Categories
Tag: PCR
Danaher Jobs – Principal Bioinformatics Scientist
At Cepheid, we are passionate about improving health care through fast, accurate diagnostic testing. Our mission drives us, every moment of every day, as we develop scalable, groundbreaking solutions to solve the world’s most complex health challenges. Our associates are involved in every stage of molecular diagnostics, from ideation to…
Enhancing malaria detection in resource-limited areas: A high-performance colorimetric LAMP assay for Plasmodium falciparum screening
Fig 2. The cLAMP specificity of the design (left panel) and reference (right panel) primer set. The plasmid DNA (pDNA) containing 18S rRNA genes from both the P. falciparum S-type (PfS) and A-type (PfA) were utilized to confirm primer specificity. A-type 18S rRNA genes from other Plasmodium species were also…
2023 gene therapy research STAR Grant winners announced
At PacBio, enabling the promise of genomics to better human health cuts right to the core of everything we do.That’s why in 2023 we created the STAR (Student Travel Awarded Researcher) Grant program. This exciting funding opportunity is intended to assist up-and-coming researchers in genomics-aligned fields with sequencing services and…
Advancements in CRISPR-Based Pathogen Detection: Limitations and Recent Progress
Gene editing technologies, particularly those based on Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), have revolutionized our ability to accurately and swiftly detect pathogens. However, even these advanced methods have their limitations. This article explores these limitations and highlights recent advancements that are paving the way for faster, more accurate…
Endogenous Coriobacteriaceae enriched by a high-fat diet promotes colorectal tumorigenesis through the CPT1A-ERK axis
Bacteria Strain Cori.ST1911 was isolated from fresh stool of 20-week-old C57/BL6J mice fed a HFD at the Animal Center of the West China Hospital of Sichuan University. Briefly, faecal particles were ground with a glass grinding rod and suspended in sterile phosphate-buffered saline (PBS). After gradient dilution, the suspension was…
FDA Approves Erdafitinib for Locally Advanced or Metastatic Urothelial Carcinoma With FGFR3 Mutations
FDA Approves Erdafitinib for Locally Advanced or Metastatic Urothelial Carcinoma With FGFR3 Mutations The FDA has approved erdafitinib (Balversa) for the treatment of adult patients with locally advanced or metastatic urothelial carcinoma with susceptible FGFR3 genetic mutations whose disease has progressed on or after previously receiving one line of systemic…
Polymorphism of the myostatin gene exon 1 using PCR-RFLP technique in five beef cattle in Indonesia
This study aims to analyze the polymorphism of the myostatin (MSTN) gene in exon 1 at SNPc.111G>C (rs523392653) and SNPc.267G>A (rs383271508) on various beef cattle in Indonesia. A total of 136 DNA samples were analyzed in this study, consisting of 33 heads of Madura, 31 heads of PO, 36 heads…
FDA Approves Balversa for Locally Advanced, Metastatic Urothelial Carcinoma
Image credit: Matthieu | stock.adobe.com The FDA has approved Balversa (erdafitinib) for adults with locally advanced or metastatic urothelial carcinoma with susceptible FGFR3 genetic mutations whose disease progressed on or following one line of systemic therapy.1 The regulatory action amends the accelerated approval granted by the FDA in April 2019 for patients…
Metagenomic analysis of Mesolithic chewed pitch reveals poor oral health among stone age individuals
The specific environmental/history/collection context The Huseby Klev materials were unearthed and collected by archaeologists (including two of the co-authors of this article) during the excavation of this coastal hunter-fisher-gatherer site in the 90s50. The material assemblage was rich and well preserved: human bones, animal bones, plant remains and pieces of…
miR-195b is required for proper cellular homeostasis in the elderly
Expression pattern of miR-195 during embryonic development We analyzed the expression pattern of miR-195 by in situ hybridization at two distinct developmental stages in mouse embryos. Whole-mount in situ hybridization at E10.5, demonstrated a wide expression of miR-195 along the entire embryo, including the central nervous system, the cardiopharyngeal area,…
Understanding the Impact of Temperate Bacteriophages on Their Lysogens Through Transcriptomics
This protocol enables the impact of prophages on their hosts to be revealed. Bacterial cultures are synchronized using conditions that best support the lysogenic state, limiting spontaneous induction. RT-qPCR unequivocally distinguishes prophage-restricted genes and those uncoupled from phage control from those that are expressed during the lytic replication cycle. Prophages…
Domestic pigs are susceptible to experimental infection with non-human primate-derived Reston virus without the need for adaptation
Ethics and animal welfare statement All infectious work with RESTV, including sample inactivation, was performed in the Containment Level 4 laboratory (CL4) in accordance with the policies and protocols outlined by the Canadian Science Centre for Human and Animal Health Institutional Biosafety Committee. All animal work was performed in strict…
Crispr Library Download
CRISPR guide RNA libraries have been iteratively improved to provide increasingly efficient reagents, although their large size is a barrier for many applications. We design an optimised minimal genome-wide human CRISPR-Cas9 library (MinLibCas9) by mining existing large-scale gene loss-of-function datasets, resulting in a greater than 42% reduction in size compared…
Aal-circRNA-407 regulates ovarian development of Aedes albopictus, a major arbovirus vector, via the miR-9a-5p/Foxl axis
< Back to Article Fig 5 Spatial-temporal patterns of four high abundant circRNA candidates measured by real-time RT-PCR. (A) Temporal profiles of circRNA candidates at different developmental stages of Aedes albopictus determined by qRT-PCR. E = n hours post-oviposition embryo (n = 200 per replicate); 1st -2nd L = 1st…
TCW’s Top Twenty: Why I don’t believe there ever was a Covid virus
As we approach the end of the year, we are repeating our twenty most-read articles of 2023, in reverse order. This is number 2 and it was first published on March 22. I’VE grown increasingly frustrated about the way debate is controlled around the topic of origins of the alleged…
[The I226R protein of African swine fever virus inhibits the cGAS-STING-mediated innate immune response]
This study aimed to explore the mechanism of how African swine fever virus (ASFV) I226R protein inhibits the cGAS-STING signaling pathway. We observed that I226R protein (pI226R) significantly inhibited the cGAS-STING-mediated type Ⅰ interferons and the interferon-stimulated genes production by dual-luciferase reporter assay system and real-time quantitative PCR. The results…
Low dose ribosomal DNA P-loop mutation affects development and enforces autophagy in Arabidopsis
Arabidopsis contains hundreds of ribosomal DNA copies organized within the nucleolar organizing regions (NORs) in chromosomes 2 and 4. There are four major types of variants of rDNA, VAR1–4, based on the polymorphisms of 3’ external transcribed sequences. The variants are known to be differentially expressed during plant development. We…
Genomic Study: Genomic Study to Detect JN.1 Variant Cases – Latest News | Bhubaneswar News
BHUBANESWAR: The state has reported five more Covid-19 cases in the last 24 hours, taking the total number of active cases to 13. The state government has taken a decision to gradually increase Covid testing at different healthcare facilities, official sources said.“The state has collected samples from more than 500…
European Mouse Mutant Cell Repository
The following list defines the different statuses that EUCOMM report on the constructs in their pipeline. Mice – Genotype confirmed (M-GC)The genotype of testcross offspring has been confirmed molecularly. Mice – Germline transmission (M-GLT)Test crosses of chimaeras indicate germline transmission of the ES cell mutation based on coat color. Mice…
Development and evaluation of a CRISPR-Cas13a system-based diagnostic for hepatitis E virus
Objectives: Hepatitis E virus (HEV) is the leading cause of acute viral hepatitis worldwide. HEV RNA detection is the gold standard for HEV infection diagnosis and PCR methods are commonly used but are usually time-consuming and expensive, resulting in low detection efficiency and coverage, especially in low-income areas. Here, we…
Can sf3b1 mutation be detected by rflp method?
Can sf3b1 mutation be detected by ARMS-PCR method?5 answersSF3B1 mutations can be detected using the ARMS-ddPCR method, which combines the amplification refractory mutation system (ARMS) with droplet digital polymerase chain reaction (ddPCR). This method allows for the detection of gene mutations at specific sites, including SF3B1 mutations, with high sensitivity…
Association of PIK3CA Mutation With Pathologic Complete Response and Outcome by Hormone Receptor Status and Intrinsic Subtype in Early-Stage ERBB2/HER2-Positive Breast Cancer | Oncology | JAMA Network Open
Key Points Question What is the association of PIK3CA mutations, response to therapy, and outcome by hormone receptor (HR) status and intrinsic subtype among patients with ERBB2/HER2-positive early breast cancer (EBC) treated in a clinical trial? Findings In this cohort study of 184 patients enrolled in the phase 3 trial…
csi-miR-96-5p delivered by Clonorchis sinensis extracellular vesicles promotes intrahepatic cholangiocarcinoma proliferation and migration via the ferroptosis-related PTEN/SLC7A11/GPX4 axis | Parasites & Vectors
Human tissue samples The preoperative diagnosis of CS mainly relies on stool microscopy, enzyme-linked immunosorbent assay, or endoscopy. Fresh liver and intrahepatic bile duct specimens were collected from ICC patients with (CS-ICC group) and without (NC-ICC group) CS infection during partial hepatectomy at the First Hospital of Jilin University. Tumor tissues…
Based on CRISPR-Cas13a System, to Establish a Rapid Visual Detection Method for Avian Influenza Viruses
1Hebei Agricultural University, China 2Institute of Special Animal and Plant Sciences, Chinese Academy of Agricultural Sciences, China 3Hebei Sanshi Biotechnology Co., Ltd, China The final, formatted version of the article will be published soon. Notify me Receive an email when it…
Summary of Genomics and Transcriptomics – DNA sequencing I. Goal II. Methodology A. Sanger DNA
DNA sequencing I. Goal II. Methodology A. Sanger DNA sequencing ● Up to 900 base pairs ● Primer extension with labeled ddNTPs (radioactive or fluorescent) ● Prior knowledge on target needed ● Difficult to detect variation in mixtures ● High accuracy + still in use for genotyping When it is…
Genetic Testing Market Size Is Surpassing USD 44.3 Billion by 2032, Growing at Projected 9.8% CAGR
The Brainy Insights Global genetic testing market size from USD 17.4 billion in 2022 to USD 44.3 billion in 10 years. The rising prevalence of genetic diseases drives the market’s growth. Well-established healthcare system and the government’s provision of research funding are further elements expected to support market expansion. Newark,…
Seroprevalence and Molecular Characterization of B. abortus
Introduction Brucellosis is a zoonotic disease caused by Brucella spp., a gram-negative facultative intracellular coccobacillus.1 These microorganisms can infect livestock, wildlife, and humans, causing significant public concern and substantial agricultural economic loss. Currently, at least six novel Brucella species have been identified: Brucella pinnipedialis, Brucella ceti,2 Brucella papionis,3 Brucella microti,4…
DNA Analysis: DNA analysis of severed body parts at Regional Forensic Science Laboratory (RFSL) | Nagpur News
Nagpur: DNA analysis of severed body parts is underway at a war-footing at the Regional Forensic Science Laboratory (RFSL) to identify the nine victims who were killed in a high explosive TNT blast at the Solar Industries India Limited at Kondhali, around 50 km from Nagpur, on Sunday.The analysts are…
The Biostar Herald for Tuesday, December 19, 2023
The Biostar Herald publishes user submitted links of bioinformatics relevance. It aims to provide a summary of interesting and relevant information you may have missed. You too can submit links here. This edition of the Herald was brought to you by contribution from Mensur Dlakic, Istvan Albert, and was edited…
Molecular characterization of a tetra segmented ssDNA virus infecting Botrytis cinerea worldwide | Virology Journal
Analysis of the multisegmented nature of BcssDV1 genome B. cinerea field isolates were previously obtained from infected grapes of vineyards of Italy and Spain and their mycovirome was determined [8]. A new ssDNA virus (BcssDV1, Genbank accession no. MN625247) was discovered and characterized. The sequence previously characterized of BcssDV1 (from…
Case Study Reveals Novel Intragenic Deletion of the FXN Gene in Friedreich Ataxia
Ariadna Padró-Miquel, PhD In a recently published case report study of a 32-year-old man with typical clinical features of Friedreich ataxia (FA), parental sample testing led to the identification of a novel intragenic deletion. Overall, the report raises awareness about the potentially higher prevalence of intragenic deletions and highlights the…
NOSTER’s latest solutions for comprehensive gut bacteria-based metabolite and microbiota analysis
KYOTO, Japan, Dec. 19, 2023 /PRNewswire/ — Japan’s Noster Inc., a premier provider of gut microbiome analysis services, is proud to unveil groundbreaking updates in its research on cutting-edge gut bacteria-based metabolite and gut microbiota analysis services. These advancements have far-reaching implications for research on human health and diseases such as…
Frontiers Publishing Partnerships | Construction of recombinant adenovirus-5 vector to prevent replication-competent adenovirus occurrence
Introduction In recent years, recombinant adenoviral vectors have been used in different fields of biomedical sciences such as in vitro and in vivo gene transfer, vaccine development, and gene therapy (Russell, 2000; Mitani and Kubo, 2002). Multiple features of recombinant adenoviral vectors such as high packaging capacity for transgene insertion,…
CRISPR/Cas9-mediated nexilin deficiency interferes with cardiac contractile function in zebrafish in vivo
CRISPR/Cas9-induced homozygous knockout of nexn causes progressive cardiac dysfunction without affecting skeletal muscle function in zebrafish Several studies in different animal models and cardiomyopathy patients have shown that loss of NEXN is leading to DCM which is characterized by an impaired contractility of the heart6,10,12. Homozygous loss of NEXN mostly…
Analysis of off-tumour toxicities of T-cell-engaging bispecific antibodies via donor-matched intestinal organoids and tumouroids
Human tissue samples Tissue samples and annotated data were obtained, and experimental procedures were performed within the framework of the non-profit foundation HTCR, including informed patient consent. Intestinal organoid and tumouroid cell culture Supplementary Table 1 provides anonymized basic donor information. After isolation of intestinal crypts following a previously described…
Effects of plant-based proteins and handling stress on intestinal mucus microbiota in rainbow trout
FAO. The State of World Fisheries and Aquaculture 2022: Towards Blue Transformation (FAO, 2022). Google Scholar Hua, K. et al. The future of aquatic protein: Implications for protein sources in aquaculture diets. One Earth 3, 316–329 (2019). Article Google Scholar Hardy, R. W. Utilization of plant proteins in fish diets:…
Preclinical assessment of an anti-HTLV-1 heterologous DNA/MVA vaccine protocol expressing a multiepitope HBZ protein | Virology Journal
Design of the recombinant virus MVA-HBZ The multiepitope protein design was based on HBZ sequence deposited in the GenBank database [17, 23, 24], and in silico analyses performed using the epitope prediction tools: NetMHCpan 4.0 (Threshold: weak binders—2.0; strong binders—0.5), NetCTL 1.2 (Threshold of 0.75) and IEDB—MHC-I Binding Predictions. Epitopes…
Detecting small- and medium-length copy number variants by whole-genome sequencing
Gains and losses of genetic material can be almost any size: a single base pair or an entire chromosome spanning tens of millions. As genomic analysis technologies have evolved, researchers have separated these often medically relevant variants into bins based on their size and the methods used to detect them….
Solved purpose of this virtual lab? 2. What are the four
purpose of this virtual lab? 2. What are the four basic steps involved in this bacterial ident lab? 3. What are the differences between a prokaryotic and a eukary ribosome? 4. What is a Svedberg unit? 5. What is 16S rRNA and why is it useful in classifying bacteria? PART…
FDA Fails to Address DNA Adulteration Concerns
The following article originally appeared on Dr. Robert Malone’s Substack, and is reprinted here verbatim with permission. Robert Malone, MD, MS; Malone Institute December 15, 2023, 2:30 PM EST (Madison VA and Tallahassee FL) The failure of government regulatory authorities to identify and disclose DNA fragment contamination of…
Randomized phase II study of preoperative afatinib in untreated head and neck cancers: predictive and pharmacodynamic biomarkers of activity
Study objectives and endpoints The main objective consisted in identifying predictive biomarkers of efficacy by exploring correlation between baseline potential biomarkers and radiological and metabolic responses to afatinib. Secondary objectives were to identify potential pharmacodynamic biomarkers, to evaluate the efficacy and safety of afatinib and to assess the metabolic and…
Invivyd Announces Positive Initial Results from Ongoing
VYD222 produced high serum virus neutralizing antibody titer levels in immunocompromised participants Data supportive of an immunobridging approach to the EVADE study of adintrevimab Overall favorable safety and tolerability profile of VYD222 including no study drug-related serious adverse events (SAEs) to date VYD222 demonstrates continued in-vitro neutralization activity against major…
Lentiviral KCNT2 HUMAN sgRNA gene Knockout/Screening Kit -FenicsBIO
Lentiviral KCNT2 HUMAN sgRNA gene Knockout/Screening Kit -FenicsBIO The store will not work correctly when cookies are disabled. JavaScript seems to be disabled in your browser. For the best experience on our site, be sure to turn on Javascript in your browser. We use cookies to give you the…
ABL DIAGNOSTICS INTRODUCING CRISPRCHEK – A NEW LINE OF ASSAYS USING THE CRISPR TECHNOLOGY
ABL Diagnostics keeps innovating and developing its Research & Development activities through a new line of PCR detection assays, called CRISPRChek, using the disruptive CRISPR technology. First CRISPRChek prototypes to be focusing on HIV & SARS-CoV-2 detection and quantification. Ambitions to position such innovation as an alternative to current qPCR…
Genomic hypomethylation in cell-free DNA predicts responses to checkpoint blockade in lung and breast cancer
Lung cancer ICB cohort Advanced non-small cell lung carcinoma patients who were treated with anti-PD-1/PD-L1 monotherapy at Samsung Medical Center, Seoul, Republic of Korea were enrolled for this study. The present study has been reviewed and approved by the Institutional Review Board (IRB) of the Samsung Medical Center (IRB no….
Validation of Oxford nanopore sequencing for improved New World Leishmania species identification via analysis of 70-kDA heat shock protein | Parasites & Vectors
Akhoundi M, Downing T, Votypka J, Kuhls K, Lukes J, Cannet A, et al. Leishmania infections: molecular targets and diagnosis. Mol Aspects Med. 2017;57:1–29. Article PubMed Google Scholar Akhoundi M, Kuhls K, Cannet A, Votypka J, Marty P, Delaunay P, et al. A historical overview of the classification, evolution, and…
The Landscape of Agricultural Biotechnology
By 2049, our global population will reach ~9 billion people. Pests, diseases and adverse environmental conditions are impacting crops across the globe, compounding the issue of feeding a growing population. Traditional breeding techniques have enabled scientists and farmers to develop many varieties of plants and livestock tailored for specific agricultural…
GCC Genomics Services Market Report 2023
Dublin, Dec. 18, 2023 (GLOBE NEWSWIRE) — The “GCC Genomics Services Market, Technology, Application, End-user, Region, Competition Forecast & Opportunities, 2028F” report has been added to ResearchAndMarkets.com‘s offering. The GCC Genomics Services Market is poised to witness impressive growth during the forecast period spanning from 2024 to 2028. The report…
India reports 5 Covid deaths, 335 new cases, active cases rise to 1,700
India on Sunday recorded 335 fresh Covid-19 cases and five deaths, of which four were in Kerala and one in Uttar Pradesh, the Union Health Ministry said. India witnessed 335 fresh COVID-19 infections on Sunday and the number of active cases grew to 1,701, according to the Union Health Ministry….
CHARACTERIZATION OF TAENIID CESTODE SPECIES BY PCR-RFLP OF ITS2 RIBOSOMAL DNA
Abstract Seven species of taeniid cestode (Echinococcus granulosus. E. multilocularis, Taenia hydatigena, T. ovis, T. pisiformis, T. multiceps and T. serialis) were characterised using a polymerase chain reaction-based restriction fragment length polymorphism technique (PCR-RFLP). The second internal transcribed spacer of ribosomal DNA (ITS2) was amplified from various geographical isolates of…
qPCR Reagents Market is Anticipated to reach above USD 2.12 billion by 2030, grow at +8 % CAGR from 2023 to 2030
qPCR Reagents Market qPCR Reagents Market is expected to grow at 8 % CAGR from 2023 to 2030. It is expected to reach above USD 2.12 billion by 2030 from USD 1.23 billion in 2023. qPCR reagents are essential components used in the qPCR or RT-PCR process, allowing researchers to…
Circulating circRNA expression profile and its potential role in late recurrence of paroxysmal atrial fibrillation post catheter ablation
Background: Catheter-based pulmonary vein isolation (PVI) is an effective and well-established intervention for symptomatic paroxysmal atrial fibrillation (PAF). Nevertheless, late recurrences of atrial fibrillation (LRAF) occurring during 3 to 12 months are common, and the underlying mechanisms remain elusive. Circular RNAs (circRNAs) in atrial tissue have been linked to the…
What is fragment analysis? | Macrogen Europe
Fragment analysis separates and analyzes amplified PCR products according to fragments using a primer marked by a fluorescent label. Fragment Analysis can have many applications, such as: Linkage mapping Pathogen sub‐typing Loss of Heterozygosity (LOH) Animal breeding Genetic diversity Inter‐simple sequence repeat (ISSR) Human, animal, and plant typing Microsatellite…
Union Health Ministry initiates preparedness measures
The reported symptoms include fever, runny nose, sore throat, headache, and, in some cases, mild gastrointestinal symptoms. The Union Ministry of Health has initiated preparedness measures after a case of the JN.1 subvariant of COVID has been identified in Kerala as part of the ongoing routine surveillance conducted by the…
What is rRNA? | 4 Answers from Research papers
What are microorganisms?5 answersMicroorganisms are tiny organisms that can exist as unicellular, multicellular, or cell clusters. They are widespread in nature and can be divided into five major types: Bacteria, Archaea, Fungi, Protozoa, and Viruses. Microbes are present everywhere in the biosphere and have a significant impact on the environment…
Biosensors | Free Full-Text | DNA Probes for Cas12a-Based Assay with Fluorescence Anisotropy Enhanced Due to Anchors and Salts
3.1. Design of Experiments To search optimal structures of ssDNA probes with anchors, we operated with the following assumptions: (1) the anchor should be an easily accessible compound, (2) it should be readily incorporated into the ssDNA probe, (3) it should provide a significant difference in FA before and after…
Evidence of an intracellular creatine-sensing mechanism that modulates creatine biosynthesis via AGAT expression in human HAP1 cells
Cell lines and reagents HAP1 cells used to generate the reporter cells were grown from a frozen stock of HAP1 (C859) passage 6 purchased from Horizon Discovery LTD (Cambridge, UK). Iscove’s media (Ref: 098–150, Wisent) supplemented with 10% Fetal Bovine serum (Multicell) was used to grow HAP1 cells. All cells…
Molecular Weight Marker Market is Projected to grow at +12.1% CAGR from 2023 To 2030 by Exactitude Consultancy
Molecular Weight Marker Marke The molecular weight marker market is expected to grow at 12.1% CAGR from 2023 To 2030. It is expected to reach above USD 938.76 million by 2030. Molecular weight markers are reference standards used in gel electrophoresis and other molecular biology techniques to estimate the size…
Integrated bioinformatics and wet-lab analysis revealed prominent inflammatory genes of Extracellular Matrix as prognostic biomarkers in patients with advance IBD requiring early surgery
Abstract Background: The number of patients with inflammatory bowel disease (IBD) is increasing worldwide. Due to the fact that at the age of 20 to 30 years, this autoimmune disease is very common; Investigating and identifying prognostic biomarkers in advanced IBD is very important; Because according to the identification of…
First report of cutaneous leishmaniasis caused by Leishmania donovani in Ethiopia | Parasites & Vectors
Alvar J, Vélez ID, Bern C, Herrero M, Desjeux P, Cano J, et al. Leishmaniasis worldwide and global estimates of its incidence. PLoS ONE. 2012. doi.org/10.1371/journal.pone.0035671. Article PubMed PubMed Central Google Scholar Gadisa E, Tsegaw T, Abera A, Elnaiem DE, Den Boer M, Aseffa A, et al. Eco-epidemiology of visceral…
Figure 1. Electrophoresis patterns for MDR1 genotypes by PCR-RFLP based assay. M is a 100 bp DNA marker. Samples 1, 4, 7 and 8 are homozygous CC genotype (Has Bfu CI restriction site). Samples 5 and 6 are homozygous TT genotype (Lack Bfu CI restriction site). Sample 2 and 3 are heterozygous CT genotype. : Genotype and Allele Frequencies of MDR-1 Gene Polymorphism in Jordanian and Sudanese Populations : Science and Education Publishing
Figure 1. Electrophoresis patterns for MDR1 genotypes by PCR-RFLP based assay. M is a 100 bp DNA marker. Samples 1, 4, 7 and 8 are homozygous CC genotype (Has Bfu CI restriction site). Samples 5 and 6 are homozygous TT genotype (Lack Bfu CI restriction site). Sample 2…
Gadolinium Oxide Nanoparticles reinforce immune response
Boyi Yu,1– 4 Xuanyi Lu,5 Xianglong Feng,1– 4 Ting Zhao,1– 4 Jiaxin Li,1– 4 Yudie Lu,5 Fei Ye,1– 4 Xiongxiong Liu,1– 4 Xiaogang Zheng,1– 4 Zheyu Shen,5 Xiaodong Jin,1– 4 Weiqiang Chen,1– 4 Qiang Li1– 4 1Biomedical Center, Institute of Modern Physics, Chinese Academy of Sciences, Lanzhou, People’s Republic of…
Fatty Acid Metabolism-Related lncRNAs as Biomarkers for SKCM
Introduction Skin cutaneous melanoma (SKCM), as one of the most aggressive types of cancer due to its elevated degree of heterogeneity, has gained increasing attention during the past few decades.1 Also known as “the cancer that rises with the sun”,2 melanoma originates from cancerous melanocytes due to molecular or genetic…
Capillary and next generation sequencing of trace DNA samples recovered from spent firearm cartridge casings of a handgun
Home Capillary and next… You do not have access to any existing collections. You may create a new collection. Masters Thesis Firearm cartridge casings are pertinent to crimes involving firearms; however, they are also the most ignored pieces of evidence for DNA analysis due to the difficulty in obtaining a…
Streamlining point-of-care assays | Nature Biomedical Engineering
When designing diagnostic assays intended for point-of-care use, more attention should be given to simplicity of operation. When it comes to assays for the detection of disease biomarkers, analytical performance typically makes the headline. An assay that misses a substantial percentage of samples positive for the biomarker or that singles…
Identification of Differentially Expressed Genes in Human Colorectal Cancer Using RNASeq Data Validated on the Molecular Level with Real-Time PCR
Allam RM, Al-Abd AM, Khedr A, Sharaf OA, Nofal SM, Khalifa AE, Mosli HA, Abdel-Naim AB (2018) Fingolimod interrupts the cross talk between estrogen metabolism and sphingolipid metabolism within prostate cancer cells. Toxicol Lett 291:77–85 Article CAS PubMed Google Scholar Andrews S et al (2010) FastQC: a quality control tool…
A transcriptomic taxonomy of mouse brain-wide spinal projecting neurons
Animals All experimental procedures were performed in compliance with animal protocols approved by the Institutional Animal Care and Use Committee at Boston Children’s Hospital (Protocol no. 20-05-4165 R). Mice were provided with food and water ad libitum, housed on a 12-hour light/dark schedule (7 a.m.–7 p.m. light period) with no more than five mice…
Plasmodium knowlesi in pig-tailed macaques: a potential new model for malaria vaccine research | Malaria Journal
Pig-tailed macaques can be reliably infected with purified cryopreserved PkSPZ This study was designed to evaluate PTM as potential alternative hosts for malaria vaccine studies, with the aim of further characterizing the parasitological and veterinary health outcomes after infectious PkSPZ challenge. The study was conducted in two pilot cohorts. Cohort…
Viruses under the Antarctic Ice Shelf are active and potentially involved in global nutrient cycles
Rignot, E., Jacobs, S., Mouginot, J. & Scheuchl, B. Ice-shelf melting around antarctica. Science (80-) 341, 266–270 (2013). Article ADS CAS Google Scholar Wadham, J. L. et al. Ice sheets matter for the global carbon cycle. Nat. Commun. 10, 1–17 (2019). Google Scholar Adusumilli, S., Fricker, H. A., Medley, B.,…
McWilliam H, Li W, Uludag M (2013). Analysis Tool Web Services from the EMBL-EBI” Nucleic acids research: 41(Web Server issue): W597-600.
1Institute of Endemic Diseases, University of Khartoum, Khartoum, Sudan 2Department of microbiology, Faculty of medicine, university of Khartoum, Sudan 3Head department of biotechnology, Biotechnology Park, Africa city of technology, Sudan 4Botany department, Faculty of Science, University of Khartoum, Sudan American Journal of Microbiological Research. 2014, Vol. 2 No. 6, 217-223DOI:…
Use of 16S rRNA probes for characterization of gut microflora of silkworm (Bombyx mori L.) breeds
Use of 16S rRNA probes for characterization of gut microflora of silkworm (Bombyx mori L.) breeds – Texas A&M University (TAMU) Scholar Search form Overview Additional Document Info View All Overview abstract The gut microflora of silkworm, Bombyx mori L. are associated with various physiological processes…
LOINC 16531-6 Campylobacter lari rRNA [Units/volume] in Serum by Probe
es-AR Spanish (Argentina) ARNr de Campylobacter lari:concentración arbitraria:punto en el tiempo:suero:cuantitativo:sonda es-ES Spanish (Spain) Campylobacter lari rRNA:Concentración arbitraria:Punto temporal:Suero:Qn:Sonda de DNASynonyms: Cuantitativo es-MX Spanish (Mexico) ARNr de Campylobacter lari:Concentración arbitraria:Punto temporal:Suero:Cuantitativo:Investigacion fr-CA French (Canada) Campylobacter lari , ARNr:Concentration arbitraire:Temps ponctuel:Sérum:Quantitatif:Sonde fr-FR French (France) Campylobacter lari ARNr:Arbitraire/Volume:Ponctuel:Sérum:Numérique:PCR fr-BE French (Belgium) Campylobacter…
Unravelling the effect of New Year’s Eve celebrations on SARS-CoV-2 transmission
Setting The study was conducted in the setting of a dedicated testing and contact tracing program targeting around 50,000 higher education students at KU Leuven Association in Leuven, Belgium. A test and trace program was implemented, specifically targeting this student population. Students could attend for a PCR test at no…
Geographic specificity of infestation of phytoplasma in weeds and sesame asrevealed by 16S rRNA gene based detection
Bertaccini, A. (2022). Plants and Phytoplasmas: When Bacteria Modify Plants. Plants 11, 1425, 1-20 Deng, S. & Hiruki, C. (1991). Amplification of 16S rRNA genes from culturable and non-culturable mollicutes. J Microbiol Methods, 14, 53–61 Gundersen, D. E. & Lee, I.-M. (1996). Ultrasensitive detection of phytoplasmas by nested-PCR assays using…
Solved 42. Polymerase chain reaction (PCR) is a technique
Transcribed image text: 42. Polymerase chain reaction (PCR) is a technique used to amplify (copy) DNA and is critical to the DNA cloning process. Suppose a single, linear molecule of double-stranded DNA (dSDNA) is amplified by PCR. After three PCR cycles, how many molecules of dsDNA will there be (assume…
Beyond the exome: utility of long-read whole genome sequencing in exome-negative autosomal recessive diseases | Genome Medicine
Our cohort comprises 34 families in which a presumably autosomal recessive disease defied molecular diagnosis by clinical exome sequencing (short-read sequencing-based) and reanalysis performed on the index individual for each family (Fig. 1). The index patient in each family was subjected to an average of 10 × depth lrWGS except for Family F8602…
Single-cell analysis of chromatin accessibility in the adult mouse brain
Tissue preparation and nucleus isolation All experimental procedures using live animals were approved by the SALK Institute Animal Care and Use Committee under protocol number 18-00006. Adult C57BL/6J male mice were purchased from Jackson Laboratories. Brains were extracted from 56–63-day-old mice and sectioned into 600 µm coronal sections along the anterior–posterior…
QIAseq miRNA 96 Index Kit IL UDI-B (96)
Gel-free miRNA Sample to Insight solution for differential expression analysis and novel discovery using next-generation sequencing Features Gel-free miRNA sequencing library prep from as little as 1 ng of total RNA Elimination of adapter dimers and unwanted RNA species resulting in the highest fidelity and most efficient data Integrated Unique…
Increasing Widespread Accessibility of Molecular Testing for Oncology Research
Advancements in cancer diagnostics and monitoring have revolutionized the way we understand and treat this complex disease. The advent of molecular technologies for analyzing nucleic acids has made it possible to detect, analyze and monitor cancer more precisely and sensitively than ever before. Furthermore, it has made noninvasive liquid biopsy…
SIO1003 W9 Practical SidneyChong 22117254.pdf – SIO1003 Bioinformatics Concepts Semester 1 Session 2023/2024 Practical 4: BLAST 20 marks Name: Sidney
Exercise 1:Finding an unknown gene. Your supervisor has conducted a PCR experiment and given you an unknown sequence for analysis. The sequence is as below: >Unknown_sequence_1 AAATGAGTTAATAGAATCTTTACAAATAAGAATATACACTTCTGCTTAGGATGATAATTG GAGGCAAGTGAATCCTGAGCGTGATTTGATAATGACCTAATAATGATGGGTTTTATTT CCAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAAT TAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCAC CATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCA TCAAAGCATGCCAACTAGAAGAGGTAAGAAACTATGTGAAAACTTTTTGATTATGCAT ATGAACCCTTCACACTACCCAAATTATATATTTGGCTCCATATTCAATCGGTTAGTCTA CATATATTTATGTTTCCTCTATGGGTAAGCTACTGTGAATGGATCAATTAATAAAACACA TGACCTATGCTTTAAGAAGCTTGCAAACACATGAA Guidelines to conduct sequence analysis 1. Navigate to the main BLAST page (blast.ncbi.nlm.nih.gov/Blast.cgi) 2. Select…
A practical workflow for forensic species identification using direct sequencing of real-time PCR products
Background Forensic scientists are often required to identify species of unknown biological samples. Although methods based on sequencing of DNA barcode regions are the gold standard for species identification in single-source forensic samples, they are cumbersome to implement as routine work in forensic laboratories that perform many tests, including human…
Which one of the following is a depiction of the GenBank sequence entry format? -triyambak.org
#Question id: 13095 #Section 7: Recombinant DNA technology and Other Tools in Biotechnology You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below. (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’ (b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’…
Single-cell DNA methylome and 3D multi-omic atlas of the adult mouse brain
Mouse brain tissues All experimental procedures using live animals were approved by the Salk Institute Animal Care and Use Committee under protocol number 18-00006. Adult (P56) C57BL/6J male mice were purchased from the Jackson Laboratory at 7 weeks of age and maintained in the Salk animal barrier facility on 12-h dark–light…
Bioactive glycans in a microbiome-directed food for children with malnutrition
Collection and handling of biospecimens obtained from participants in the randomized controlled clinical study of the efficacy of MDCF-2 The human study entitled ‘Community-based clinical trial with microbiota-directed complementary foods (MDCFs) made of locally available food ingredients for the management of children with primary moderate acute malnutrition (MAM)’ was approved…
[2024-2031] Molecular Blood Market Advancing The Growth Globally
(MENAFN– The Express Wire) Global report Molecular Blood Market provides overview of the market segmentation, size, share, new innovations information up to that point. This market report trends may have evolved since 2024-2031 consulting more recent sources for the most up-to-date information. The Molecular Blood market is highly dynamic and…
Solved A PCR-RFLP analysis was performed to identify PTC
A PCR–RFLP analysis was performed to identify PTC tasters in a population. The taster allele sequence included a palindromic sequence recognized by a restriction enzyme, whereas the non–taster allele did not due to a SNP in the sequence. The gel shows the results of the analysis from 100 individuals. The…
Global Enzymatic DNA Synthesis Market Report 2023-2028, Featuring Profiles of Telesis Bio, Twist Bioscience ,GenScript Biotech, Evonetix, Camena Bio, Molecular Assemblies, Touchlight and Kern Systems
DUBLIN, Dec. 13, 2023 /PRNewswire/ — The “Global Enzymatic DNA Synthesis Market: Analysis By Product Type (DNA Library Synthesis and Custom DNA Synthesis), By Technology (PCR, CRISPR, SOLA and Others), By Application, By End User, By Region, Size, Trends and Forecast to 2028” report has been added to ResearchAndMarkets.com’s offering….
Benchmarking DNA isolation methods for marine metagenomics
Scheme of the study The overall pipeline of our study is presented in Fig. 1 and is described in detail in the methods section. We processed three types of samples: fresh water, sea sediment, and digestive system of a marine invertebrate M. gigas (“gut flora”). These samples were treated in triplicates…
High-throughput sequencing of Diatoms using V4 region of 18S rRNA gene in Bayug Island, Iligan City, Philippines
Almarez DN, Almarez FJS, Baulete EM. 2014. Bayug Island Aquasilvi Program: An Eco-Governance Strategy for Climate Change Adaptation and Mitigation. J Govern Dev 10(2): 35-54. DOI: 10.32890/jgd. Alongi DM. 2014. Carbon cycling and storage in mangrove forests. Ann Rev Mar Sci 6: 195-219. DOI: 10.1146/annurev-marine-010213-135020. Balint M, Pfenninger M, Grossart…
Anitoa rolls out new qPCR modular system
The new system is suitable for use in various applications, including sample/library preparation for DNA sequencing. Credit: Anitoa Systems, LLC/PRNewswire. Biotechnology company Anitoa Systems has launched the Anitoa MAx16, an automation-ready real-time polymerase chain reaction (qPCR) modular system. The new fully integrated four-plex (4 independent fluorescence channels) qPCR module with…
What are the limitations of using 16S sequencing for taxonomic identification?
What are the challenges and opportunities in using phylogenomics to study spiders?5 answersPhylogenomics has provided valuable insights into the study of spiders, but it also presents challenges and opportunities. One challenge is the low capture efficiency of available UCE probe sets for spider phylogenomics, which are not optimized for certain…
A laboratory ice machine as a cold oligotrophic artificial microbial niche for biodiscovery
Flemming, H.-C. & Wuertz, S. Bacteria and archaea on earth and their abundance in biofilms. Nat. Rev. Microbiol. 17, 247–260 (2019). Article CAS PubMed Google Scholar Flemming, H.-C., Neu, T. R. & Wozniak, D. J. The EPS matrix: The “house of biofilm cells”. J. Bacteriol. 189, 7945–7947 (2007). Article CAS …
Phyloecology of nitrate ammonifiers and their importance relative to denitrifiers in global terrestrial biomes
Steffen, W. et al. Planetary boundaries: guiding human development on a changing planet. Science 347, 1259855 (2015). Article PubMed Google Scholar Kanter, D. R. et al. Nitrogen pollution policy beyond the farm. Nat. Food 1, 27–32 (2020). Article ADS Google Scholar Tian, H. et al. A comprehensive quantification of global…
Light-Triggered Signal Enhancement Strategy Integrated with a CRISPR/Cas13a-Based Assay for Ultrasensitive and Specific miRNA Detection
The development of facile, accurate, and affordable assays for microRNAs (miRNAs) in early cancer is greatly desirable but encounters an obstacle due to low cellular abundance in biofuids. In this study, we present a novel approach called a light-triggered exponential amplification strategy coupled with a CRISPR/Cas13a-based diagnostic system (LEXPA-CRISPR), which…
Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System
This protocol describes how to build a continuous-flow-polymerase chain system based on the microfluidic chip, and how to build a capillary electrophoresis system in the lab. It presents a simple way for the analysis of nucleic acids in the lab. Polymerase chain reaction is a traditional method employed for the…
An ncRNA transcriptomics-based approach to design siRNA molecules against SARS-CoV-2 double membrane vesicle formation and accessory genes | BMC Infectious Diseases
When compared to the genomes of other RNA viruses, coronaviruses have been found to possess largest genome sizes. They are capable of establishing reservoirs in both human and zoonotic populations, enabling their transmission and circulation among a range of animal hosts, including bats, pangolins, civets, cats, mice, pigs, whales, dogs,…
Global Enzymatic DNA Synthesis Market Analysis, Trends and
Dublin, Dec. 12, 2023 (GLOBE NEWSWIRE) — The “Global Enzymatic DNA Synthesis Market: Analysis By Product Type (DNA Library Synthesis and Custom DNA Synthesis), By Technology (PCR, CRISPR, SOLA and Others), By Application, By End User, By Region, Size, Trends and Forecast to 2028” report has been added to ResearchAndMarkets.com‘s…
Regulation of the ER-Resident Mannosidase EDEM2 in HEK293 Cells
Abstract EDEM2 plays an important role as the first enzyme that acts during mannose trimming of N-glycosylated proteins in the ERAD machinery. Although EDEM2 expression has been reported to be transcriptionally regulated by the IRE1-sXBP1 pathway, very little is known about how endogenous EDEM2 protein expression is regulated. In this…
Analysis of geometric morphometrics and molecular phylogeny for Anopheles species in the Republic of Korea
World Health Organization (WHO). WHO malaria report. 2022 www.who.int/publications/i/item/9789240064898 (2022). Savi, M. K. An overview of malaria transmission mechanisms, control, and modeling. Med. Sci. 11, 3 (2023). Google Scholar Bahk, Y. Y. et al. Epidemiological characteristics of re-emerging vivax malaria in the Republic of Korea (1993–2017). Korean J. Parasitol. 56,…
Long PCRSeq – Microsynth – CH
Explore expanded possibilities with Microsynth’s Long PCRSeq, leveraging the cutting-edge long-read sequencing technology from Oxford Nanopore Technologies (ONT) to sequence clonal linear DNA ranging from 600 bp to 50 kb in length. Conveniently accessible for samples in tubes and 96-well plates, this service builds upon the capabilities of…