Tag: primer3
Phylogenomic analysis, cryptic species discovery, and DNA barcoding of the genus Cibotium in China based on plastome data
Introduction Traditional Chinese herbal medicine plays an indispensable role in the treatment of multiple diseases in China and other developing countries (Newman et al., 2008). Apart from the traditional usage, many medicinal plants, such as Artemisia annua L. (artemisinin, Tu, 2016), Huperzia javanica (Sw.) C. Y. Yang (Huperzine A, Zangara, 2003;…
Selection and validation of reference genes for RT-qPCR normalization of porcine alveolar macrophages (PAMs) for PRRSV studies
Sample collection and cDNA synthesis In this study, we used porcine alveolar macrophages (PAMs) that were isolated from 16 different animals between the years 2011 and 2022, and subsequently stored. The PAMs were isolated by bronchoalveolar lavage (BAL) from lungs of euthanized 3-week-old healthy conventional piglets from a PRRSV negative…
ZNF330/NOA36 interacts with HSPA1 and HSPA8 and modulates cell cycle and proliferation in response to heat shock in HEK293 cells | Biology Direct
Cell lines, culture conditions, heat shock treatment and transfections HeLa, HEK293 and 2D12 (a NOA36-knockout HEK293-cell line generated in this work) cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and 100 U/mL penicillin and 100 µg/mL streptomycin at 37 °C in a CO2 incubator. For heat…
Nontuberculous mycobacteria and MAB_0540 mutations
Introduction Nontuberculous mycobacteria (NTM), a mycobacterium other than the Mycobacterium tuberculosis complex (MTC) and M. leprae, are conditional pathogens widely found in the environment.1 Studies have shown that the probability of NTM transmission is extremely low, and exposure comes primarily from the environment, soil, water, etc.1 In recent years, lung…
Highly-multiplexed and efficient long-amplicon PacBio and Nanopore sequencing of hundreds of full mitochondrial genomes | BMC Genomics
Laboratory methods Tissue samples of lizards were collected over the course of several field seasons in Indonesia under appropriate permits as part of a biotic survey of mountains across the island of Sulawesi. Liver tissues were dissected and stored in RNA-later, which were incubated at ambient temperature for 24 to…
Identification of two insecticide resistance markers in Ethiopian Anopheles stephensi mosquitoes using a multiplex amplicon sequencing assay
Faulde, M. K., Rueda, L. M. & Khaireh, B. A. First record of the Asian malaria vector Anopheles stephensi and its possible role in the resurgence of malaria in Djibouti Horn of Africa. Acta Trop. 139, 39–43 (2014). Article PubMed Google Scholar R, A. et al. Confirmation of the presence…
Clinical phenotyping and genetic diagnosis of a large cohort of Sudanese families with hereditary spinocerebellar degenerations
Patients recruitment and interviews We included a total of 90 patients from 38 Sudanese families in this study with the following inclusion criteria: 1. Patients presenting with symptoms, signs, and/or history suggestive of SCD. 2. Non-genetic causes that can mimic neurological illnesses that resemble SCD due to pregnancy- or birth-related…
Python formatting when visualizing Primer3-py dimers
I am currently creating a program to analyze primers prior to multiplexing. I am interested in visualizing homo/heterodimers and hairpin structures. To do this I am using Primer3-py bindings. I am able to get a nice visual representation of dimers like so: z = primer3.bindings.calcHeterodimer(‘TGACACCGCCAAGGTGAATTT’, ‘CCGCTCCGTGGTTGGTCCGGTGGCGAGCGG’, output_structure = True).ascii_structure_lines print([i.split(‘\t’)[1]…
Implementation of helicase-dependent amplification with SYBR Green I for prompt naked-eye detection of bacterial contaminants in platelet products
Representative bacterial strains Five strains of bacteria, including Staphylococcus aureus (ATCC 29,523), Staphylococcus epidermidis, Bacillus cereus, Escherichia coli (ATCC 25,922), and Serratia marcescens, were used as representative strains. All of these strains have been previously reported as common transfusion-relevant bacterial strains of platelet products1,8,9. The ATCC bacterial strains were kindly…
Error when running Kruskal Wallis test in for loop
log_fc primer ID_1 category Avg_logfc primer_1 42 test_1 1.88444044 primer_2 43 test_1 0.8730141 primer_3 44 test_1 1.10542821 primer_4 45 test_1 0.79234524 primer_1 11 test_2 0.33098178 primer_2 12 test_2 0.66117247 primer_3 13 test_2 0.62520437 primer_4 14 test_2 0.21972443 primer_1 94 test_3 -0.96924447 primer_2 95 test_3 1.4806643 primer_3 96 test_3 1.83216384 primer_4…
Genotyping approach to predict Coa and Cob antigens
Introduction The Colton (CO) blood group system (ISBT No. 015) currently consists of four antigens; a high prevalence antigen, Coa with its antithetical antigen, Cob, and the other high prevalence antigens, Co3 and Co4.1 The CO antigens are carried on red blood cell (RBC) water transporter, aquaporin-1 (AQP1), encoded by…
Primer design scripts. OSError: Missing SEQUENCE tag
I made primer design script. when I input the sequence, there are error. how can i solve this problem. i attached error code and my script. please give me a solution. Thank you very much. File “Primer_short.py”, line 26, in <module> ‘SEQUENCE_TEMPLATE’: raw_sequence File “/home/youngho/anaconda3/lib/python3.7/site-packages/primer3/bindings.py”, line 276, in designPrimers return…
Genetic characteristics involving the PD-1/PD-L1/L2 and CD73/A2aR axes and the immunosuppressive microenvironment in DLBCL
Key messages What is already known on this topic Targeting immunosuppressive pathways have emerged as promising strategies for cancer treatment. The genetic characteristics of PD-1/PD-L1/L2 (programmed cell death protein 1/programmed cell death ligand 1/ligand 2) and CD73/A2aR (A2a adenosine receptor) and the effect of these two signalings on dysfunctional CD8+…
Convenient and High-Throughput PCR Primer Design for Circular RNA Quantification
Please use this url to cite or link to this publication: hdl.handle.net/1854/LU-8743723 MLA Vromman, Marieke, et al. “CIRCprimerXL: Convenient and High-Throughput PCR Primer Design for Circular RNA Quantification.” Frontiers in Bioinformatics, 2022, doi:10.3389/fbinf.2022.834655. APA Vromman, M., Anckaert, J., Vandesompele, J., & Volders, P.-J. (2022). CIRCprimerXL: Convenient and High-Throughput PCR Primer…
Bioconductor – TAPseq
DOI: 10.18129/B9.bioc.TAPseq This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see TAPseq. Targeted scRNA-seq primer design for TAP-seq Bioconductor version: 3.12 Design primers for targeted single-cell RNA-seq used by TAP-seq. Create sequence templates for target gene panels and design gene-specific primers using…
Primers and multimapping ?
Primers and multimapping ? 0 Hi, I am trying design primer using primer3. Maybe a stupid question but I was wondering if the forward primer map in multiple location on the genome but the reverse map in one uniq location, will I still got a pcr product ? primer3 •…
Primer3 issue with the Sequence_ID
Primer3 issue with the Sequence_ID 0 Hi everyone, I am trying to sign primers for my sequences but I have an error that I do not understand the problem. I made my finputfile.txt and I made the command below: aka@aka:~/Desk/Primer$ /home/aka/primer3/src/primer3_core < input.txt > result.txt input.txt PRIMER_TASK=generic PRIMER_PICK_LEFT_PRIMER=1 PRIMER_PICK_INTERNAL_OLIGO=0 PRIMER_PICK_RIGHT_PRIMER=1…
Automated Primer-Blast like funcionnality
Automated Primer-Blast like funcionnality 5 A member of our lab is using Primer-Blast (www.ncbi.nlm.nih.gov/tools/primer-blast/) to find what DNA her pairs of primers amplify in the NT nucleotide database. She designed degenerated primers and the number of possible pairs goes up to 256. She does not want to do that many…
