Tag: PHRED

What is Next-Generation Sequencing (NGS)? Next-Generation Sequencing (NGS), also known as high-throughput sequencing, has revolutionized the field of genomics and molecular biology by allowing the sequencing of thousands to millions of DNA molecules simultaneously. It encompasses a range of different sequencing technologies, all aimed at producing large amounts of sequence…

Hi all, I am expressing a GFP synonymous variant library in human cells and sequencing its RNA on the nanopore and I am having some trouble analysing the data. Initially, I basecalled all the fast5 files using the super accuracy model in the guppy basecaller, then I discarded the reads…

Introduction Although globalization has provided opportunities for consumers to enjoy a wide range of products and expanded global food trade, the complexity of the international food supply has contributed to an increase in foodborne outbreaks (Quested et al., 2010; Hussain and Dawson, 2013). Worldwide efforts have ensured food safety by…

Here’s another beginner BioPython question from me… I’m running some genome assemblies for someone who has some new Illumina sequence data and also had done some sequencing a few years ago. They have some Sanger and 454 sequences (a couple thousand sequences with a couple thousand base pairs for each)…

FastQC Function AMPERE quality control tool for elevated throughput sequence data. Your Java What A match Java Runtime Ecology This Picard BAM/SAM Libraries (included in download) Code Maturation Robust. Mature code, but feedback exists comprehended. Code Released No, under GPL v3 or later. Initial Contact Simon Andrews Download Now Views…

Dear Biostars, I am having a confusing issue with my CADD plugin. This is confusing because when I run VEP for my whole trio – all the plugins work fine. However when I try to run CADD for individual – pivoted files – it no longer does and I get…

How to trim reads for Chip Seq analysis 1 Hi I am doing a Chip-seq analysis. How do you cut for base sequence content in the final part where some bases tend to go down and some bases up ??? on the galaxy platform. Is it necessary to continue the…

Enter a project name for your analyze runner. This name will help you identify insert final in case yours do manifold runs in a brawl. Provision of an email site exists optional, but desires rented you safely close the browser during the analysis and receive a notification following verwirklichung. Upload…

Introduction The metabolome is an incredibly diverse collection of small molecules (<1,500 Da) in biological systems involved in virtually every cellular process, including cellular energy production, macromolecule synthesis, epigenetic modifications, cell signalling and more (for recent reviews see [Citation1–6]). It responds rapidly (in seconds) to both internal (signalling, allostery) and external…

Hello,I’d like to use a public dataset from SRA, this is one of the runs. I’ll put here some sample data, the first two reads in R1: @ERR2204072.1 HWI-ST1450:172:C6H19ANXX:7:2315:16228:9537/1 ATTACCATCAGAATTGTACTGTTCTGTATCCCACCAGCAATGTCTAGGAATGCCTGTTTCTCCACAAAGTGTTTAC + %%$%%())))&)’))))))))))())()())))))))))()&&&)#)))))))))’)))))))))))()&&%&))) @ERR2204072.2 HWI-ST1450:172:C6H19ANXX:7:1104:8419:82653/1 GTTTAAACGAGATTGCCAGCACCGGGTATCATTCACCATTTTTCTTTTTGTTAACTTGCCGTCAGCCTTTTCTTTG + %%&&&))))))))))))))))())))))))))))))()))))))))&)&))%))))))))(%)))))))))))))! A quick look would rule out phred64; but if those were actual phred33-encoded…

What filters do I use on my variant calls (vcf.gz) file for imputation? 0 Hi! After about 2 full days of research and reading so many papers, I am still super stuck on this question: What site filters do I need to use on my vcf file to prepare it…

Introduction In very simple terms, current sequencing technology begins by breaking up long pieces of DNA into lots more short pieces of DNA. The resultant set of DNA is called a “library” and the short pieces are called “fragments”. Each of the fragments in the library are then sequenced individually…

Small RNAs are important functional molecules in organisms, which have three main categories: microRNA (miRNA), small interfering RNA (siRNA), and piwi-interacting RNA (piRNA). They are less than 200 nt in length and are often not translated into proteins. Small RNA generally accomplishes RNA interference (RNAi) by forming the core of…

MapSplice2 gives error if the thread count (-p value) is greater than 2 1 Hello! I get a multi-threading error while using MapSplice2. All the reference fasta files and index files were generated accordingly, as mentioned in the website. (www.netlab.uky.edu/p/bioinfo/MapSplice2UserGuide) I get an error after it evaluates given files/parameters but…

Provided by: samtools_1.16.1-1_amd64 NAME samtools-phase – call and phase heterozygous SNPs SYNOPSIS samtools phase [-AF] [-k len] [-b prefix] [-q minLOD] [-Q minBaseQ] in.bam DESCRIPTION Call and phase heterozygous SNPs. OPTIONS -A Drop reads with ambiguous phase. -b STR Prefix of BAM output. When this option is in use, phase-0…

wrong quality plots in fastqc output 1 Good morning, I simulated reads based on the reference genome using samtools wgsim wgsim -N 30000000 -1 151 -2 151 -r 0 -R 0 -X 0 -e 0 genome.fasta Sample_R1.fastq Sample_R2.fastq and obtained fastq files with such content: @DQ898156.1_36602_37076_0:0:0_0:0:0_0/1 CTGTAGTCTGGCACTGCAAAAACAGGATACAGGTGTATATATGATATATATATATGTGTGGACATGTTGTGTATAAAGAACGAAAAAATGCGGATATGGTCGAATGGTAAAATTTCTCTTTGCCAAGGAGAAGATGCGGGTTCGATTCCCG + IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII @DQ898156.1_147753_148277_0:0:0_0:0:0_1/1…

Motivation for developing a sparse RDB Computational approaches for discovering the etiologies of rare diseases typically depend on the analysis of a heterogeneous set of files, each of which can be very large and follow a distinct convention. Genotypes, for example, are ordinarily stored in VCFs containing data for one…

Tool To Find Out If Fastq Is In Sanger Or Phred64 Encoding? 9 Is there a simple tool I can use to quickly find out if a FASTQ file is in Sanger or Phred64 encoding? Ideally something that tells me ‘Encoding XX’ somewhere the terminal output. fastq tools • 46k…

Samples RNA-seq We used the same publicly available data source of human post-mortem brain samples as Van Booven et al.7, which were collected from the New South Wales Brain Tissue Resource Center. Van Booven et al.7 also performed differential splicing, but they used different methods, included individuals from disparate ancestral…

NEW YORK – During beta testing for Element Biosciences’ new sequencer last year, one of the customers quickly ran into a problem when trying it out with 10x Genomics’ single-cell assays. 10x’s Cell Ranger software, used for single-cell sequencing data analysis, was aborting runs and spitting out error messages. The reason?…

Next-generation sequencing (NGS), which makes millions to billions of sequence reads at a fast rate, has greatly sped up genomics research. At the moment, Illumina, Ion Torrent/Life Technologies, 454/Roche, Pacific Bioscience, Nanopore, and GenapSys are all NGS platforms that can be used. They can produce reads of 100–10,000 bp in…

Ethics statement and animals All animals and experimental protocols used in this study were approved by the Beijing Institute of Animal Science, Chinese Academy of Agricultural Sciences (the scientific research department responsible for animal welfare issues) (No.: IASCAAS-AE20140615). In this study, experimental chickens (JXH) were selected on H/L, with the…

How does one interpret the quality score in the FASTQ (or BAM) results coming out from the Illumina Novaseq 6000 Sequencer and DRAGEN pipeline. Any ideas or pointers? Occur ASCII ASC-to-Num PHRED Q value? 82 * (42-33) or 9 Q10? Q0? 65 5 20 152 7 22 37377 : (58-33)…

I have a vcf files like below: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT treatmentSample chr1 857100 . C T 1756.06 PASS AC=2;AF=1;AN=2;DP=60;ExcessHet=3.0103;FS=0;MLEAC=2;MLEAF=1;MQ=60;QD=29.27;SOR=1.812;CSQ=chr1:857100|T|SNV|ENSG00000228794|ENST00000445118|LINC01128||1|MODIFIER|non_coding_transcript_exon_variant||||5/5|||||||||||||||||| GT:AD:DP:GQ:PL 1/1:0,60:60:99:1770,180,0 Does anyone know how to seperate INFO columns into different columns? And also how to separate treatmentSample column following the FORMAT ORDER? I…

P. aeruginosa bacterial strains Reference strains Four well-described and genome-available reference strains were used in the present study, ATCC27853 and ATCC15442, obtained from the American Type Culture Collection (ATCC), and PAO1 and PA14, from the collection of Institut Pasteur (Paris, France). Strain ATCC15442 is recommended for disinfectant susceptibility testing44, strain…

This story includes reporting by Huanjia Zhang. NEW YORK – As the reigning Nature Methods method of the year, long-read sequencing featured prominently in many of the talks at this year’s Advances in Genome Biology and Technology meeting, held in Hollywood, Florida, last week. Pacific Biosciences presented new data from…

Hello everybody, I am using pharmcat tool’s prerprocessor feature to preprocessmy vcf file using the command > python3 pharmcat_vcf_preprocessor.py -vcf sample.vcf But I think there is some issue with my vcf file as this command outputs an error > Reading samples from sample.vcf … Saving output to . > >…

Rar V, Tkachev S, Tikunova N. Genetic diversity of Anaplasma bacteria: twenty years later. Infect Genet Evol. 2021;91:104833. Google Scholar  Atif FA. Alpha proteobacteria of genus Anaplasma (Rickettsiales: Anaplasmataceae): epidemiology and characteristics of Anaplasma species related to veterinary and public health importance. Parasitology. 2016;143:659–85. Google Scholar  Battilani M, de Arcangeli…

I have a VCF file with 200 samples (mitochondrial genome of Plasmodium falciparum). Here is a pic to take a look at: And a few relevant lines from the actual file: ##INFO=<ID=AC,Number=A,Type=Integer,Description=”Allele count in genotypes, for each ALT allele, in the same order as listed”> ##INFO=<ID=AF,Number=A,Type=Float,Description=”Allele Frequency, for each ALT…

Physico-chemical features of Lake Urmia Sampling was performed during the period of lowest rainfall and input volume in the year when the lake water reached the highest salt concentration (locations shown in Fig. 1, Supplementary Table S1). The measured ionic composition of the collected brine showed the typical composition of halite-dominated…

Organisation of the Pregap4 Manual Introduction Summary of the Files used and the Processing Steps Introduction to the Pregap4 User Interface Introduction to the Files to Process Window Introduction to the Configure Modules Window Introduction to the Textual Output Window Introduction to Running Pregap4 Pregap4 Menus Pregap4 File menu Pregap4…

dint May 9, 2022, 1:33pm #1 i’m just wondering if you can specify cadd, gnomad, clinvar and dbNSFP options when annotating with hail on dxjupyterlab_spark_cluster o the UKB RAP? From the hail website, the following command can be used on your matrix file to annotate with these features: db =…

Introduction Incipient species are critical for evolutionary biologists to study speciation, but they also challenge taxonomy due to gene flow or ancestral polymorphism. The former and contrasting population size lead to larger intraspecific than interspecific variations, a phenomenon called the species-definition anomaly zone (Jiao and Yang, 2021). The latter results…

Help me understand the Nanopore fastqc results 2 Hi, I have got my first Nanopore sequencing data and the first step was to see if the data is good. Has anyone has any experience with this kind of data and can tell me how to interpret the results. The whole…

bowtie2 – (ERR): bowtie2-align exited with value 13 1 I am trying to run bowtie2. but following error are occuring everytime bowtie2 –very-fast-local -x bowtie -q -1 R1.fastq -2 R2.fastq -s aligned.sam Saw ASCII character 10 but expected 33-based Phred qual. terminate called after throwing an instance of ‘int’ Aborted…

First, trimming adapters is definitely necessary as they are essentially a form of contamination. For quality trimming and filtering I would highly recommend reading the following: Trimming of sequence reads alters RNA-Seq gene expression estimates Essentially they show that aggressive trimming is a problem. To quote from the Conclusions: The…

Datasets and populations We first compiled whole-genome sequencing data to analyze the patterns of variation in ZTGs on two geographical levels. Thus, we explored a worldwide dataset of 2,328 unrelated individuals representing 24 populations across Africa (AFR), Europe (EUR), East Asia (EAS), South Asia (SAS) and America (AMR), denoted as…

The protocol presented here describes a complete pipeline to analyze RNA-sequencing transcriptome data from raw reads to functional analysis, including quality control and preprocessing steps to advanced statistical analytical approaches. Welcome to the protocol of high-throughput transcriptome analysis for investigating host-pathogen interactions. This protocol is divided in the following steps….

Analyzing and slicing FASTQ file entries using Python 1 I have the code pasted below for running on FASTQ file entries in order to compare specific parts and remove the redundancy of the same sequences (based on the miRNA + umi_seq combination). I save the entry IDs and then make…

Significance Large-scale meteorological and biological data demonstrate the vertical stratification of airborne biomass. The previously described diel cycle of airborne microorganisms is shown to disappear at height. Atmospheric turbulence and stratification are shown to be defining factors for the scale and boundaries, dynamics, and natural variability of airborne biomass, resulting…

I’ve annotated some variants using VEP, and was looking at the minor allele frequencies. Some of the variants had very different MAFs in the annotation than I expected (I expected MAF < 1%, whereas some annotated MAFs were >50%). I looked up the same variants on the gnomAD v3 browser,…

I’m using Biopython to parse a fastq file, and I found that the SeqIO object get cleared away once I accessed it. from Bio import SeqIO record_fastqIO = SeqIO.parse(‘SRR835775_1.first1000.fastq’,’fastq’) for record in record_fastqIO: print(record.id) This script works perfectly. But if I add one line to the script: from Bio import…

Hello, I ran seqtk seq -VQ64 read1.fastq.gz > read1_phred33.fastq to convert my 64 based phred score reads to 33 based phred score phred reads. However when I attempted to run them through tophat alignment I got this error: Saw ASCII character 4 but expected 33-based Phred qual. terminate called after…

plotting roh from bcftools 0 Heys, I am following this small tutorial on how to calculate ROHs from a vcf file using bcftools (samtools.github.io/bcftools/howtos/roh-calling.html) and I am getting this txt file: # This file was produced by: bcftools roh(1.10.2+htslib-1.10.2-3) # The command line was: bcftools roh -G30 –AF-dflt 0.4 my_file.vcf…

How can I get PHRED score? 1 Hi, all. I am trying to get the assembly stat(Table S1.) according to the following paper about de novo assembly. [www.ncbi.nlm.nih.gov/pmc/articles/PMC7266049/%5D%5B1] In the table, there is an item “Mean read PHRED score after filtering and trimming”. How can I get this? Is there…

INTRODUCTION Large-scale annual migrations occur in an extraordinary range of animals, from insects to the great whales. While the driving mechanisms of these migrations are varied and sometimes poorly understood, they often represent a way of optimizing conditions for breeding and adult fitness when these are in conflict. Often, populations…

Trimmomatic error 1 Hi everyone. I’m trying to trim some read data but i’m getting an error message. This is my input: trimmomatic PE -threads 24 -phred 33 /home/tbeckett/lustre/practice/output_data/ Filtered2S1_L3_R1.fastq.gz /home/tbeckett/lustre/practice/output_data/ Filtered2S1_L3_R2.fastq.gz /home/tbeckett/lustre/practice/output_data/trimmed/ TrimmedFiltered2S1_L3_R1_p.fastq /home/tbeckett/lustre/practice/output_data/trimmed/ TrimmedFiltered2S1_L3_R1_un.fastq /home/tbeckett/lustre/practice/output_data/trimmed/ TrimmedFiltered2S1_L3_R2_p.fastq /home/tbeckett/lustre/practice/output_data/trimmed/ TrimmedFiltered2S1_L3_R2_un.fastq ILLUMINACLIP:NexteraPE-PE.fa LEADING:20 TRAILING:20 MINLEN:60 This is the error i’m getting:…

Illumina Q score 1 Hi all, I have Illumina sequencing results of a bacterial genome and a quality score of 35.89 is associated with these data. I know that a quality score of 30 is 99.99% of base calling accuracy based on this but what about the meaning of 35.89?…

Stochastic Amplicon Ligation. DNA samples for oncology sequencing are typically extracted from FFPE tissues and can have average lengths of less than 500 nt due to accumulated chemical damage [18]. We developed the Stochastic Amplicon Ligation (SAL) method to enzymatically concatenate many short DNA molecules together to utilize the long-read…

Hi Experts, I am using Rsubread align using following comand- align (index=”my_index”, readfile1 = “SRR123456_1.fastq” ,readfile2= “SRR123456_2.fastq”, type=”rna”,input_format = “FASTQ”, minFragLength=35,maxFragLength=151,useAnnotation=”TRUE”, nthreads=64, annot.ext = “my_annotation.gtf.gz”, isGTF = “TRUE”, sortReadsByCoordinates = “TRUE”, output_format = “BAM”) here i have asigned 64 threads but in console, i see only 40 threads, I dont…

The samtools view outputs information from SAM and BAM files in SAM format. You can find a description of the SAM format here: samtools.github.io/hts-specs/SAMv1.pdf Section 1.4 deals with the meaning of each of the manditory coloumns. It includes the following table: Col Field Type Regexp/Range Brief description |—|——|——-|—————————-|—————————————-| 1 QNAME…

Convert a VCF-file in a user specific Format 0 Hello everyone, I am curious if it is possible to convert a VCF-File (with multiple samples) in a Format whith 5 columns. Column should be Sample ID Column: Position on the chromosome Genotyp Number of reads covering site QUAL phred-scaled quality…