Tag: regex

boost/regex/v4/regex_token_iterator.hpp /* * * Copyright (c) 2003 * John Maddock * * Use, modification and distribution are subject to the * Boost Software License, Version 1.0. (See accompanying file * LICENSE_1_0.txt or copy at www.boost.org/LICENSE_1_0.txt) * */ /* * LOCATION: see www.boost.org for most recent version. * FILE regex_token_iterator.hpp *…

I generated an openapi json spec from a Jersey RestApi code I wrote, and one of the constraints I have is a regex negative-lookahead pattern for “LEAGUE-MEMBER” request header. When I convert the json into yaml like so. openapi: 3.0.1 info: title: Justice League Delegate Admin Sheet description: ‘Log Record…

Source: boost1.81 Version: 1.81.0-5 Severity: normal —–BEGIN PGP SIGNED MESSAGE—– Hash: SHA512 Dear maintainer, starting with CMake 3.26, a new warning is issued if cmake_minimum_required() is not called before project(), as some policy settings affect the behavior of project(). Your package is affected: autopkgtest [23:01:45]: @@@@@@@@@@@@@@@@@@@@ summary atomic FAIL stderr: CMake Warning (dev) at…

Hello. Recently I installed eks cluster with torchserve following the tutorial github.com/pytorch/serve/tree/master/kubernetes/EKS, but having troubles uploading a motel. When I try to upload a model via: curl -X POST “http://$HOST:8081/models?url=http%3A//54.190.129.247%3A8222/model_ubuntu_2dd0aac04a22d6a0.mar” curl -X POST “http://$HOST:8081/models?url=http://54.190.129.247/8222/model_ubuntu_2dd0aac04a22d6a0.mar” I am getting the following error: { “code”: 400, “type”: “DownloadArchiveException”, “message”: “Failed to download archive…

Join top executives in San Francisco on July 11-12, to hear how leaders are integrating and optimizing AI investments for success. Learn More Data security and management platform Cohesity today announced a significant expansion of its partnership with Google Cloud. This collaboration aims to empower organizations in harnessing the full…

Sign up for best executives in San Francisco on July 11-12 to be told how leaders are integrating and optimizing AI investments for good fortune. Learn more Knowledge safety and control platform coherence These days it introduced an important enlargement of its partnership Google the cloudThe collaboration objectives to empower…

Phenotype and organism model references for a large list of genes 1 Hi all. I have to generate table for about 3500 genes with following columns: 1) references to each gene; 2) pathological features 3) reference to the organism model, e.g. MGI number for mouse Are there any databases/softwares, which…

I am trying to use pattern to validate the value using regex as below host: type: string description: mail.mydomain.com example: mail.mydomain.com format: regex pattern: ‘\S’ while generating a class it is generating as  @ApiModelProperty( example = “mail.mydomain.com“, required = true, value = “mail.mydomain.com” ) public @NotNull @Pattern( regexp = “\\S”…

The samtools view command you’ve provided just uses a filter expression to discard records that do not meet the specified expression criteria. In this case, the expression is looking for alignments where the value of the ‘rq’ (read quality) tag is greater or equal to 0.9. The isoseq tags documentation…

Image by Editor   With the rising interest in natural language processing, more and more practitioners are hitting the wall not because they can’t build or fine-tune LLMs, but because their data is messy! We will show simple, yet very effective coding procedures for fixing noisy labels in text data….

E.g., use gsub to substitute the respective words with “*word*” (using a regex pattern). library(tidyverse) library(ggtext) diamonds %>% mutate(cut_fill = gsub(“(Very|Ideal)”, “\\*\\1\\*”, cut)) %>% ggplot() + geom_bar(mapping = aes(x = cut, fill = cut_fill)) + theme(legend.text = element_markdown()) The opposite, italicising all and leaving just a few words regular, is…

Hi there, I would like to know how to extract all the numbers after the ID (KC000001-3), including the number set after a tap using Perl regex. The additional number (0.50) for the first ID, (0.60) second ID, and (0.70 0.80) third ID is always starting with a space as…

I’m trying to use the ‘qiime2 tools import’ for SampleData[SequencesWithQuality] with ‘Single Lane Per Sample Single End Fastq Directory Format’.I think I’ve correctly build the manifest and metada files. But I keep getting the same persistent error regarding the element ‘name’.This parameter asks me for “Filename to import the data…

How to let `trim_galore ` resolve multiple Regex file names? 0 Hello In ATACseq and ChIP-seq, I have multiple *R1_001.fastq.gz and multiple *R2_001.fastq.gz files for each sample. When I supply Regex file names to trim_galore using bash script trim_galore.bash: # 3 arguments of the script: 1. directory of FASTQ, 2….

I am trying to write a code that will replace a value from period5 column by the digits extracted from the period column if the value in period5 column contains more than 4 digits. In the first mutate of the code, I am just extracting digits between the first and…

I use R version 4.2.2 on a Windows Server x64. I have a cleaning script that runs without errors (and includes several printouts), but then gives me a few different fatal errors when trying to do a simple printout of a data.table once it’s finished running:View(d[!is.na(var3),])ord[!is.na(var3),] In the first case,…

There is a spam filter in almost every emailing or messaging platform. The filter examines each mail or message as it arrives and classifies it as either spam or ham. Your inbox displays those that fall under ham. It rejects, or displays separately, the messages that fall under spam. You…

I am seeing that when looping over the my Dataloader() obect using enumerate() I am getting a new dimension that is being coerced in order to create the batches of my data. I have 4 Tensors that I am slicing at a macro level (I am panel data so I…

Using an OpenAPI spec is a great way to create and share a contract to which your API adheres. This package will automatically verify both the request and response used in your integration and feature tests wherever the Laravel HTTP testing methods (->get(‘/uri’), etc) are used. Behind the scenes this…

How to remove a gene before making a cellranger reference? 1 Hello, I was asked to make a new reference where I remove one of the genes from a reference and add some isoforms. I have found several instances of this gene in the gtf file and I will remove…

There are many things wrong in your code. I’ve boiled down your code to something more essential – to crystallise the problem: The use of a global aesthetic for all geom layers, although not all data frames have this aesthetic (in your case: mod). I’ve also used a smaller version…

Transcribed image text: Instructions: – Work through Object-Oriented Programming \& Biopython and Practice Finding Open Reading Frames to gain the building blocks to complete this assignment – Review the spec below for the script we would like you to create – Review the automated tests in the folder to understand…

Hi everyone, I’m currently processing some RNA-seq samples and using different tools to extract metrics. In particular, I’m a bit confused about the outputs I’m having from Picard MarkDuplicates and EstimateLibraryComplexity. For the same sample, MarkDuplicates is estimating that 76% of reads are duplicated, whereas EstimateLibraryComplexity is estimating a 29%…

Eplanation about some code 2 Hello I have some code to extract data from my .VCF file. cat ‘/home/yousef/Desktop/Haplotyp_results/INDEL/info_8indel.vcf’ | sed ‘s/^.*;DP=\([0-9]*\);.*$/\1/’ I wanted to know what is the meaning of this (sed ‘s/^.*;DP=\([0-9]*\);.*$/\1/’) section in the code. I will be pleased if you could give me a source to…

download a set of proteome from uniprot 1 I have a bench of Uniprot proteome ID I would like to download in an automated way. e.g. UP000005640 UP000001073 UP000001519 It sounds an easy task but after many tries I’m still unsuccessful, anyone has trick? I tried using a for loop…

Here’s what I get on my install, a System76 version of Ubuntu 22.04 with version details as shown, using your example and the stringr help(str_count) examples. All appears as it should. What is very odd is that one or both of the two arguments, both shown as strings, which are…

I had a JupyterHub crash on me today. When scrutinizing the logs (e.g., kubctl logs hub-xxx -n jhub), I stumbled upon the error below. Note, that this problem temporarily crashed the entire JupyterHub(!). See how MattPanavva is getting encoded into -4datt-50anavva. The -4d and -50 are coming from URL ASCII…

ebeb January 25, 2023, 7:53pm #1 Hello, While I can do mapping for individual users from email to local user, I am interested in doing a wildcard mapping for all users for example some regex or * like below:c.AzureAdOAuthenticator.username_map = {‘*@xyz.com’: ‘*’} The expected result is that any username like…

separate read1 and read2 from merged fastq file and align against reference genome 0 Hi, I am processing a merged fastq file. I used the following command to separate read1s and read2s in separate files for alignment using bwa mem. paste – – – – – – – – <…

itertools.product() is the way to go here. If your proteins are all single characters then for each position in your “regex”, just put a string representing the valid proteins for that position into the itertools.product() arguments. For example [IG]…D.SG would become the following: p = ‘ABCDEFGHIJKLMNOPQRST’ # or whatever the…

Reading records separated by > is a nice idea as it gives you the whole chunk at a time. However, here you want to process and merge lines but not the header, thus distinguishing between lines. It is clearer to read line by line. The sequence-line is specific: all caps…

Most popular tags python javascript html java css reactjs c# php r sql arrays pandas c++ android jquery DataFrame python-3.x node.js c mysql list flutter JSON ios typescript sql-server swift string angular regex laravel excel django dictionary dart bash numpy postgresql loops oracle vba linux angularjs function for-loop spring spring-boot…

So I downloaded pymc3 (uninstalled and reinstalled a few times) and every time I try to import pymc3 into a jupyter notebook I get some kind of error. I am guessing that I am having an issue with how I am installing Pymc3, I followed this tutorial: github.com/pymc-devs/pymc/wiki/Installation-Guide-(Windows). After my…

As your sample GenBank file was incomplete, I went online to find a sample file that could be used in an example, and I found this file. Using this code and the Bio::GenBankParser module, it was parsed guessing what parts of the structure you were after. In this case, “features”…

import re test_str = ‘ /product=”hypothetical protein”‘ match = re.search(r’product=”([^”]+)”‘, test_str) if match: print(match.group(1)) ——————————————————————————– product=” ‘product=”‘ ——————————————————————————– ( group and capture to \1: ——————————————————————————– [^”]+ any character except: ‘”‘ (1 or more times (matching the most amount possible)) ——————————————————————————– ) end of \1 ——————————————————————————– ” ‘”‘ Read more here:…

The problem is probably that you’re looking for non-overlapping instances of the regex. Methods like findall won’t return B as the match for A consumes the , before B. >>> regex.findall(“((A:[c1]0.1,B:[c2]0.2),C:[c2]0.3);”) [(‘(A:[c1]0.1,’, ‘(‘, ‘A’, ‘:’, ‘[c1]’, ‘0.1’, ‘,’), (‘,C:[c2]0.3)’, ‘,’, ‘C’, ‘:’, ‘[c2]’, ‘0.3’, ‘)’)] Changing the end pattern to…

You should split your lines into “words” and only look up these words in your dictionary: >>> re.findall(r”\w+”, “CHROMOSOME_IV ncRNA gene 5723085 5723105 . – . ID=Gene:WBGene00045518 CHROMOSOME_IV ncRNA ncRNA 5723085 5723105 . – . Parent=Gene:WBGene00045518”) [‘CHROMOSOME_IV’, ‘ncRNA’, ‘gene’, ‘5723085’, ‘5723105’, ‘ID’, ‘Gene’, ‘WBGene00045518’, ‘CHROMOSOME_IV’, ‘ncRNA’, ‘ncRNA’, ‘5723085’, ‘5723105’, ‘Parent’,…

Kolkata FF is a game of Satta Matka in which person guess the correct number. Hence, then is rewarded with a … 1 Min Read. Regex number greater than 1000.. It was higher than in 91.8% U.S. cities. The 2019 Syracuse crime rate rose by 5% compared to 2018. The…

As you suggest one way of solving your problem would be by selecting all atoms that don’t have backbone atoms names. In a pdb file I believe backbone atoms would be named ‘CA’, ‘HA’, ‘N’, ‘HN’ or ‘H’, ‘C’ and ‘O’. Beware of the N-terminal (where the hydrogens would be…

Docs.rs Releases Releases by Stars Recent Build Failures Build Failures by Stars Release Activity Rust The Book Standard Library API Reference Rust by Example Rust Cookbook Crates.io The Cargo Guide poem-openapi-derive-1.3.0 poem-openapi-derive 1.3.0 Docs.rs crate page MIT/Apache-2.0 Links Homepage Documentation Repository Crates.io Source Owners sunli829 Dependencies Inflector ^0.11.4 normal darling…

How can I separate 3 different pieces of information in a column? 3 For example, in the column I have, there is a line written Ser25Phe. And I want to split the column written HGVS.Consequence as Ser 25 Phe. Programming regex split R gsub • 205 views • link updated…

I have some RNAseq data from miRNAs that I have processed with Bowtie2 (aligning to miRBase). Now, when doing the deduplication with umi_tools dedup I find that some of the files take a lot of time+RAM to finish (some files take around 3-4 minutes and 4-5GB of RAM and some…

FilterTest (BioJava-1.4 API)  PREV CLASS   NEXT CLASS FRAMES    NO FRAMES     All Classes SUMMARY: NESTED | FIELD | CONSTR | METHOD DETAIL: FIELD | CONSTR | METHOD org.biojava.bio.search Interface FilterTest All Known Implementing Classes: FilterTest.Equals, FilterTest.GreaterThan, FilterTest.LessThan public interface FilterTest Class for implementing tests with BlastLikeSearchFilter objects. Several precanned tests are included. Author: David Huen Nested Class Summary static class FilterTest.Equals…

I am building out a new endpoint in my application which uses express-openapi-validator as validator middleware. /* index.ts */ import * as OpenApiValidator from ‘express-openapi-validator’; const whitelistedPaths = [/* regex tested paths */]; app.use( OpenApiValidator.middleware({ apiSpec: ‘./schema/api.json’, validateRequests: true, validateResponses: true, ignorePaths: whitelistedPaths, validateSecurity: true, }), ); /* … */…

GPT2-Pytorch with Text-Generator Better Language Models and Their Implications Our model, called GPT-2 (a successor to GPT), was trained simply to predict the next word in 40GB of Internet text. Due to our concerns about malicious applications of the technology, we are not releasing the trained model. As an experiment…

I have this regex evolved on www.regex101.com and it seems to work properly.  When I copy this regex into the OpenApi @Pattern annotation in a Spring Boot 2.5.4 application with springdoc-openapi (tried v1.4.8 and v1.6.1, supporting OpenApi v3) I get the message  Spoiler (Highlight to read) Conditionals are not supported in this…

There’s a saying among writers that “All writing is re-writing” — that is, the greater part of writing is revising. For programmers (or at least data scientists) the expression could be re-phrased as “All coding is debugging.” Any time you’re writing code, you need to verify that it works as…

You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: ampere2.nyi.freebsd.org/data/main-arm64-default/p7539e33f88ff_s169b368a62/logs/RStudio-2021.09.1+372.log Build URL: ampere2.nyi.freebsd.org/build.html?mastername=main-arm64-default&build=p7539e33f88ff_s169b368a62 Log: =>> Building devel/RStudio build started at Wed Dec 8…

Say I have a vector of strings, g<-c(“bunchofstuff>query=true/fun/weird>bunchofstuff”, “bunchofstuff>query=animals/octopus/weird>bunchofstuff”, “bunchofstuff>query=flowers/sunshine/fun>bunchofstuff”, ” bunchofstuff>query=fun/true/sunshine>bunchofstuff” and I want to essentially use sub to erase anything after query=, until the end of the string, IF query= is not followed by true (ideally in any position). As far as I can tell, there isn’t a…

In this post I am going through several common issues with CSV files and fixing them using regular expressions. Often as a data scientist you work with large. 24.7 Testing and improving. Developing the right regex on the first try is often difficult. Trial and error is a common approach…

How to find sequence patterns in genome? 2 Hi, I want to find a pattern of sequence in a genome. Let’s say to find following pattern (G4N(1-10))5 that translates to 4 Guanines followed by 1 to 10 bases of either A or T or G or C and then this…

I’m got some low coverage skim-seq bam files (1x) and was doing qc on them and got some strange results. I ran Picard CollectInsertSizeMetrics. The sequencing was done by Illumina paired end and the orientation was be F-R as usual. But I got insert size histograms showing FR, TANDEM, and…

Pound: CMakeLists.txt | Fossies “Fossies” – the Fresh Open Source Software Archive Member “Pound-3.0.2/CMakeLists.txt” (28 Nov 2021, 3057 Bytes) of package /linux/www/Pound-3.0.2.tgz: As a special service “Fossies” has tried to format the requested text file into HTML format (style: standard) with prefixed line numbers. Alternatively you can here view or…

REST APIs fuzzer and negative testing tool. Run thousands of self-healing API tests within minutes with no coding effort! Comprehensive: tests are generated automatically based on a large number scenarios Highly Configurable: high amount of customization to adapt to each context Self-Healing: as tests are generated, any OpenAPI spec change…

OpenAPI (known as Swagger before) is a standard to declare Restful API. But why should I use it? In the current context, when we are working with APIs (no matters of the language used) we want to have a clean documentation and be able to share a complete documentation of…

November 23, 2021 A story about how we went from spontaneous api code writing to a process with a separate repository of api schemas and code generation based on them. TL;DR We were living with an unstructured websocket API of our own design, but realized that it was impossible to…

I have a pytorch model that dies with an exception. I am running docker on a Mac. 2021-11-22 09:58:25,083 [INFO ] W-9001-deviceidentification_ffda761820ab4a519ef598fb241e28d4-stdout MODEL_LOG – done saving hyperparameters 2021-11-22 09:58:25,162 [INFO ] W-9002-deviceidentification_ffda761820ab4a519ef598fb241e28d4-stdout MODEL_LOG – saving hyperparameters 2021-11-22 09:58:25,185 [INFO ] W-9002-deviceidentification_ffda761820ab4a519ef598fb241e28d4-stdout MODEL_LOG – done saving hyperparameters 2021-11-22 09:58:38,625 [INFO ]…

Bug Report Checklist Description Python code generation tries to strip leading and trailing / from regex patterns, but the pattern its using to do so matches when it shouldn’t. For example this pattern in my spec: [0-9a-f]{8}-[0-9a-f]{4}-[0-9a-f]{4}-[0-9a-f]{4}-[0-9a-f]{12} has no leading and trailing slashes, but the code linked above would still…

Using python FlashText to do pattern matching in nucleotide sequences 0 Hi all, I’m playing with the idea of using FlashText (instead of RegEx) to do some pattern finding in nucleotide sequences. My idea came from the massive speed up seen in the post below: dev.to/vi3k6i5/regex-was-taking-5-days-to-run-so-i-built-a-tool-that-did-it-in-15-minutes-c98?ref=codebldr My basic idea is…

Am using openapi 3.0.3 to autogenerate my Spring Boot based REST API… Inside src/main/resources/openapi/schema/PurchaseOrder.yaml: openapi: ‘3.0.3’ info: title: ‘Purchase Order’ version: ‘1.0’ paths: {} components: schemas: PurchaseOrder: title: ‘Purchase Order’ type: ‘object’ properties: account: type: ‘string’ description: Identifier for account making the purchase example: 1 minLength: 1 pattern: ‘^s-$’ So,…

How can I find which frame is producing the final protein? Is there any way to set all the frames? import re filename = input(‘Enter name of file to parse: ‘) sequences = [] descr = None # here is the path of multifalsta file with open(filename) as file: line…

Transform a GTF file into a data frame in R 4 Hi, I would like to analyse the content of a GTF file. I am quite able with R and dplyr, so I would like to transform my GTF file into a data frame to facilitate my analysis. Does anybody…

I am running 325 vcftools commands to generate Fst values, which obviously needs to be automated. An example: vcftools –vcf big.vcf –weir-fst-pop pop_lists/pop1.txt –weir-fst-pop pop_lists/pop2.txt –out weir_fst_results/pop1_vs_pop2 and when I run this job, it works fine when I run it one by one by the command line, i.e. there are…

Extract sequences from a fasta file with specific nucleotide repetition 2 I have a fasta file name seqs.fa with multiple sequences i.e., >Seq1 GATAGAT**ATC**GAATG**ATC** >Seq2 GATGATAG**ATC**GATGC I want grep/extract only those sequences having ATC repeated exactly 2 times like in Seq1. How we can use grep/sed or {} method for…

My two questions are: What is the simplest way to do this? This unique book shows you how to program with Python, using code examples taken directly from bioinformatics. using python-bloom-filter, just replace the set with seen = BloomFilter(max_elements=10000, error_rate=0.001). This book is suitable for use as a classroom textbook,…

Invert regex match 1 Hello, I would like to invert my regex match Example: sssd;RS=93298723;f My current regex : RS=d* This regex would match RS=93298723, I would want to invert the match, see demo here regex101.com/r/PGkwA5/1 Thank you. regex • 92 views I found ! ([^0-9-RS=]+) Login before adding your…

isolate adapter contamination reads from fastq file using python 0 hi everyone, I want to extract adapter contaminated reads from a fastq file using python code, but I am unable to do so. adapter sequence is : “GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA” file contain this data : @HWUSI-EAS570R_0003:2:50:5038:17424#0/1 CAGCTTCTGTTGATGCTGATTTAATTCCTGCAACTA +HWUSI-EAS570R_0003:2:50:5038:17424#0/1 hhhhhhhhhhhgghhhhhahhhhhhhhhhhhgfhh[ @HWUSI-EAS570R_0003:2:50:5175:17417#0/1 CACCTTGCTTTATGGGAAAGCGTAACATAACTACAG +HWUSI-EAS570R_0003:2:50:5175:17417#0/1…

A regex to convert operon names to genes? 0 Hi, I would like to convert operon names to gene names (and the reverse). I think this should be possible with a regex, but I’m not fluent enough with regexes to crack it up. Conventionally, operons are named like this: genes…

bash script 3 Hello everyone, I have a file like this: RSID1 RSID2 chr1_169894240_G_T_b38 chr1_169894240_G_T_b38 chr1_169894240_G_T_b38 chr1_169891332_G_A_b38 chr1_169891332_G_A_b38 chr1_169891332_G_A_b38 chr1_169661963_G_A_b38 chr1_169661963_G_A_b38 chr1_169661963_G_A_b38 chr1_169697456_A_T_b38 chr1_169697456_A_T_b38 chr1_169697456_A_T_b38 chr1_27636786_T_C_b38 chr1_27636786_T_C_b38 chr1_196651787_C_T_b38 chr1_196651787_C_T_b38 chr6_143501715_T_C_b38 chr6_143501715_T_C_b38 I want to extract info just like: chr1_169894240 chr1_169894240. I don’t want to have other info. I just want…