Categories
Tag: QC
Moderate Mapping percentage
Moderate Mapping percentage 1 Hi all, I received my sequenced transcriptome and genomic data from my service provider and started working with it. Both the DNA and RNA data passed quality metrics post trimming. But the mapping percentage comes out to be 90% using bowtie-DNA and 85% using Hisat2-RNA. I…
Professor of Medical Bioinformatics and Statistical Genetics job with Aarhus University (AU)
The Department of Biomedicine at Faculty of Health at Aarhus University invites applications for a position as Professor in the field of Medical Bioinformatics and Statistical Genetics as per 1 July 2024 or as soon as possible thereafter. The position is a time-limited full-time position for 5 years with extension…
Ubuntu Manpage: FastQC – high throughput sequence QC analysis tool
Provided by: fastqc_0.11.9+dfsg-5_all NAME FastQC – high throughput sequence QC analysis tool SYNOPSIS fastqc seqfile1 seqfile2 .. seqfileN fastqc [-o output dir] [–(no)extract] [-f fastq|bam|sam] [-c contaminant file] seqfile1 .. seqfileN DESCRIPTION FastQC reads a set of sequence files and produces from each one a quality control report consisting of…
Special Episode 3: PhiX / UMIs / QC
Podcast: Explain Podcast Erschienen: 09.02.2024Dauer: 01:10:43 Getting the most out of Machines Chapters: 04:30 PhiX 14:30 low complexity 19:30 UMIs 32:10 FastQC 43:00 MultiQC 56:40 PycoQC PhiX concentrations for loading a validation run: knowledge.illumina.com/instrumentation/general/instrumentation-general-reference_material-list/000001536 Dnatech on why UMIs are used: dnatech.genomecenter.ucdavis.edu/faqs/what-are-umis-and-why-are-they-used-in-high-throughput-sequencing/ BMH learning on UMIs: www.youtube.com/watch?v=sRPMsnhIBK0 FastQC for QC of…
cfDNA Extraction Sensitivity Controls – cfDNA Extraction Sensitivity Controls
Does your cfDNA extraction process affect the Limit of Detection (LOD) of a particular gene target? Our new products, cfDNA Extraction Sensitivity Panels and Extraction Low Positive Controls, can help your research and development for liquid biopsy assays. NEW PRODUCTS: cfDNA EXTRACTION SENSITIVITY PANELS & CONTROLS The Extraction Sensitivity Controls…
How to trim miRNA reads?
How to trim miRNA reads? 1 Hi there, I am new to bioinformatics. I am trying to prepare fasta.gz files for uploading onto CPSS, a websever for miRNA-seq datasets. My data is from Gene Omnibus db. Basically the sample fasta file appears like this: ;>SRR1658346.1 HISEQ1:187:D0NWFACXX:3:1101:2565:2050 length=51 ATCATACAAGGACAATTTCTTTTAACGTCGTATGCCGTCTTCTGCTTGNAA >SRR1658346.2 HISEQ1:187:D0NWFACXX:3:1101:2654:2232…
European Mouse Mutant Cell Repository
The following list defines the different statuses that EUCOMM report on the constructs in their pipeline. Mice – Genotype confirmed (M-GC)The genotype of testcross offspring has been confirmed molecularly. Mice – Germline transmission (M-GLT)Test crosses of chimaeras indicate germline transmission of the ES cell mutation based on coat color. Mice…
DADA2 formatted 16S rRNA gene sequences for both bacteria & archaea
Description This version is to stay up to date with the improvements and increase in 16S rRNA gene sequences (SSU) added to the GTDB release 214.1. Please read this post for the stats on the updates. gtdb.ecogenomic.org/stats/r214 . There has been no change to the RDP-RefSeq reference database If anyone…
How to convert and annotate apt-probeset-genotype into PLINK format
How to convert and annotate apt-probeset-genotype into PLINK format 2 Dear all, I called SNP genotypes of 100 Affy6 CEL files using apt-probeset-genotype from APT in order to perform a subsequent CNV analysis with PennCNV. As PennCNV doesn’t integrate SNP quality control procedure (move out SNP with genotype call <…
Single-cell RNA-seq workflow
In this tutorial we walk through a typical single-cell RNA-seq analysis using Bioconductor packages. We will try to cover data from different protocols, but some of the EDA/QC steps will be focused on the 10X Genomics Chromium protocol. We start from the output of the Cell Ranger preprocessing software. This…
A high-resolution transcriptomic and spatial atlas of cell types in the whole mouse brain
Mouse breeding and husbandry All experimental procedures related to the use of mice were approved by the Institutional Animal Care and Use Committee of the AIBS, in accordance with NIH guidelines. Mice were housed in a room with temperature (21–22 °C) and humidity (40–51%) control within the vivarium of the AIBS…
Single Cell Data Scientist at European Molecular Biology Laboratory (EMBL)
About the team/job We are looking for a Bioinformatician to join the Open Targets data team. We are seeking an enthusiastic team member to expand our informatics platforms through the integration of single cell omics data to enhance drug discovery. This role would suit someone with experience in data integration…
Reduced Representation Bisulfite Sequencing (RRBS)
We’re Ready for Your Order! Here’s what to expect in your project’s life cycle. If you have a question during sequencing, it’s easy to get in touch! 01 Request a Consultation Create an account through our client portal and get in touch with your local field team to start designing…
Whole-Genome Bisulfite Sequencing | Psomagen, Inc.
We’re Ready for Your Order! Here’s what to expect in your project’s life cycle. If you have a question during sequencing, it’s easy to get in touch! 01 Request a Consultation Create an account through our client portal and get in touch with your local field team to start designing…
Generating high-quality plant and fish reference genomes from field-collected specimens by optimizing preservation
Sample collection A total of nine species of marine fish were collected across three different sampling days (September 7th, 9th, and 12th 2022) under IACUC Animal Use Protocol S12219 (Supplementary Data 1). Six species were collected using a speargun donated by a local fisher. Fish were transported back to shore, euthanized,…
How to perform quality control for sex when there are no variants after thresholding for MAF
How to perform quality control for sex when there are no variants after thresholding for MAF 0 How to perform quality control for sex when there are no variants after thresholding for MAF? I am trying with PLINK. Would it be accurate to merge with 1000 genomes European allele frequencies…
University of Connecticut Single Cell RNA-seq Workshop December 12-15, 2023
News:University of Connecticut Single Cell RNA-seq Workshop December 12-15, 2023 0 Join UConn’s Computational Biology Core for a Single Cell RNAseq Workshop December 12-15, 2023 Scope of the workshop: Introduction to different data file formats. Understanding the Considerations while designing single-cell RNA-seq experiments, Hands on steps to convert raw single-cell…
Bioinformatics Analyst in Proteomics – basel-jobs.ch
The Position In Roche’s Pharmaceutical Research and Early Development organization (pRED), we make transformative medicines for patients in order to tackle some of the world’s toughest unmet healthcare needs. At pRED, we are united by our mission to transform science into medicines. Together, we create a culture defined by curiosity,…
Need to PrepSCTfindMarker again after subset if the original object has already been normalized?
Need to PrepSCTfindMarker again after subset if the original object has already been normalized? 0 Hi, I’ve got a seurat object of 2 samples integrated after QC and SCTv2. I then performed clustering and PrepSCTfindMarker followed by findMarker. These all went smoothly. Then I made a subset from 3 clusters,…
Lower-limb ulcers in participants with leprosy sequelae
Introduction Leprosy is a disabling infectious disease that predominantly occurs in the skin and peripheral nerves and is transmitted by contact with pathogenic bacteria through the respiratory tract and broken skin. Leprosy is attributed to infection with Mycobacterium leprae (M. leprae)1 and the more recently discovered Mycobacterium lepromatosis.2 In addition,…
Process Truncated fastq file
Process Truncated fastq file 1 Dear all, I have 150bp paired-end mRNA data, for one sample in the reverse reads (R2) file the QC (FastQC) run for upto 95 % and then failed with an error message: Failed to process file Sample1-mRNA_R2.fastq.gz uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Ran out of data in the middle…
Issue with genetic QC sex check
Issue with genetic QC sex check 1 Hi, I am doing a sex check on genetic data for a cohort I am working on, consisting of about 830 people. Most people seem to have incorrect sex assignment (around 560 problems). I have used plink QC and there were no people…
Bioinformatics Programmer in New York, NY for Columbia University
Details Posted: 01-Dec-23 Location: New York, New York Type: Full-time Salary: Open Categories: Staff/Administrative Job Type: Officer of Administration Bargaining Unit: Regular/Temporary: Regular End Date if Temporary: Hours Per Week: 35 Standard Work Schedule: M-F 9am-5pm Building: Salary Range: $80,000 – $95,000 The salary of the finalist selected for this…
Mitophagy in human health, ageing and disease
Palikaras, K., Lionaki, E. & Tavernarakis, N. Mechanisms of mitophagy in cellular homeostasis, physiology and pathology. Nat. Cell Biol. 20, 1013–1022 (2018). Article CAS PubMed Google Scholar Palikaras, K., Lionaki, E. & Tavernarakis, N. Coordination of mitophagy and mitochondrial biogenesis during ageing in C. elegans. Nature 521, 525–528 (2015). Article …
East Asian-specific and cross-ancestry genome-wide meta-analyses provide mechanistic insights into peptic ulcer disease
We conducted a three-stage genome-wide analysis of PUD and its subtypes. An overview of the workflow is provided in Fig. 1 and Supplementary Fig. 1. PUD cases in the east Asian populations were obtained by combining individuals with any of the two major PUD subtypes (DU and GU), which were…
Bioinformatics Programmer – Columbia University Medical Center, New York, United States
Bioinformatics Programmer Columbia University Medical Center Job Type: Officer of Administration Bargaining Unit: Regular/Temporary: Regular End Date if Temporary: Hours Per Week: 35 Standard Work Schedule: M-F 9am-5pm Building: Salary Range: $80,000 – $95,000 The salary of the finalist selected for this role will be set based on a variety…
BioVie Announces Efficacy Data from Phase 3 Trial of
Positive Trending Data from 57 Per-Protocol Patients Suggest NE3107 is Biologically Active and May Have Impact on Cognitive, Functional, and Biomarker Endpoints Sponsor Identified Issues Relating to Significant GCP Violations and Protocol Deviations, Which Allowed for Data from Only a Subset of Enrolled Patients to be Included in the Efficacy Analysis;…
Release Testing Of AAV Gene Therapies For Clinical Trials
By Mark Haydock, biologics CMC consultant, Agile Biologics Consulting LLC Adeno-associated virus (AAV) gene therapies that are designed to deliver a therapeutic transgene to patients are complex products that can be challenging to manufacture. Because of their complexity, a variety of analytical methods are required to ensure that these viral…
Testing Smart Deep Basecaller for Sanger Sequencing QC
Testing Smart Deep Basecaller for Sanger Sequencing QC Tuesday, December 12, 2023, 11:00 AM – 12:00 PM EST Category: ABRF Events Testing Smart Deep Basecaller for Sanger Sequencing QCPresented by Werner Sterr, Sequencing Manager Join this webinar to learn about the testing process implemented by Thermo Fisher Scientific GeneArt GmbH to…
pheatmap lengends are being cutoff
I’m trying to removed annotations for the heat map legend. Originally this what the heatmap looks like using the following code:pheatmap(M.adj, annotation_col = conds, #dropData set border_color = NA, filename = “QC/QCheatmap.pdf”, color = colorRampPalette(rev(brewer.pal(n=11, name=”RdBu”)))(100), cluster_cols = TRUE, show_rownames = FALSE, main=paste(“Gene Expression (VST) of Top 1000 Variable Genes”)…
Biophysical properties of NaV1.5 channels from atrial-like and ventricular-like cardiomyocytes derived from human induced pluripotent stem cells
hiPSC cultures and cardiomyocyte differentiation The hiPSC lines CBRCULi001-A54 and CBRCULi008-A55 were generated from a 44-year-old male and 75-year-old female control lymphoblastoids, respectively, and they were reprogramed at the LOEX core facility (Quebec City, QC, Canada). All the work with hiPSCs were approved by CIUSSS de la Capitale-Nationale ethics committee (Project…
Genetic data QC prior to imputation
Hi there, Should SNPs that have this sort of name ‘exm_….” be removed from genetic data at the QC stage. Not necessarily, they used this ID cause it was part of their ExomeSNP array, probably because there was no RSID at the time, for example this one: www.ncbi.nlm.nih.gov/projects/SNP/snp_ss.cgi?subsnp_id=ss1958317049 Should SNPs…
Pruning with –indep-pairwise with plink 1.9
I’m new to PLINK and I would like to obtain a file with SNPs in approximate linkage equilibrium. Here is my script and the outputs of each step. If someone could tell me if there is an error in the script because at…
Analyzing somatic mutations by single-cell whole-genome sequencing
Failla, G. The aging process and cancerogenesis. Ann. N. Y. Acad. Sci. 71, 1124–1140 (1958). Article CAS PubMed Google Scholar Szilard, L. On the nature of the aging process. Proc. Natl Acad. Sci. USA 45, 30–45 (1959). Article CAS PubMed PubMed Central Google Scholar Vijg, J. & Dong, X. Pathogenic…
Allen Institute for AI (AI2) hiring Head of Bioinformatics at Stealth Life Science Startup in Seattle, WA
About UsWe are an early stage startup using generative AI to fundamentally change life sciences research and accelerate the pace of biomedical discovery. Genomic data are at the heart of most modern molecular studies and tools, from basic research to clinical decision support, but these data are hard to work…
132amd64-default][science/votca] Failed for votca-2023 in package
You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: pkg-status.freebsd.org/beefy16/data/132amd64-default/5b346a1c0cc2/logs/votca-2023.log Build URL: pkg-status.freebsd.org/beefy16/build.html?mastername=132amd64-default&build=5b346a1c0cc2 Log: =>> Building science/votca build started at Tue Nov 21…
Salmon (or other pseudo-mappers) for multi-species RNAseq read filtering
Hello all, Background: I’ve inherited a new RNAseq data set and am thinking about updating my approaches (last time I did this I was using HISAT and Cuffdiff). I’d like some opinions on best strategies to disentangle/filter out parasite microbe reads from infected host reads before preforming a differential gene…
All variants in a VCF register as “invalid genotype records in input file”
ANNOVAR Error: All variants in a VCF register as “invalid genotype records in input file” 0 Hello, I am running into an error with convert2annovar.pl where it is registering all of the variants in my VCF as invalid. My VCF is 1925 variants plus the header with the following format:…
Assistant Professor Bioinformatics Jobs in Islamabad 2023 Page 2
Job Vacancies at Higher Education Commission HEC Higher Education Commission HEC, Islamabad, Islamabad, Pakistan Vacancies: | Project Director | Project Manager | Account Manager | Project Assistant | Naib Qasid | Driver | Nov 13, 2023 – Apply Now Vacancy Announced at Public Sector Private Limited Company Islamabad Public Sector…
How long does sequencing take?
The turnaround time for HLA and genome sequencing varies based on the sequencing type, sample quality, and number of samples. We typically estimate turnaround between 10-15 business days for smaller projects, from the time your samples arrive in the lab to when we deliver results. Important Notes DNA extraction is…
Qualimap bamqc v2.2.2 Cannot invoke “org.bioinfo.ngs.qc.qualimap.beans.XYVector.getXVector()” because “this.data” is null
That solves the problem! It is a panel data so I thought it would be expected not to have regions outside the given intervals. Maybe just for completeness, what are the implications of not supplying a –feature-file ? Otherwise, the problem is resolved: “` QualiMap v.2.2.2-devBuilt on 2019-11-11 14:05 Selected…
Bioinformatics Scientist | Cleared Careers
Overview Axle is a bioscience andinformation technology company that offers advancements intranslational research, biomedical informatics, and datascience applications to research centers and healthcareorganizations nationally and abroad. With experts inbiomedical science, software engineering, and programmanagement, we focus on developing and applying researchtools and techniques to empower decision-making andaccelerate research discoveries. We…
MAJOR Computational Biology Research Lab
MAJOR Computational Biology Research Lab (MCBRL) uses computer science algorithms to solve biology related problems, bioinformatics software development and develop bioinformatics cloud computing platforms or services for handling and analyzing large-scale biological data.. The workflow of hdWGCNA analysis for Single-cell Spatial Transcriptomics data RNA-seq Schematicsc/nRNA-seq Schematic ” RNA-seq Schematic 空间转录共表达网络分析流程…
RNA star taking more than 24h to complete 2nd pass
RNA star taking more than 24h to complete 2nd pass 0 Hello all, I am very new to star alignment and rna seq in general. I have 20 mouse rna bulk samples which I am trying to align to a reference genome, after performing QC filtering and trimming. To align,…
US Department of Agriculture (USDA) Agricultural Research Service (ARS) hiring Biologist (Computational Bioinformatics) in Las Cruces, NM
Summary This position is in the Agricultural Research Service (ARS), Field Organization, Plains Area (PA), Range Management Research Unit located in Las Cruces, NM. In this position, you will be responsible for integrating existing databases and identifying and implementing procedures for analysis of vegetation, climate and soil data in agroecosystems…
MD Anderson Cancer Center hiring Associate Bioinformatics Data Scientist in Houston, TX
SummaryThe University of Texas MD Anderson Cancer Center in Houston is one of the world’s most respected centers focused on cancer patient care, research, education and prevention. It was named the nation’s No. 1 hospital for cancer care in U.S. News & World Report’s 2022-2023 rankings. It is one of…
mRNA Vaccines and Therapeutics Combine Power and Finesse
By Kathy Liszewski Medical applications of mRNA technology are in the spotlight—not just mRNA-based vaccines, but mRNA-based therapeutics, too. The mRNA-based vaccines are the most conspicuous successes. They include the vaccines approved for use against COVID-19, of course, as well as the more recent vaccines approved for use against respiratory…
Bioinformatics Scientist, multi-omics of Immune-Mediated Inflammatory Diseases
We are looking for a highly motivated postdoctoral researcher to work in the multi-omic analysis of Immune-Medated Inflammatory Diseases (IMIDs). The successful applicant will work in IMIDomics, a rapidly growing company focused on bringing the power of precision medicine to IMID patients. A fundamental strategy at IMIDomics is to integrate…
Senior Bioinformatics Scientist @ Storm3
⚡ Senior Bioinformatics Scientist (HUMAN GENETICS) 🧪 Healthtech Start-Up 📌 Remote (US) 💰 $150K Base + Bonus + Impressive equity Are you interested in joining a revolutionary Biotech start-up that is using their ground-breaking AI platform to change the way we discover drugs? This established start-up with over $30M in…
Uncertainty of how to proceed with Metagenomic Analysis of WGS data
Uncertainty of how to proceed with Metagenomic Analysis of WGS data 1 Hello guys, I am relatively new to metagenomic data analysis and even bioinformatics in general. To maybe give you a brief idea of what my issue is, I will just explain what my data is about: the data…
Quality control on imputed genotypes for GWAS / application of PGS
Quality control on imputed genotypes for GWAS / application of PGS 0 Hi everyone, I want to run a GWAS on imputed genotypes from UKB. Unfortunately, I only found tutorials that describe the quality control of genotypes in preparation for a GWAS. Are there tutorials for imputed datasets? I suppose…
bwa-mem2 error: skip or orientatioon FF
bwa-mem2 error: skip or orientatioon FF 1 I am having some problems with using bwa-mem2 After using the command line(below): there is some error in my results. The error message stated: “Skip or orientation FR as there are not enough pairs. paired reads have different names. How can I solve…
Samtools index not working in Snakemake
I am setting up a Snakemake pipeline for sequencing reads alignment and variants calling. But the samtools index rule is not activated, and the subsequent haplotype caller rule fail. I think it is because the samtools index rule is not perceived as necessary to execute the output of rule all…
scRNA-seq quality control
scRNA-seq quality control 0 Hi, Based on the literature, some genes like Gm42418, AY036118 and Malat1 are indicators of rRNA contamination or low quality cells and are suggested to be removed from the count matrix before normalization. I am dealing with a dataset that after removal of controversial genes (MT…
Bioinformatics Scientist job with BostonGene
Summary: We are looking for a highly motivated and capable Bioinformatics Scientist with experience and interest in translational cancer research and the development of novel transcriptomic and genomic assays. This position requires experience with scientific programming, relational data systems, algorithm development, and statistical modeling. Key Responsibilities: Act as a core…
RVFScan predicts virulence factor genes and hypervirulence of the clinical metagenome | Briefings in Bioinformatics
Abstract Bacterial infections often involve virulence factors that play a crucial role in the pathogenicity of bacteria. Accurate detection of virulence factor genes (VFGs) is essential for precise treatment and prognostic management of hypervirulent bacterial infections. However, there is a lack of rapid and accurate methods for VFG identification from…
FastQC quality dropping after trimming
FastQC quality dropping after trimming 1 Hello everyone, I have a question about my Fast QC report. Before the trimming, this is the FastQC report After trimming with ILLUMINACLIP:$TRIMM_ADAPTERS/NexteraPE-PE.fa:2:30:10 \ SLIDINGWINDOW:10:30 \ LEADING:30 \ TRAILING:30 \ HEADCROP:15 \ MINLEN:100 I have this FastQC report why is the quality dropping in…
The Electroporation Technique: Principles, Applications, and Adva
Opinion Article – (2023) Volume 12, Issue 9 The Electroporation Technique: Principles, Applications, and Advancements Doan Ziya* Department of Life Science, Sogang University, Seoul, South Korea *Correspondence: Doan Ziya, Department of Life Science, Sogang University, Seoul, South Korea, Email: Received: 04-Sep-2023, Manuscript No. BOM-23-23603; Editor assigned: 07-Sep-2023, Pre…
DE Jobs – EXACT SCIENCES CORPORATION Bioinformatics Product Owner in MADISON, Wisconsin, United States
JOB REQUIREMENTS: Position Overview The Bioinformatics Product Owner is to work in a highly dynamic environment, engaging and coordinating the activities with internal stakeholders, collaborators, software developers, contractors, and third-party vendors for the flawless development of critical bioinformatics products and its implementation for a Genomics CLIA laboratory and FDA approved…
Comment: RNA seq QC
Looks like this . I am sure that is an example of a strong adapter contamination. ![fastqc ][1] The R1 report of overrepresented sequences shows(before the trimming): ![adapter][2] [1]: /media/images/e289023a-9836-4537-adbd-d8ae5e03 [2]: /media/images/3b7f0506-3baa-4e0f-95ff-56bcd6e9 They are all from adapter contamination. But I cannot understand how it is possible that I am losing…
RNA seq QC
Hello everyone, I have this strange FastQC report. This is the R1 report before the trimming, the R2 is quite similar. This is a sample from RNA-seq experiment. Before the trimming, I have 3875104 reads, after the trimming with trimmomatic(SLIDINGWINDOW:10:30 LEADING:30 TRAILING:30 HEADCROP:15) I have 742368 reads. Can you help…
HLA allele-calling using multi-ancestry whole-exome sequencing from the UK Biobank identifies 129 novel associations in 11 autoimmune diseases
HLA allele calling from WES HLA-HD was used to call HLA alleles for 454,824 participants at 3-field resolution (representing the allele’s serological specificity, HLA protein, and synonymous variants). We used the UKB whole-genome genotyping (unavailable in 1283 participants) projected on the 1000 Genome reference to estimate genetic ancestry. We found…
Plink Error
Plink Error 1 Hi I am trying to convert ped file for hapmap3 I downloaded here ftp.ncbi.nlm.nih.gov/hapmap/genotypes/2009-01_phaseIII/plink_format/ and unzipped with binzip2 but I am getting the following error when running this command PLINK v1.90b5.2 64-bit (9 Jan 2018) www.cog-genomics.org/plink/1.9/ (C) 2005-2018 Shaun Purcell, Christopher Chang GNU General Public License v3…
What is Next Generation Sequencing (NGS)?
History of Next-generation Sequencing Next Generation Sequencing (NGS) is a revolutionary genetic analysis technique that involves fragmenting the genetic material (DNA or RNA) and attaching oligonucleotides with known sequences through a process called adapter ligation. This allows the resulting fragments to interact with the selected sequencing platform. Subsequently, the bases within…
Bioinformatics Analyst job with University of Miami
Current Employees: If you are a current Staff, Faculty or Temporary employee at the University of Miami, please click here to log in to Workday to use the internal application process. To learn how to apply for a faculty or staff position using the Career worklet, please review this tip…
Single-nucleus DNA sequencing reveals hidden somatic loss-of-heterozygosity in Cerebral Cavernous Malformations
Ethical statement Our research complies with all relevant ethical regulations, including the Declaration of Helsinki and has been approved by the Institutional Review Boards of University of Chicago, Duke University and the Alliance to Cure Cavernous Malformations. Cerebral cavernous malformation lesions All human CCM tissue specimens have been previously reported18,19…
No valid entries in –score file
PLINK Error: No valid entries in –score file 0 Hi, I ran this command on plink1.9 to calculate the poligenic score. plink –vcf sample –score output.txt 1 2 3 –out poligenic_results – output.txt: ID ALT UKB-b-15541 rs10399793 C 0.000345793 rs2462492 T -0.00027716 – sample.vcf: #CHROM POS ID REF ALT QUAL…
A tool to combine LC-MS datasets
Tool:massSight: A tool to combine LC-MS datasets 0 Hey everyone! massSight is a tool that I’ve been working on for a bit now, and I wanted to share it with the Biostars community! It’s an R package to combine multiple LC-MS datasets from different experiments/conditions for further downstream analysis. In…
Mosaic chromosomal alterations in blood across ancestries using whole-genome sequencing
Study population We included 67,390 participants from 19 TOPMed studies: Genetics of Cardiometabolic Health in the Amish (n = 1,109) (ref. 32), Atherosclerosis Risk in Communities Study (n = 3,780) (ref. 33), Barbados Genetics Asthma Study (n = 980), Mount Sinai BioMe Biobank (n = 9,392) (ref. 34), Coronary Artery Risk Development in Young Adults (n = 3,293) (ref. 35),…
Sequencing and Genotyping / Technological Facilities / Facilities / CRI – Fondazione E. Mach
Instruments MISEQ ILLUMINA NGS sequencing platform that allows to generate up to 25 million reads from 25 to 300 nucleotides in paired end mode (PE 2X300) MinION ONT Portable real time device for DNA and RNA sequencing by nanopore technology 3730xl GENETIC ANALYZER Capillary electrophoresis platform for high throughput genetic…
Filtering qscore on dorado
Filtering qscore on dorado 1 I am looking to re-basecall some ONT long-read data which was originally basecalled using Guppy. Previously, with guppy, min_qscore=9. Would it be a good idea to do similar with dorado using the –min-qscore paramater? Or would it be better to filter further downstream of basecalling…
Bioinformatic Scientist | Cleared Careers
Overview Axle is a bioscience and information technology company that offers advancements in translational research, biomedical informatics, and data science applications to research centers and healthcare organizations nationally and abroad. With experts in biomedical science, software engineering, and program management, we focus on developing and applying research tools and techniques…
N50 value of bacterial assembly is not half of total assembly size
N50 value of bacterial assembly is not half of total assembly size 0 Dear scientists, I have performed de novo assembly of bacterial WGS data using spades and abyss. However I am not sure which assembly approach is good to go because N50 value is not half or more than…
Quantifying Genetic Stability and Quality Control of Multiple Integrations of Orthogonal Transposases, Upcoming Webinar Hosted by Xtalks
The transposon-based platform avoids major challenges presented by random integration or viral-based delivery systems. Post this To ensure that each transposon is integrated correctly and to demonstrate its orthogonality, they have performed genetic QC by means of Targeted Locus Amplification (TLA) coupled with next-generation sequencing (NGS). This allowed for the…
The Emmes Company, LLC Associate Bioinformatics Data Manager in Rockville, MD | 879160000
Overview Associate Bioinformatics Data Manager US Remote The Emmes Company, LLC (“Emmes”) is a global, full-service Clinical Research Organization dedicated to excellence in supporting the advancement of public health and biopharmaceutical innovation. We believe in the power of truth, so much so that we named our company Emmes, which means…
Mycobacterium tuberculosis Sub Lineage 4.2.2/SIT149 as DR
Introduction Antimicrobial resistance is a hidden global pandemic that shattered over 4.9 million people in 2019 alone, and the burden is highest, mainly in low-resource settings.1 Drug-resistant tuberculosis (DR-TB) caused by Mycobacterium tuberculosis (Mtb) complex (MTBC), which is resistant to one or more anti-TB drugs, is a leading global public…
New CRISPR/Cas9 Licensing Agreement for ERS Genomics & CHUM Research Centre, Montreal
New licence provides CHUM access to the ERS CRISPR/Cas9 patent portfolio. DUBLIN and MONTREAL, Oct. 26, 2023 /PRNewswire/ — ERS Genomics Limited (‘ERS’) is pleased to announce a new license agreement with the CHUM Research Centre (‘(CRCHUM),’). This is a non-exclusive licensing agreement granting the CRCHUM research rights to the…
Filtering for primary and secondary reads using sam flags (0 properly paired reads in alignment step)
Hey everybody, I have just performed the alignment of paired-end reads to a reference using bwa mem with the -M flag, ran samtools markdup and flagstat. Flagstat produced the following output: 4985084 + 0 in total (QC-passed reads + QC-failed reads) 1806492 + 0 primary 3178592 + 0 secondary 0…
Introduction to Galaxy for Bioinformatics Tickets, Mon 20/11/2023 at 1:00 pm
Introduction to Galaxy for Bioinformatics Lead trainer: Anna Syme (Melbourne Bioinformatics, The University of Melbourne) Workshop Description: This beginners tutorial will introduce Galaxy’s interface, tools and how to perform quality control (QC) on sequencing reads. Click on these links to learn about Galaxy and available training material. The material covered…
Association Analysis with Plink error
Association Analysis with Plink error 3 1. this is my phenotype file (called outputfile.txt in command line use): FID IID Cadmium_Chloride Caffeine Calcium_Chloride Cisplatin Cobalt_Chloride Congo_red Copper Cycloheximide Diamide E6_Berbamine Ethanol Formamide Galactose Hydrogen_Peroxide Hydroquinone Hydroxyurea Indoleacetic_Acid Lactate Lactose Lithium_Chloride Magnesium_Chloride Magnesium_Sulfate Maltose Mannose Menadione Neomycin Paraquat Raffinose SDS Sorbitol…
How to split a folder full of pod5 by phred score?
How to split a folder full of pod5 by phred score? 0 Hi, I’m working on ONT data as pod5 files. Usually, the sequencing device divides the pod5 files in two output folders pod5_pass and pod5_fail. However, this time something failed on that step so I was left with all…
Different “Reads Mapped Confidently to Transcriptome” values in scRNA
Hello everyone. My question is about sing-cell RNASeq. I am re-analyzing a scRNA raw data in my lab, which has previously analyzed by seqencing company, i am trying to replicate the results and update/optimize my pipeline. Currently my pipeline is as follows: 1. Creating custom reference I indexed the reference…
FDA Grants Fast Track Designation to ANPD001, Autologous Investigational Cell Therapy for the Treatment of Parkinson’s Disease
SAN DIEGO, Oct. 19, 2023 /PRNewswire/ — Aspen Neuroscience today announced that the U.S. Food and Drug Administration (FDA) has granted Fast Track Designation for ANPD001 for the treatment of Parkinson’s disease (PD) to improve motor function. ANPD001, is a personalized (autologous) cell therapy under investigation to treat PD by…
GoM DE: interpreting structure in sequence count data with differential expression analysis allowing for grades of membership | Genome Biology
Models for single-cell ATAC-seq data In single-cell ATAC-seq data, \(x_{ij}\) is the number of unique reads mapping to peak or region j in cell i. Although \(x_{ij}\) can take non-negative integer values, it is common to “binarize” the accessibility data (e.g., [19, 74, 133,134,135]), meaning that \(x_{ij} = 1\) when…
molkart: Output
Introduction This document describes the output produced by the pipeline. Most of the plots are taken from the MultiQC report, which summarises results at the end of the pipeline. The directories listed below will be created in the results directory after the pipeline has finished. All paths are relative to…
How to interpret the discrepancy of assignment rate in featurecounts using forward and reverse strand protocols
How to interpret the discrepancy of assignment rate in featurecounts using forward and reverse strand protocols 0 My RNAseq analysis pipeline is as follows: fastqc (read quality is good, some overrepresentation of adaptor sequence) -> trimmomatic (trimmed adaptor sequence, qc report after trimming suggests the overrepresented adaptors are gone) ->…
QC cut off for snRNAseq data
QC cut off for snRNAseq data 1 Hi all, Apologies if this is a silly question as I am very early on in my bioinformatics journey! I have been playing with an snRNAseq dataset in Seurat and I am currently performing QC on the dataset. Alot of the profiles look…
Solved Download fastac.ac.sh, fastac.loop.sh and
Transcribed image text: Download fastac.ac.sh, fastac.loop.sh and runinfo.csv, Answer the questions below: 1. Run the bash script fas tqc. qc. sh. How many NEW files are generated under directory reports/ after your script runs successfully? 2. Edit the file fastqc. loop. sh so the script successfully loops through the SRR…
Fast QC results (per sequence GC content)
Fast QC results (per sequence GC content) – RNA seq 0 Please help me to understand what is these two peaks(1st peak 37%, 2nd peak 50%).. This result is data downloaded from an RNA seq in another experiment. Is it because it was before trimming, or is it because of…
Accepted r-cran-ggplot2 3.4.4+dfsg-1 (source) into unstable
—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA256 Format: 1.8 Date: Tue, 17 Oct 2023 11:03:27 +0200 Source: r-cran-ggplot2 Architecture: source Version: 3.4.4+dfsg-1 Distribution: unstable Urgency: medium Maintainer: Debian R Packages Maintainers <r-pkg-t…@alioth-lists.debian.net> Changed-By: Andreas Tille <ti…@debian.org> Changes: r-cran-ggplot2 (3.4.4+dfsg-1) unstable; urgency=medium . * New upstream version Checksums-Sha1: f33e42590eb14147963877ec97f5d75635be2fa9 2717 r-cran-ggplot2_3.4.4+dfsg-1.dsc 6f204d2b2ca03f0a68fc86ebea2e7a578e17f9de…
Oak Ridge Institute for Science and Education hiring CDC Bioinformatics Fellowship in Atlanta, Georgia, United States
OrganizationCenters for Disease Control and Prevention (CDC) Reference Code CDC-NCHHSTP-2023-0099A How To Apply Connect with ORISE…on the GO! Download the new ORISE GO mobile app in the Apple App Store or Google Play Store to help you stay engaged, connected, and informed during your ORISE experience and beyond! A complete…
Jobot hiring Bioinformatics Principal in Boise, ID
Want to learn more about this role and Jobot? Click our Jobot logo and follow our LinkedIn page! Job details This Jobot Job is hosted by Ivan Ruiz Are you a fit? Easy Apply now by clicking the “Easy Apply” button and sending us your resume. Salary $100,000 – $120,000…
public databases – Converting VCF format to text for use with PLINK and understanding column mapping
I successfully completed Nature PRS tutorial, which is based on PLINK. Turning to my real data, I downloaded ukb-d-20544_1.vcf.gz. Now I’m facing the problem that I seem to be unable to use it in PLINK or find the correct data format to download at all, and I am a bit…
FINAL CALL – Workshop – Single-Cell RNA-Seq Data Analysis: A Practical Introduction (November 8-10, 2023 in Berlin)
News:FINAL CALL – Workshop – Single-Cell RNA-Seq Data Analysis: A Practical Introduction (November 8-10, 2023 in Berlin) 1 Single-Cell RNA-Seq Data Analysis: A Practical Introduction Master the tools and techniques to confidently analyze single-cell RNA-seq data and gain new insights into complex biological systems When? November 8-10, 2023 Where? Berlin…
PacBio Announces Complete Computational Workflow for Human Whole Genome Sequencing Data Analysis
PacBio WGS Variant Pipeline Will Bring Standardization to PacBio HiFi Data Analysis MENLO PARK, Calif., Oct. 11, 2023 /PRNewswire/ — PacBio (NASDAQ: PACB), a leading developer of high-quality, highly accurate sequencing solutions, today announced the availability of PacBio WGS Variant Pipeline – a complete, standardized…
Pacbio Announces Complete Computational Workflow for Human Whole Genome Sequencing Data Analysis -October 11, 2023 at 09:05 am EDT
PacBio announced the availability of PacBio WGS Variant Pipeline — a complete, standardized computational method for HiFi whole genome sequencing (WGS) data analysis. The new software pipeline will enable customers to resolve many different variant types, including single-nucleotide polymorphisms, insertions and deletions, structural variants, tandem repeats, segmental duplications, and copy…
SeqSQC can be used for sample QC of Whole Genome Sequencing Data
SeqSQC can be used for sample QC of Whole Genome Sequencing Data 0 I am using the R librabry SeqSQC from Bioconductor to do sample QC of around 50 Whole Genome Sequencing samples. The vignette says Through incorporation a benchmark data assembled from the 1000 Genomes Project, it can accommodate…
Is Guix full-source bootstrap a lie?
One of the biggest concern, in my humble opinion, about the current state of this awesome story is non-deterministic compilations. And especially at early stages, for example gash-boot. $ guix build -e ‘(@@ (gnu packages commencement) gash-boot)’ $ guix build -e ‘(@@ (gnu packages commencement) gash-boot)’ –check guix build: error:…
Storm3 hiring Senior Bioinformatics Scientist in United States
⚡ Senior Bioinformatics Scientist (HUMAN GENETICS) 🧪 Healthtech Start-Up 📌 Remote (US) 💰 $150K Base + Bonus + Impressive equity Are you interested in joining a revolutionary Biotech start-up that is using their ground-breaking AI platform to change the way we discover drugs? This established start-up with over $30M in…
Habitat and climate influence hybridization among three genetically distinct Canada jay (Perisoreus canadensis) morphotypes in an avian hybrid zone complex
Adams RV, Burg TM (2015) Gene flow of a forest-dependent bird across a fragmented landscape. PLoS One 10:1–22 Article Google Scholar Aguillon S, Rohwer V (2022) Revisiting a classic hybrid zone: movement of the northern flicker hybrid zone in contemporary times. Evolution 76:1082–1090 Article PubMed Google Scholar Aktas C (2020)…