive exposure to the technology sector would do well to check out healthcare. Arguably, healthcare is the most innovative sector aside from tech and the one with the next largest arena of disruptive growth opportunities. However, many traditional healthcare exchange…

Continue Reading Embrace WDNA as BioRevolution Gains Momentum

Bioinformatics Systems Analyst – Job posted on PostdocJobs.com

Job Description Job-Specific Responsibilities The Department of Biomedical Informatics (DBMI) at Harvard Medical School is looking for a Bioinformatics Systems Analyst to help us build cutting-edge research platforms. We seek an individual to work on our multidisciplinary team of data scientists, medical doctors, post-doctoral fellows, project managers, and software developers….

Continue Reading Bioinformatics Systems Analyst – Job posted on PostdocJobs.com

Koala moms pass deadly virus to their joeys

Share this Article You are free to share this article under the Attribution 4.0 International license. Mother koalas are transferring a deadly virus, called koala retrovirus, to their joeys, a new study shows. The virus can cause immune depletion and cancer. It also predisposes koalas to chlamydia and other diseases…

Continue Reading Koala moms pass deadly virus to their joeys

World in a drop of water: DNA tool transforms nature tracking

In their search for pink river dolphins, researchers in the Peruvian Amazon scooped up river water containing genetic material they hoped could be useful in tracing the elusive creature. They found what they were looking for, and more. The environmental DNA collected yielded information on 675 species, including dozens of…

Continue Reading World in a drop of water: DNA tool transforms nature tracking

mitochondrial dna damage triggers an ifn mediated immune response

2.6 Mitochondrial Damage-Induced Mitochondrial DNA Release is Central to Chronic Kidney Disease-Induced Type-I-Interferon Response in Vascular Smooth Muscle Cells DNA released from nuclear or mitochondria is the main source of endogenous DNA that activates cGAS-STING pathway. This is thought to be mediated by the presence 75 of leaked mitochondrial DNA…

Continue Reading mitochondrial dna damage triggers an ifn mediated immune response

Google Getting Into Genomics? It Already Is

Google parent Alphabet (NASDAQ:GOOG) has a long history of disruption and one that extends far beyond internet search and advertising. As such, it’s not surprising that the stock makes appearances in exchange traded funds such as the ARK Space Exploration and Innovation ETF (ARKX) and the ARK Autonomous Technology &…

Continue Reading Google Getting Into Genomics? It Already Is

To find new antibiotics, will technology overtake underwater exploration?

LAKE SUPERIOR — Choppy, windswept waves slap at the hull as our boat nears the last known location of the Lucerne, a schooner that sank to the bottom of Lake Superior in 1886. The wreck, just off a narrow sand peninsula jutting from the northern tip of Wisconsin, doubles as…

Continue Reading To find new antibiotics, will technology overtake underwater exploration?

The History Of DNA Sequencing and Its Importance In Life Forms

DNA sequencing has helped develop various sectors of the economy and mainly in the health sector. DNA sequencing has helped scientists understand the causes of related genetic disorders and how to cure them. DNA sequencing has also helped scientists understand the evolution of different animal species. What about developing GMOs?…

Continue Reading The History Of DNA Sequencing and Its Importance In Life Forms

DNA tool transforms nature tracking

Some animals, like the Amazon pink river dolphin are tricky to track using conventional methods. In their search for pink river dolphins, researchers in the Peruvian Amazon scooped up river water sloshing with genetic material that they hoped could trace the elusive creatures. They found what they were looking for….

Continue Reading DNA tool transforms nature tracking

RTL Today – Tracing elusive creatures: The world in a drop of water: DNA tool transforms nature tracking

In their search for pink river dolphins, researchers in the Peruvian Amazon scooped up river water sloshing with genetic material that they hoped could trace the elusive creatures. They found what they were looking for. And then some. The environmental DNA collected yielded information on 675 species, including dozens of…

Continue Reading RTL Today – Tracing elusive creatures: The world in a drop of water: DNA tool transforms nature tracking

kaggle datasets for tableau

The homepage is full of small visualizations telling stories about each data set. This is the default Tableau location (if you’ve not changed) so far. Transformation processes can also be referred to as data wrangling, or data munging, transforming and mapping data from one raw data form into another format…

Continue Reading kaggle datasets for tableau

Novel Test Distinguishes Benign From Malignant Lesions in NF1

A novel liquid biopsy test has been shown to distinguish between patients with neurofibromatosis type 1 (NF1) who have benign plexiform neurofibroma (PN) precursor lesions from patients who have malignant peripheral nerve sheath tumors (MPNST), say authors of a multi-institutional cross-sectional study. “Transformation from PN to MPNST is challenging to…

Continue Reading Novel Test Distinguishes Benign From Malignant Lesions in NF1

How to pass custom software specific variables to nf-core/sarek nextflow pipeline?

How to pass custom software specific variables to nf-core/sarek nextflow pipeline? 0 I’m attempting to call whole genome variants using nf-core/sarek nextflow pipeline. In QC step there is an option that invokes trim_galore quality trimming, but i don’t know how to pass my custom adapters to be cut as well….

Continue Reading How to pass custom software specific variables to nf-core/sarek nextflow pipeline?

nanopore sequencing stock

It holds a 15% stake in the company and has valued its holding at £340m, giving a valuation of more than £2bn for the company. . While the company’s current shareholders have recorded its value at just over £2bn, analysts . Essay from the year 2011 in the subject Business…

Continue Reading nanopore sequencing stock

VCFtools doesn’t keep any variants using GATK output

Hi guys! I’m having trouble using vcftools to filter snp through GATK output. For infomation, i used the command HaplotypeCallerto make SNP-calling of 12 samples ; i used the CombineGVCFs to join the 12 VCFS and make the joint call after merging the vcf files; i used the VarianFiltration for…

Continue Reading VCFtools doesn’t keep any variants using GATK output

Diffbind adding my own consensus peaks

I’m not entirely sure what you are actually trying to do. Are you trying to add this peakset to use as a consensus peakset for counting? If so you can specify it as a parameter to dba.count() by setting peaks=merged_narrowPeak_sorted without having to load it to look like a sample…

Continue Reading Diffbind adding my own consensus peaks

Validation of Low Coverage Whole Genome Sequencing for Mitochondrial DNA Variants Suggests Mitochondrial DNA as a Genetic Cause of Preterm Birth

doi: 10.1002/humu.24279. Online ahead of print. Zeyu Yang  1 , Jesse Slone  1 , Xinjian Wang  1 , Jack Zhan  1 , Yongbo Huang  2 , Bahram Namjou  2 , Kenneth M Kaufman  2   3 , Michael Pauciulo  1 , John B Harley  2   3 , Louis J Muglia  1   4 , Iouri Chepelev  2 , Taosheng Huang …

Continue Reading Validation of Low Coverage Whole Genome Sequencing for Mitochondrial DNA Variants Suggests Mitochondrial DNA as a Genetic Cause of Preterm Birth

Biologist Bioinformatics Server Administration Job in CLAY CENTER, NE

Overview Open & closing dates Opening and closing dates 09/02/2021 to 09/16/2021 Service Competitive Pay scale & grade GS 9 – 11 Salary $53,433 to $84,049 per year Appointment type Permanent Work schedule Full-time Locations 1 vacancy in the following location: Relocation expenses reimbursed No Telework eligible Yes as determined…

Continue Reading Biologist Bioinformatics Server Administration Job in CLAY CENTER, NE

Biologist (Bioinformatics) – USDA Employment

Job Description: This position is located within United States Department of Agriculture, Agricultural Research Service, ARS Field Organization, Northeast Area, Eastern Regional Research Center, Dairy and Functional Foods Research Service in Wyndmoor, PA. The incumbent works as part of a scientific team, providing bioinformatics resource pertaining to metagenomics, metabolomics, and…

Continue Reading Biologist (Bioinformatics) – USDA Employment

Moderna hiring Associate Director, Bioinformatics in Cambridge, Massachusetts, United States

The RoleModerna is seeking an Associate Director to join our Computational Science Department. You will provide scientific, technical, strategic and managerial leadership for a team of talented scientists working on a broad range of bioinformatics and computational biology activities, including the analysis and interpretation of diverse Next Generation Sequencing (NGS)…

Continue Reading Moderna hiring Associate Director, Bioinformatics in Cambridge, Massachusetts, United States

UC Santa Barbara Scientists Developed Genetically Modified Mosquitoes That Can’t See Humans

Scientists have just created mutant mosquitoes that cannot see contrasts. Although they are not completely blind, they can no longer find their way to their prey. An original strategy to fight mosquitoes carried diseases. Mutant Mosquitoes. Image Courtesy of Yinpeng Zhan et al., Current Biology. Imagine being able to become…

Continue Reading UC Santa Barbara Scientists Developed Genetically Modified Mosquitoes That Can’t See Humans

GSTAr.pl probelm running

GSTAr.pl probelm running 0 Hi, I want to run CleaveLand to analyze my degradome sequencing, however, I run with the below error. The resulting file is empty and when I check the Checking Dependencies, it shows me GSTAr: FAIL. I always get this error even running with the tutorial files….

Continue Reading GSTAr.pl probelm running

Extract multiple times a fasta sequence from a list by name

Hi everybody! I have uploaded on R a list of 9K fasta sequences, on which 40K SNPs map to – which means, some sequence host 1+ SNP. I have a R object (and a vcf as well) with the fasta sequences names and the SNP positions and I want to…

Continue Reading Extract multiple times a fasta sequence from a list by name

Twist (TWST) gains 3.56% on Strong Volume August 27

Last Price $ Last Trade Change $ Change Percent % Open $ Prev Close $ High $ low $ 52 Week High $ 52 Week Low $ Market Cap PE Ratio Volume Exchange TWST – Market Data & News Trade Today, Twist Bioscience Corp Inc’s (NASDAQ: TWST) stock gained…

Continue Reading Twist (TWST) gains 3.56% on Strong Volume August 27

Why Fortnite just isn’t the platform to teach kids about racism and MLK’s legacy

Fortnite recently teamed up with TIME to teach players about racism and Martin Luther King, Jr.’s legacy with the March Through Time event. It is a Creative mode event offering players a cosmetic reward in an effort to incentivize players to participate. The event kicked off yesterday and will stay…

Continue Reading Why Fortnite just isn’t the platform to teach kids about racism and MLK’s legacy

Python FASTA scripting

Python FASTA scripting 4 Hi all, I finally got that illusive Bioinformatician job and am now undergoing training. My first project is to write a FASTA parsing script that will take a FASTA file and split it into multiple files each containing a gene and its sequence. The task is…

Continue Reading Python FASTA scripting

The Future of Information Storage: DNA’s Use for Storing Data

Responsible for the construction of all living things, DNA formats organic data within an organism. DNA is, in essence, what instructs our body to create the proteins it needs to run. Created by a four letter alphabet of ACGT, the human genome comprises a unique sequence that is over 3…

Continue Reading The Future of Information Storage: DNA’s Use for Storing Data

bcftools multiallelic split not working

I am attempting to split multiallelic sites using bcftools norm with the following command: zcat ${inputVcf} | sed ‘s/AD,Number=./AD,Number=R/g’ | sed ‘s/ADR,Number=./ADR,Number=R/g’ | sed ‘s/ADF,Number=./ADF,Number=R/g’ | bcftools norm –fasta-ref ${genomeFa} –check-ref s –multiallelics -any –output ${outputVcf} The sed commands were based on the recommendation from here. However I’m still getting…

Continue Reading bcftools multiallelic split not working

Initu extraction and detection of DNA using nanopores

Extraction and detection of single-molecule DNA from cells using 3D integrated nanopores. Credit: Makusu Tsutsui et al. The ability to detect DNA from a single cell is important for the detection of diseases and hereditary diseases. Measurement of a single DNA molecule has long been possible. However, the sample cannot…

Continue Reading Initu extraction and detection of DNA using nanopores

Mapping unique GO term description given a specific GO id

Mapping unique GO term description given a specific GO id 0 I have a list of GO ids and I want to find unique term description such that if I provide say 200 GO IDs I will give 200 specific GO terms. The code snippet I am using is given…

Continue Reading Mapping unique GO term description given a specific GO id

Consolidate gVCF calling

Hi. I am running genotyping with HaplotypeCaller and GenotypeGVCFs. After that, in the genotype information for some samples in my vcf I found some calls containing multiple genotypes (e.g. 0|0:8,0:11:99:0|1:10777_AGGCGCGGAGG_A:102,126,462:). What could be the issue? Thank you! Here is the full line: chr10 10787 . G GGGCGCGCAGCGCCGGCGCA 356.99 PASS AC=1;AF=0.014;AN=18;BaseQRankSum=-1.762;DP=4023;Ex…

Continue Reading Consolidate gVCF calling

Innovative tools take aim at antibiotic-resistant microbes

Maha Farhat spent months in 2007 tending to patients at a hospital in Durban, South Africa. Many were infected with HIV. But the infection that preyed on the then-medical-resident’s mind, and her patients’, was caused not by a virus, but by a bacterium: Mycobacterium tuberculosis, the pathogen that causes tuberculosis….

Continue Reading Innovative tools take aim at antibiotic-resistant microbes

Fish on its way to new shores

Ice Age bones reveal how sticklebacks adapt to new habitats Three-spined sticklebacks live in both salt and fresh water. When the glaciers melted at the end of the last ice age and new lakes were formed, sticklebacks from the sea found new habitats in them. Felicity Jones and her team…

Continue Reading Fish on its way to new shores

Bcftools how to add DP to FORMAT field (get per sample read depth for REF vs ALT alleles )

Bcftools how to add DP to FORMAT field (get per sample read depth for REF vs ALT alleles ) 1 I’m trying to achieve what this post was looking for Add Dp Tag To Genotype Field Of Vcf File Currently this is my command: bcftools mpileup -Ou –max-depth 8000 –min-MQ…

Continue Reading Bcftools how to add DP to FORMAT field (get per sample read depth for REF vs ALT alleles )

Biostar Systems

Comment: STAR vs Novoalign IGV Browser visualization by chasem &utrif; 10 That is good to know that it isn’t just my set of reads…still concerning, though. Comment: STAR vs Novoalign IGV Browser visualization by chasem &utrif; 10 I was not expecting this — not sure what to make of it…

Continue Reading Biostar Systems

getting paired end datasets from SRA

getting paired end datasets from SRA 0 I am searching SRA by keywords like “paired-end”, but the sra-toolkit seems to only download one file (single-end) about 90% of the time. I just want to make sure my commands are all correct: prefetch SRR13310323 fastq-dump -I –split-files –outdir fastq –gzip –skip-technical…

Continue Reading getting paired end datasets from SRA

Discriminant gene analysis

Discriminant gene analysis 0 I want to obtain the top 5 discriminant genes (positive and negative direction) after a feature selection process. Is this the proper way to obtain the top 5 discriminant genes? # New data.frame with genes that have passed both (Fold and rawp) tests true.genes <- subset(gene.info,…

Continue Reading Discriminant gene analysis

Electroporation ELECTROPORATION It consists of applying short high voltage

ELECTROPORATION It consists of applying short high voltage pulses to a mixture of host cells in suspension and recombinant vectors in solution. These pulses increase the permeability of the membranes, allowing the vectors to pass into the cell. It is a highly efficient method that can be applied to all…

Continue Reading Electroporation ELECTROPORATION It consists of applying short high voltage

Biologist Bioinformatics Job in GLENSIDE, PA

Overview Open & closing dates Opening and closing dates 08/16/2021 to 09/16/2021 Service Competitive Pay scale & grade GS 12 – 13 Salary $84,231 to $130,211 per year Appointment type Permanent Work schedule Full-time Locations 1 vacancy in the following location: Relocation expenses reimbursed No Telework eligible Yes as determined…

Continue Reading Biologist Bioinformatics Job in GLENSIDE, PA

Filter on Allele Balance using BCFTools

Filter on Allele Balance using BCFTools 0 Hi All, I need to filter my variants based on the following criteria. 1) Include SNP sites with at least one heterozygous with allele balance(AB) > 0.15 or at least one homozygous variant 2) Include INDEL sites with at least one heterozygous with…

Continue Reading Filter on Allele Balance using BCFTools

MAKER genome annotation error with SNAP ab initio prediction

I am trying to do a second round of maker genome annotation with ab initio prediction by snap. The error I am getting is as follows: error: unknown command “genome.hmm”, see ‘snap help’. ERROR: Snap failed –> rank=NA, hostname=bioinformatics ERROR: Failed while preparing ab-inits ERROR: Chunk failed at level:0, tier_type:2…

Continue Reading MAKER genome annotation error with SNAP ab initio prediction