Tag: primer3

How to correct the position of my primers

I have been having issue getting my primers to match the expected output. For instance the bases of the first primer starting on the left are off by 4 base pairs to the right of the correct position. This is what I am suppose to get: ttggcagttgggaccgttta This is what…

Continue Reading How to correct the position of my primers

Using Primer3 with python to genotype a SNP at a particular position

I’m trying to figure out how to genotype an SNP at a particular position. Honestly I’m not sure what that means, but here are the instructions: “The idea is that the user wants to genotype a SNP at a particular position. To do this they will need to amplify a…

Continue Reading Using Primer3 with python to genotype a SNP at a particular position

Evaluation and validation of reference genes for RT-qPCR gene expression in Naegleria gruberi

Heggie, T. W. Swimming with death: Naegleria fowleri infections in recreational waters. Travel Med. Infect. Dis. 8, 201–206 (2010). Article  PubMed  Google Scholar  Grace, E., Asbill, S. & Virga, K. Naegleria fowleri: Pathogenesis, diagnosis, and treatment options. Antimicrob. Agents Chemother. 59, 6677–6681 (2015). Article  CAS  PubMed  PubMed Central  Google Scholar …

Continue Reading Evaluation and validation of reference genes for RT-qPCR gene expression in Naegleria gruberi

IDT vs primer 3 – PCR dimerisation

IDT vs primer 3 – PCR dimerisation 2 I am in the process of screening a set of primers for hetero/homodimer formation. I have filtered 1200 primers using Primer3 (via it’s python API – libnano.github.io/primer3-py/quickstart.html#thermodynamic-analysis), and now should have a set of primers that do not form homo/heterodimers with any…

Continue Reading IDT vs primer 3 – PCR dimerisation

Hemoglobin O-Arab first-time molecular detection

Introduction Sickle Cell Disease (SCD) Sickle cell disease is an inherited chronic hemolytic anemia whose clinical manifestations arise from the tendency of the hemoglobin (HbS or sickle hemoglobin) to polymerize and deform red blood cells into the characteristic sickle shape.1 Hb S is insoluble and crystallizes in environments with minimal…

Continue Reading Hemoglobin O-Arab first-time molecular detection

Mapping the poultry insectome in and around broiler breeder pullet farms identifies new potential Dipteran vectors of Histomonas meleagridis | Parasites & Vectors

Sampling Four broiler breeder pullet farms in North Alabama belonging to two different companies were selected for this study. Two of them had a history of histomonosis. All farms had closed houses with dirt floors with tunnel ventilation and pine shavings as litter. Each house had about 20,000 pullets. Biosecurity…

Continue Reading Mapping the poultry insectome in and around broiler breeder pullet farms identifies new potential Dipteran vectors of Histomonas meleagridis | Parasites & Vectors

Primers used for the process of pcr are

Primer Types and their Roles in the PCR Process Polymerase Chain Reaction (PCR) is a widely used technique in molecular biology and genetics to amplify specific DNA sequences. The success of PCR relies on the design and selection of appropriate primers, which are short DNA fragments that bind to complementary…

Continue Reading Primers used for the process of pcr are

Genome-wide discovery of di-nucleotide SSR markers based on whole genome re-sequencing data of Cicer arietinum L. and Cicer reticulatum Ladiz

Varshney, R. K. et al. Draft genome sequence of chickpea (Cicer arietinum) provides a resource for trait improvement. Nat. Biotechnol. 31, 240–246 (2013). Article  CAS  PubMed  Google Scholar  Li, Y. et al. Investigating drought tolerance in chickpea using genome-wide association mapping and genomic selection based on whole-genome resequencing data. Front….

Continue Reading Genome-wide discovery of di-nucleotide SSR markers based on whole genome re-sequencing data of Cicer arietinum L. and Cicer reticulatum Ladiz

Chinese population with hailey-hailey disease

Introduction Hailey–Hailey disease (HHD; Online Mendelian Inheritance in Man no. 169600), also known as familial benign chronic pemphigus, is a rare autosomal dominant inherited blistering dermatosis. It is characterized by recurrent blisters, erythema, and vesicles predominantly located in the neck, axilla, groin, and breast folds.1 Histopathologically, HHD is characterized by…

Continue Reading Chinese population with hailey-hailey disease

IJMS | Free Full-Text | Analysis of CircRNA Expression in Peripheral Blood of Holstein Cows in Response to Heat Stress

1. Introduction With the global temperature rise, the dairy industry is confronted with a significant challenge brought about by severely damaging impacts of heat stress. Heat stress increases mortality rates and threatens the health of livestock, especially in highly productive and intolerant species. The increase in ambient temperature–humidity index (THI)…

Continue Reading IJMS | Free Full-Text | Analysis of CircRNA Expression in Peripheral Blood of Holstein Cows in Response to Heat Stress

Phylogenomic analysis, cryptic species discovery, and DNA barcoding of the genus Cibotium in China based on plastome data

Introduction Traditional Chinese herbal medicine plays an indispensable role in the treatment of multiple diseases in China and other developing countries (Newman et al., 2008). Apart from the traditional usage, many medicinal plants, such as Artemisia annua L. (artemisinin, Tu, 2016), Huperzia javanica (Sw.) C. Y. Yang (Huperzine A, Zangara, 2003;…

Continue Reading Phylogenomic analysis, cryptic species discovery, and DNA barcoding of the genus Cibotium in China based on plastome data

Selection and validation of reference genes for RT-qPCR normalization of porcine alveolar macrophages (PAMs) for PRRSV studies

Sample collection and cDNA synthesis In this study, we used porcine alveolar macrophages (PAMs) that were isolated from 16 different animals between the years 2011 and 2022, and subsequently stored. The PAMs were isolated by bronchoalveolar lavage (BAL) from lungs of euthanized 3-week-old healthy conventional piglets from a PRRSV negative…

Continue Reading Selection and validation of reference genes for RT-qPCR normalization of porcine alveolar macrophages (PAMs) for PRRSV studies

ZNF330/NOA36 interacts with HSPA1 and HSPA8 and modulates cell cycle and proliferation in response to heat shock in HEK293 cells | Biology Direct

Cell lines, culture conditions, heat shock treatment and transfections HeLa, HEK293 and 2D12 (a NOA36-knockout HEK293-cell line generated in this work) cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and 100 U/mL penicillin and 100 µg/mL streptomycin at 37 °C in a CO2 incubator. For heat…

Continue Reading ZNF330/NOA36 interacts with HSPA1 and HSPA8 and modulates cell cycle and proliferation in response to heat shock in HEK293 cells | Biology Direct

Nontuberculous mycobacteria and MAB_0540 mutations

Introduction Nontuberculous mycobacteria (NTM), a mycobacterium other than the Mycobacterium tuberculosis complex (MTC) and M. leprae, are conditional pathogens widely found in the environment.1 Studies have shown that the probability of NTM transmission is extremely low, and exposure comes primarily from the environment, soil, water, etc.1 In recent years, lung…

Continue Reading Nontuberculous mycobacteria and MAB_0540 mutations

Highly-multiplexed and efficient long-amplicon PacBio and Nanopore sequencing of hundreds of full mitochondrial genomes | BMC Genomics

Laboratory methods Tissue samples of lizards were collected over the course of several field seasons in Indonesia under appropriate permits as part of a biotic survey of mountains across the island of Sulawesi. Liver tissues were dissected and stored in RNA-later, which were incubated at ambient temperature for 24 to…

Continue Reading Highly-multiplexed and efficient long-amplicon PacBio and Nanopore sequencing of hundreds of full mitochondrial genomes | BMC Genomics

Identification of two insecticide resistance markers in Ethiopian Anopheles stephensi mosquitoes using a multiplex amplicon sequencing assay

Faulde, M. K., Rueda, L. M. & Khaireh, B. A. First record of the Asian malaria vector Anopheles stephensi and its possible role in the resurgence of malaria in Djibouti Horn of Africa. Acta Trop. 139, 39–43 (2014). Article  PubMed  Google Scholar  R, A. et al. Confirmation of the presence…

Continue Reading Identification of two insecticide resistance markers in Ethiopian Anopheles stephensi mosquitoes using a multiplex amplicon sequencing assay

Clinical phenotyping and genetic diagnosis of a large cohort of Sudanese families with hereditary spinocerebellar degenerations

Patients recruitment and interviews We included a total of 90 patients from 38 Sudanese families in this study with the following inclusion criteria: 1. Patients presenting with symptoms, signs, and/or history suggestive of SCD. 2. Non-genetic causes that can mimic neurological illnesses that resemble SCD due to pregnancy- or birth-related…

Continue Reading Clinical phenotyping and genetic diagnosis of a large cohort of Sudanese families with hereditary spinocerebellar degenerations

Python formatting when visualizing Primer3-py dimers

I am currently creating a program to analyze primers prior to multiplexing. I am interested in visualizing homo/heterodimers and hairpin structures. To do this I am using Primer3-py bindings. I am able to get a nice visual representation of dimers like so: z = primer3.bindings.calcHeterodimer(‘TGACACCGCCAAGGTGAATTT’, ‘CCGCTCCGTGGTTGGTCCGGTGGCGAGCGG’, output_structure = True).ascii_structure_lines print([i.split(‘\t’)[1]…

Continue Reading Python formatting when visualizing Primer3-py dimers

Implementation of helicase-dependent amplification with SYBR Green I for prompt naked-eye detection of bacterial contaminants in platelet products

Representative bacterial strains Five strains of bacteria, including Staphylococcus aureus (ATCC 29,523), Staphylococcus epidermidis, Bacillus cereus, Escherichia coli (ATCC 25,922), and Serratia marcescens, were used as representative strains. All of these strains have been previously reported as common transfusion-relevant bacterial strains of platelet products1,8,9. The ATCC bacterial strains were kindly…

Continue Reading Implementation of helicase-dependent amplification with SYBR Green I for prompt naked-eye detection of bacterial contaminants in platelet products

Error when running Kruskal Wallis test in for loop

log_fc primer ID_1 category Avg_logfc primer_1 42 test_1 1.88444044 primer_2 43 test_1 0.8730141 primer_3 44 test_1 1.10542821 primer_4 45 test_1 0.79234524 primer_1 11 test_2 0.33098178 primer_2 12 test_2 0.66117247 primer_3 13 test_2 0.62520437 primer_4 14 test_2 0.21972443 primer_1 94 test_3 -0.96924447 primer_2 95 test_3 1.4806643 primer_3 96 test_3 1.83216384 primer_4…

Continue Reading Error when running Kruskal Wallis test in for loop

Genotyping approach to predict Coa and Cob antigens

Introduction The Colton (CO) blood group system (ISBT No. 015) currently consists of four antigens; a high prevalence antigen, Coa with its antithetical antigen, Cob, and the other high prevalence antigens, Co3 and Co4.1 The CO antigens are carried on red blood cell (RBC) water transporter, aquaporin-1 (AQP1), encoded by…

Continue Reading Genotyping approach to predict Coa and Cob antigens

Primer design scripts. OSError: Missing SEQUENCE tag

I made primer design script. when I input the sequence, there are error. how can i solve this problem. i attached error code and my script. please give me a solution. Thank you very much. File “Primer_short.py”, line 26, in <module> ‘SEQUENCE_TEMPLATE’: raw_sequence File “/home/youngho/anaconda3/lib/python3.7/site-packages/primer3/bindings.py”, line 276, in designPrimers return…

Continue Reading Primer design scripts. OSError: Missing SEQUENCE tag

Genetic characteristics involving the PD-1/PD-L1/L2 and CD73/A2aR axes and the immunosuppressive microenvironment in DLBCL

Key messages What is already known on this topic Targeting immunosuppressive pathways have emerged as promising strategies for cancer treatment. The genetic characteristics of PD-1/PD-L1/L2 (programmed cell death protein 1/programmed cell death ligand 1/ligand 2) and CD73/A2aR (A2a adenosine receptor) and the effect of these two signalings on dysfunctional CD8+…

Continue Reading Genetic characteristics involving the PD-1/PD-L1/L2 and CD73/A2aR axes and the immunosuppressive microenvironment in DLBCL

Convenient and High-Throughput PCR Primer Design for Circular RNA Quantification

Please use this url to cite or link to this publication: hdl.handle.net/1854/LU-8743723 MLA Vromman, Marieke, et al. “CIRCprimerXL: Convenient and High-Throughput PCR Primer Design for Circular RNA Quantification.” Frontiers in Bioinformatics, 2022, doi:10.3389/fbinf.2022.834655. APA Vromman, M., Anckaert, J., Vandesompele, J., & Volders, P.-J. (2022). CIRCprimerXL: Convenient and High-Throughput PCR Primer…

Continue Reading Convenient and High-Throughput PCR Primer Design for Circular RNA Quantification

Bioconductor – TAPseq

DOI: 10.18129/B9.bioc.TAPseq     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see TAPseq. Targeted scRNA-seq primer design for TAP-seq Bioconductor version: 3.12 Design primers for targeted single-cell RNA-seq used by TAP-seq. Create sequence templates for target gene panels and design gene-specific primers using…

Continue Reading Bioconductor – TAPseq

Primers and multimapping ?

Primers and multimapping ? 0 Hi, I am trying design primer using primer3. Maybe a stupid question but I was wondering if the forward primer map in multiple location on the genome but the reverse map in one uniq location, will I still got a pcr product ? primer3 •…

Continue Reading Primers and multimapping ?

Primer3 issue with the Sequence_ID

Primer3 issue with the Sequence_ID 0 Hi everyone, I am trying to sign primers for my sequences but I have an error that I do not understand the problem. I made my finputfile.txt and I made the command below: aka@aka:~/Desk/Primer$ /home/aka/primer3/src/primer3_core < input.txt > result.txt input.txt PRIMER_TASK=generic PRIMER_PICK_LEFT_PRIMER=1 PRIMER_PICK_INTERNAL_OLIGO=0 PRIMER_PICK_RIGHT_PRIMER=1…

Continue Reading Primer3 issue with the Sequence_ID

Automated Primer-Blast like funcionnality

Automated Primer-Blast like funcionnality 5 A member of our lab is using Primer-Blast (www.ncbi.nlm.nih.gov/tools/primer-blast/) to find what DNA her pairs of primers amplify in the NT nucleotide database. She designed degenerated primers and the number of possible pairs goes up to 256. She does not want to do that many…

Continue Reading Automated Primer-Blast like funcionnality