Tag: relatedness

Natera Announces Data from the

Natera%2C+Inc. (NASDAQ: NTRA), a global leader in cell-free DNA testing, today announced new data on its Prospera test being presented at the American Transplant Congress (ATC) 2023 taking place June 3-7, 2023. The presentations include several interim analyses from ProActive, a prospective donor-derived cell-free DNA (dd-cfDNA) study evaluating Natera’s Prospera…

Continue Reading Natera Announces Data from the

Discrimination of monozygotic twins using mtDNA heteroplasmy through probe capture enrichment and massively parallel sequencing

Oosthuizen T, Howes LM (2022) The development of forensic DNA analysis: new debates on the issue of fundamental human rights. Forensic Sci Int Genet 56:102606 Article  CAS  PubMed  Google Scholar  Nwawuba Stanley U et al (2020) Forensic DNA profiling: autosomal short tandem repeat as a prominent marker in crime investigation….

Continue Reading Discrimination of monozygotic twins using mtDNA heteroplasmy through probe capture enrichment and massively parallel sequencing

Why Aren’t The Three Rrna Genes Of Corn One Anothers Closest Relatives?

Ribosomal RNA (rRNA) genes play a crucial role in the process of protein synthesis and are essential components of the ribosome, the cellular machinery responsible for translating genetic information into functional proteins. In many organisms, these genes are found as multiple copies within their genomes, with each copy exhibiting varying…

Continue Reading Why Aren’t The Three Rrna Genes Of Corn One Anothers Closest Relatives?

How Do DNA And mtDNA Differ?

The field of genetics has experienced significant advancements in recent years, shedding light on the complex molecular mechanisms that govern inheritance and the expression of genetic traits. Central to this understanding is the distinction between two distinct types of genetic material, namely deoxyribonucleic acid (DNA) and mitochondrial DNA (mtDNA). While…

Continue Reading How Do DNA And mtDNA Differ?

Polygenic prediction of preeclampsia and gestational hypertension

Burton, G. J., Redman, C. W., Roberts, J. M. & Moffett, A. Pre-eclampsia: pathophysiology and clinical implications. BMJ 366, l2381 (2019). Article  PubMed  Google Scholar  Jiang, L. et al. A global view of hypertensive disorders and diabetes mellitus during pregnancy. Nat. Rev. Endocrinol. 18, 760–775 (2022). Article  PubMed  PubMed Central …

Continue Reading Polygenic prediction of preeclampsia and gestational hypertension

Ex vivo RSA and pfkelch13 targeted-amplicon deep sequencing reveal parasites susceptibility to artemisinin in Senegal, 2017 | Malaria Journal

WHO. Guidelines for malaria. WHO/UCN/GMP/2022.01 Rev. 2. Geneva. World Health Organization; 2022. Nzoumbou-Boko R, Panté-Wockama CBG, Ngoagoni C, Petiot N, Legrand E, Vickos U, et al. Molecular assessment of kelch13 non-synonymous mutations in Plasmodium falciparum isolates from central African Republic (2017–2019). Malar J. 2020;19:191. Article  CAS  PubMed  PubMed Central  Google…

Continue Reading Ex vivo RSA and pfkelch13 targeted-amplicon deep sequencing reveal parasites susceptibility to artemisinin in Senegal, 2017 | Malaria Journal

The impact of rare protein coding genetic variation on adult cognitive function

The UKB is approved by the North West Multi-centre Research Ethics Committee (www.ukbiobank.ac.uk/learn-more-about-uk-biobank/about-us/ethics). The current study was conducted under UKB application no. 26041. The data in the UKB were collected after written informed consent was obtained from all participants. The Human Research Committee of the MGB approved the Biobank research…

Continue Reading The impact of rare protein coding genetic variation on adult cognitive function

Ribosomal RNA – Study Achievement

Ribosomal RNA Definition Ribosomal ribonucleic acid (rRNA) is the RNA component of ribosomes, the molecular machines that catalyze protein synthesis. Ribosomal RNA constitute over sixty percent of the ribosome by weight and are crucial for all its functions – from binding to mRNA and recruiting tRNA to catalyzing the formation…

Continue Reading Ribosomal RNA – Study Achievement

Genome data sheds light on how Homo sapiens arose in Africa

Our species arose in Africa more than 300,000 years ago, with the oldest-known Homo sapiens fossils discovered at a site in Morocco called Jebel Irhoud, located between Marrakech and the Atlantic coast. But the scarcity of Homo sapiens fossils from early in our evolutionary history and the geographical spread of…

Continue Reading Genome data sheds light on how Homo sapiens arose in Africa

Genetic Origins of Ancient Pict Warriors in Britain

Genetic analysis has uncovered the mysterious origin of the Picts, a people group that lived in many parts of northern Britain roughly 1,500 years ago. Research reveals that the ethnic group, which many thought might have come from Eastern Europe, had a local origin similar to other British Celtic groups….

Continue Reading Genetic Origins of Ancient Pict Warriors in Britain

Genomic Medicine Market is Probable to Influence the Value of USD 75.67 Billion by 2029, Size, Share, Trends, Demand, Growth, Challenges and Competitive Analysis

Genomic Medicine Market is Probable to Influence the Value of USD 75.67 Billion by 2029, Size, Share, Trends, Demand, Growth, Challenges and Competitive Analysis BOSTON, May 16, 2023 (GLOBE NEWSWIRE) — Data Bridge Market Research’s latest report, ” Genomic Medicine Market ” provides a thorough analysis of growth strategies, drivers,…

Continue Reading Genomic Medicine Market is Probable to Influence the Value of USD 75.67 Billion by 2029, Size, Share, Trends, Demand, Growth, Challenges and Competitive Analysis

Microorganisms | Free Full-Text | Whole-Genome Sequencing of Shiga Toxin-Producing Escherichia coli for Characterization and Outbreak Investigation

1. Introduction Shiga toxin-producing Escherichia coli (STEC) is a Gram-negative foodborne pathogen that was estimated to cause ~265,000 infections, 3600 hospitalizations, and 30 deaths in the U.S. each year [1]. Most patients with STEC infections develop diarrhea and abdominal pain, though hemolytic uremic syndrome (HUS) and kidney failure can occur,…

Continue Reading Microorganisms | Free Full-Text | Whole-Genome Sequencing of Shiga Toxin-Producing Escherichia coli for Characterization and Outbreak Investigation

Integrative population genetics and metagenomics reveals urbanization increases pathogen loads and decreases connectivity in a wild bee

As urbanization continues to increase, it is expected that two-thirds of the human population will reside in cities by 2050. Urbanization fragments and degrades natural landscapes, threatening wildlife including economically important species such as bees. In this study, we employ whole genome sequencing to characterize the population genetics, metagenome and…

Continue Reading Integrative population genetics and metagenomics reveals urbanization increases pathogen loads and decreases connectivity in a wild bee

Resistance of Nosocomial Acinetobacter baumannii

Chenxing Wei,1,* Jian Chen,1,* Tanveer Muhammad Anwar,2,* Lingling Huang,1 Wenjie Yang,3 Xueyan Dong,1 Qiong Chen,1 Min Yue,2,4,5 Daojun Yu1,3 1Department of Medical Laboratory, Affiliated Hangzhou First People’s Hospital, Zhejiang University School of Medicine, Hangzhou, 310006, People’s Republic of China; 2Department of Veterinary Medicine, Institute of Preventive Veterinary Sciences, Zhejiang University…

Continue Reading Resistance of Nosocomial Acinetobacter baumannii

STAGEs: A web-based tool that integrates data visualization and pathway enrichment analysis for gene expression studies

STAGEs is an interactive web app built using Streamlit (www.streamlit.io), and the running instance of the online app can be accessed via the website (kuanrongchan-stages-stages-vpgh46.streamlitapp.com/). The app can also run locally using the instructions detailed in GitHub (github.com/kuanrongchan/STAGES). Users can directly upload data from Excel spreadsheets, csv or txt files…

Continue Reading STAGEs: A web-based tool that integrates data visualization and pathway enrichment analysis for gene expression studies

DNA study sheds light on Scotland’s Picts, and resolves some myths about them

The people known as the Picts have puzzled archaeologists and historians for centuries. They lived in Scotland during the early medieval period, from around AD300 to AD900, but many aspects of their society remain mysterious. The Picts’ unique cultural characteristics, such as large stones decorated with distinct symbols, and lack…

Continue Reading DNA study sheds light on Scotland’s Picts, and resolves some myths about them

Genomic and transcriptomic profiling reveal molecular characteristics of parathyroid carcinoma

Clinical and biochemical characteristics of parathyroid carcinoma In total, 50 thyroid tissues were collected from three groups, 12 parathyroid carcinomas, 28 parathyroid adenomas, and 10 normal parathyroid tissues, for genomic and transcriptomic profiling (Fig. 1). The detailed protocols and quality control procedures are described in the Materials and Methods section….

Continue Reading Genomic and transcriptomic profiling reveal molecular characteristics of parathyroid carcinoma

GWAS with OmicsBox – BioBam

Genome-Wide Association Studies (GWAS) is a valuable approach to investigating the relationship between genetic variations and phenotypic traits. However, due to many different analysis options, performing GWAS can be challenging, especially for researchers without a strong background in statistics or bioinformatics. OmicsBox’s Genetic Variation Module provides a solution by offering…

Continue Reading GWAS with OmicsBox – BioBam

Application of a core genome sequence typing (cgMLST) pipeline for surveillance of Clostridioides difficile in China

Front Cell Infect Microbiol . 2023 Mar 13;13:1109153. doi: 10.3389/fcimb.2023.1109153. eCollection 2023. Affiliations Expand Affiliations 1 State Key Laboratory of Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing, China. 2 Research Center for Micro-Ecological Agent Engineering and…

Continue Reading Application of a core genome sequence typing (cgMLST) pipeline for surveillance of Clostridioides difficile in China

Public health implications of Yersinia enterocolitica investigation: an ecological modeling and molecular epidemiology study | Infectious Diseases of Poverty

Epidemic profile of Yersinia during 2007–2019 A total of 9031 samples were monitored from 2007 to 2019, with the detection rate of Yersinia ranging from 0.9% to 7.6% (Table 1). The highest detection rate was in 2014 (7.6%), eightfold higher than in 2013 (0.5%). The difference in positivity rates between…

Continue Reading Public health implications of Yersinia enterocolitica investigation: an ecological modeling and molecular epidemiology study | Infectious Diseases of Poverty

Molecular and expression characterization of insulin-like signaling in development and metabolism of Aedes albopictus | Parasites & Vectors

Molecular and phylogenetic characterization of Ae. albopictus ILP genes Seven putative ILP transcripts in Ae. albopictus genomic assembly were obtained by using sequence blast with known Ae. aegypti ILP1-8 genes [5]. The phylogenetic analysis was performed to discern the evolutionary relatedness of Ae. albopictus ILPs with those identified in other…

Continue Reading Molecular and expression characterization of insulin-like signaling in development and metabolism of Aedes albopictus | Parasites & Vectors

Desulfovibrionaceae | 24 Publications | 865 Citations | Top Authors

Abstract: The different nutritional properties of several Desulfovibrio desulfuricans strains suggest that either the strains are misclassified or there is a high degree of phenotypic diversity within the genus Desulfovibrio. The results of partial 16S rRNA and 23S rRNA sequence determinations demonstrated that Desulfovibrio desulfuricans ATCC 27774 and “Desulfovibrio multispirans”…

Continue Reading Desulfovibrionaceae | 24 Publications | 865 Citations | Top Authors

kinship coefficient negative in multi-sample VCF from exome sequencing

Hi All, I hope you can guide me a hand here. I have a SNP multi-sample vcf file (n=259 people) from target exome sequencing with ~20x coverage; this file has been processed with GATK by a big Center so I fairly trusted their work. This multi-sample vcf file contains ~70…

Continue Reading kinship coefficient negative in multi-sample VCF from exome sequencing

chromosome identifier not found in FASTA file, prompting ‘skipping’ error, when chr identifier is there

Hi, I have a FASTA file that looks like this: >D00829_0044_ACADL6ANXX_PEdi_Ay_VS_2:6:1214:4434:71826 TGATCTTGGCCAAGTCACTTCCTCCTTCAGGAACATTGCAGTGG >D00829_0044_ACADL6ANXX_PEdi_Ay_VS_2:1:2203:12900:37094 ACTTTGGTCAAGTCACTTCCTCCTTCAGGAACATTGCAGTGG >D00829_0044_ACADL6ANXX_PEdi_Ay_VS_2:1:2213:1470:83635 Which I created through the code below. The .bam file in question is an aDNA file from a Neanderthal (cdna.eva.mpg.de/neandertal/Chagyrskaya/BAM/). samtools bam2fq chr22.rh.bam > chag.22.fq bioawk -c fastx ‘{print “>”$name”\n”$seq}’ chag.22.fq > chag.22.fa I also…

Continue Reading chromosome identifier not found in FASTA file, prompting ‘skipping’ error, when chr identifier is there

Thermophilic Dehalococcoidia with unusual traits shed light on an unexpected past

Two new Tepidiforma species expand on a small number of cultivated Dehalococcoidia Two bacterial strains were isolated from terrestrial geothermal springs by plating benthic mat and sediment slurries onto R2A medium and were identified by 16S rRNA gene sequencing as members of the recently described genus Tepidiforma [27]. Strain YIM…

Continue Reading Thermophilic Dehalococcoidia with unusual traits shed light on an unexpected past

15.1. Methods and Mathematics – EN – Deep Learning Bible – 2. Classification

en.wikipedia.org/wiki/Multi-task_learning $\equiv$ CONTENTS Methods 1.1. Task grouping and overlap 1.2. Exploiting unrelated tasks 1.3. Transfer of knowledge 1.4. Group online adaptive learning Mathematics / Reproducing Hilbert space of vector valued functions (RKHSvv) 2.1. RKHSvv concepts 2.2. Separable kernels 2.3. Known task structure $\quad$ 2.3.1. Task structure representations $\quad$ 2.3.2. Task…

Continue Reading 15.1. Methods and Mathematics – EN – Deep Learning Bible – 2. Classification

The Biostar Herald for Monday, April 10, 2023

The Biostar Herald publishes user submitted links of bioinformatics relevance. It aims to provide a summary of interesting and relevant information you may have missed. You too can submit links here. This edition of the Herald was brought to you by contribution from Istvan Albert, Pavel, and was edited by…

Continue Reading The Biostar Herald for Monday, April 10, 2023

Whole-genome sequencing of Shigella for surveillance purposes shows (inter)national relatedness and multidrug resistance in isolates from men who have sex with men

Whole-genome sequencing of Shigella for surveillance purposes shows (inter)national relatedness and multidrug resistance in isolates from men who have sex with men | Microbiology Society 1887 This is a required field Please enter a valid email address Approval was a Success Invalid data An Error Occurred Approval was…

Continue Reading Whole-genome sequencing of Shigella for surveillance purposes shows (inter)national relatedness and multidrug resistance in isolates from men who have sex with men

Phylogenomic analysis uncovers a 9-year variation of Uganda influenza type-A strains from the WHO-recommended vaccines and other Africa strains

Demographic characteristics of sampled patients The Uganda Virus Research Institute National Influenza Centre (UVRI-NIC) laboratory tested 18,353 patients between 22nd October 2010 and 9th May 2018. Thirteen-percent (2404/18,353) were positive for influenza, 69.88% (1680/2404), 29.62% (712/2404), and 0.17% (4/2404) had influenza A, B, and A/B co-infection, respectively (Fig. 1A). IAV positives…

Continue Reading Phylogenomic analysis uncovers a 9-year variation of Uganda influenza type-A strains from the WHO-recommended vaccines and other Africa strains

DDX3Y is likely the key spermatogenic factor in the AZFa region that contributes to human non-obstructive azoospermia

Vander Borght, M. & Wyns, C. Fertility and infertility: definition and epidemiology. Clin. Biochem. 62, 2–10 (2018). Article  Google Scholar  Kasak, L. & Laan, M. Monogenic causes of non-obstructive azoospermia: challenges, established knowledge, limitations and perspectives. Hum. Genet. 140, 135–154 (2021). Article  PubMed  Google Scholar  Punab, M. et al. Causes…

Continue Reading DDX3Y is likely the key spermatogenic factor in the AZFa region that contributes to human non-obstructive azoospermia

Intraspecific trait variation and species turnover in successional tropical forests: assessing trait imputation for community-weighted means

Adler PB, Salguero-Gómez R, Compagnoni A, Hsu JS, Ray-Mukherjee J, Mbeau-Ache C, Franco M (2014) Functional traits explain variation in plant life history strategies. Proc Natl Acad Sci USA 111:740–745 Article  CAS  PubMed  Google Scholar  Albert CH, Thuiller W, Yoccoz NG, Soudant A, Boucher F, Saccone P, Lavorel S (2010)…

Continue Reading Intraspecific trait variation and species turnover in successional tropical forests: assessing trait imputation for community-weighted means

The potential to produce tropodithietic acid by Phaeobacter inhibens affects the assembly of microbial biofilm communities in natural seawater

Falkowski, P. G., Barber, R. T. & Smetacek, V. Biogeochemical controls and feedbacks on ocean primary production. Science (1979) 281, 200–206 (1998). CAS  Google Scholar  Nemergut, D. R. et al. Patterns and processes of microbial community assembly. Microbiol. Mol. Biol. Rev. 77, 342–356 (2013). Article  PubMed  PubMed Central  Google Scholar …

Continue Reading The potential to produce tropodithietic acid by Phaeobacter inhibens affects the assembly of microbial biofilm communities in natural seawater

significant sequence identity?

significant sequence identity? 1 Hi, could you tell me when I can define the sequence identity between two proteins significant?In general, I knew that sequences with more 30% sequence identity are considered similar, and below no..Could you confirm that? Thank you very much. Silvia sequence • 1.4k views Yes/No. It…

Continue Reading significant sequence identity?

Rickettsial DNA and a trans-splicing rRNA group I intron in the unorthodox mitogenome of the fern Haplopteris ensiformis

Our choice of the shoestring fern H. ensiformis as a leptosporangiate fern for complete assembly of both organelle genomes was based on pronounced variability in mitochondrial RNA editing and intron (co-)evolution in the monilophyte family Pteridaceae and the sub-family Vittarioideae in particular22. We used next-generation sequencing (NGS) data to assemble…

Continue Reading Rickettsial DNA and a trans-splicing rRNA group I intron in the unorthodox mitogenome of the fern Haplopteris ensiformis

Intravenous ravulizumab in mechanically ventilated patients hospitalised with severe COVID-19: a phase 3, multicentre, open-label, randomised controlled trial

Introduction Case fatality rates of COVID-19 have decreased globally from 3·7% in March, 2020, to 1·0% in February, 2023, due in part to vaccination, changes in the prevailing SARS-CoV-2 variant, and improvements in clinical care. 1 Global case fatality rate from COVID-19 has decreased by 96·8% during 2·5 years of…

Continue Reading Intravenous ravulizumab in mechanically ventilated patients hospitalised with severe COVID-19: a phase 3, multicentre, open-label, randomised controlled trial

Investigation of a suspected nosocomial transmission of blaKPC3-mediated carbapenem-resistant Klebsiella pneumoniae by whole genome sequencing.

Abstract Whole genome sequencing (WGS) was compared to pulse-field gel electrophoresis (PFGE) of XbaI-digested genomic DNA, as methods by which to evaluate a potential transmission of carbapenem-resistant Klebsiella pneumoniae between 2 hospital inpatients. PFGE result demonstrated only 1-band difference between the isolates, suggesting probable relatedness. In contrast, while WGS data…

Continue Reading Investigation of a suspected nosocomial transmission of blaKPC3-mediated carbapenem-resistant Klebsiella pneumoniae by whole genome sequencing.

Genomic diversity of non-diarrheagenic fecal Escherichia coli from children in sub-Saharan Africa and south Asia and their relatedness to diarrheagenic E. coli

Kaper, J. B., Nataro, J. P. & Mobley, H. L. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2, 123–140 (2004). Article  CAS  PubMed  Google Scholar  Nataro, J. P. & Kaper, J. B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11, 142–201 (1998). Article  CAS  PubMed  PubMed Central  Google Scholar  Croxen, M. A….

Continue Reading Genomic diversity of non-diarrheagenic fecal Escherichia coli from children in sub-Saharan Africa and south Asia and their relatedness to diarrheagenic E. coli

From fossils to phylogenies part 2: using blast to identify … | Lecture notes Bioinformatics

Download from fossils to phylogenies part 2: using blast to identify … and more Bioinformatics Lecture notes in PDF only on Docsity! FROM FOSSILS TO PHYLOGENIES PART 2: USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES – TEACHER EDITION HOW CAN BIOINFORMATICS BE USED AS A TOOL…

Continue Reading From fossils to phylogenies part 2: using blast to identify … | Lecture notes Bioinformatics

Discovery and comparative genomic analysis of a novel equine anellovirus, representing the first complete Mutorquevirus genome

Manzin, A., Mallus, F., Macera, L., Maggi, F. & Blois, S. Global impact of Torque teno virus infection in wild and domesticated animals. J. Infect. Dev. Countries 9, 562–570 (2015). Article  CAS  Google Scholar  Biagini, P. et al. Family Anelloviridae. In Virus Taxonomy: Ninth Report of the International Committee on…

Continue Reading Discovery and comparative genomic analysis of a novel equine anellovirus, representing the first complete Mutorquevirus genome

Palaeogenomics of Upper Palaeolithic to Neolithic European hunter-gatherers

Prüfer, K. et al. A genome sequence from a modern human skull over 45,000 years old from Zlatý kůň in Czechia. Nat. Ecol. Evol. 5, 820–825 (2021). Article  PubMed  PubMed Central  Google Scholar  Hajdinjak, M. et al. Initial Upper Palaeolithic humans in Europe had recent Neanderthal ancestry. Nature 592, 253–257…

Continue Reading Palaeogenomics of Upper Palaeolithic to Neolithic European hunter-gatherers

A Phylogenomic Analysis of HIV Transmission Pattern among High Risk Groups of North-West India

Abstract Background Molecular techniques can enhance the power of epidemiological investigations for tracing HIV transmission networks. This information could be useful for developing strategies for the prevention of HIV transmission. Hence, we carried out a study on the transmission patterns among newly diagnosed HIV cases among High-Risk Groups (HRGs) of…

Continue Reading A Phylogenomic Analysis of HIV Transmission Pattern among High Risk Groups of North-West India

Adaptations of Pseudoxylaria towards a comb-associated lifestyle in fungus-farming termite colonies

Genome reduction is associated with a termite comb-associated lifestyle For our studies, we collected fungus comb samples originating from mounds of Macrotermes natalensis, Odontotermes spp., and Microtermes spp. termites and were able to obtain seven viable Pseudoxylaria cultures (X802 [Microtermes sp.], Mn132, Mn153, X187, X3-2 [Macrotermes natalensis], and X167, X170LB [Odontotermes…

Continue Reading Adaptations of Pseudoxylaria towards a comb-associated lifestyle in fungus-farming termite colonies

A thousand-genome panel retraces the global spread and adaptation of a major fungal crop pathogen

Global genetic structure of the pathogen tracks the historical spread of wheat We assessed the evolutionary trajectory of the pathogen in conjunction with the history of global wheat cultivation (Fig. 1a). For this, we assembled a worldwide collection of Z. tritici isolates from naturally infected fields (Fig. 1b). We selected isolates covering…

Continue Reading A thousand-genome panel retraces the global spread and adaptation of a major fungal crop pathogen

Choice of relatedness cutoff for GWAS of a large cohort (>100K samples)

Choice of relatedness cutoff for GWAS of a large cohort (>100K samples) 0 Hi all, When dealing with a large cohort (>100K samples) for GWAS, is there a case for using the more stringent cutoff to exclude 3rd degree related samples instead of 2nd degree related samples? Thank you in…

Continue Reading Choice of relatedness cutoff for GWAS of a large cohort (>100K samples)

Phase 3 Study of Uproleselan for R/R AML to Continue to Final OS Events Trigger

A pivotal phase 3 study (NCT03616470) of uproleselan (GMI-1271) in relapsed/refractory (R/R) acute myeloid leukemia (AML) has been reviewed by the Data Monitoring Committee (DMC) and was recommended to continue to the originally planned final overall survival (OS) events trigger, according to GlycoMimetics, Inc.1 The interim utility analysis was added…

Continue Reading Phase 3 Study of Uproleselan for R/R AML to Continue to Final OS Events Trigger

Genetic correlates of vitamin D-binding protein and 25-hydroxyvitamin D in neonatal dried blood spots

Samples This study was based on the Lundbeck Foundation Initiative for Integrative Psychiatric Research (iPSYCH) sample37, a population-based case-cohort design to study the genetic and environmental factors associated with severe mental disorders. The iPSYCH2012 sample is nested within the entire Danish population born between 1981 and 2005 (N = 1,472,762). In total,…

Continue Reading Genetic correlates of vitamin D-binding protein and 25-hydroxyvitamin D in neonatal dried blood spots

Institut Pasteur MLST databases and software

LIN codes General presentation The cgMLST-based Life Identification Numbers (LIN) codes (cgLIN codes, or LIN codes for short) constitute the basis of a novel bacterial strain taxonomy system proposed in 2022. An implementation was initially developed for the Klebsiella pneumoniae species complex (KpSC) by Hennart et al. 2022. This system…

Continue Reading Institut Pasteur MLST databases and software

Statistical test on two phylogenetically remote groups

Statistical test on two phylogenetically remote groups 0 I would like to conduct a statistical test to check if some character of interest is significantly different between two groups of species (let’s call them groups A and B). Since A and B belong to different kingdoms, these two groups have…

Continue Reading Statistical test on two phylogenetically remote groups

[Clonality relatedness and molecular characteristics of Richter transformation]

Objective: To investigate the clinical, genetic, and clonality related aspects of individuals with Richter transformation (RT) . Methods: From January 2019 to December 2021, 18 RT patients with diagnoses at the First Affiliated Hospital of Nanjing Medical University (Pukou CLL center) were retrospectively examined. The immunoglobin heavy variable (IGHV) gene…

Continue Reading [Clonality relatedness and molecular characteristics of Richter transformation]

Virulence and antibiotic-resistance genes in Enterococcus faecalis associated with streptococcosis disease in fish

Isolation, phenotypic identification, pathogenicity and antibiogram profiling Enterococcus faecalis strains BFF1B1, BFFF11 and BFPS6 were cultured in Streptococcus selective agar media (Himedia, India). The culture characteristics such as colony, morphological, physiological and biochemical characteristics of these strains BFF1B1, BFFF11 and BFPS6 were summarized in the Supplementary Table S1. All of…

Continue Reading Virulence and antibiotic-resistance genes in Enterococcus faecalis associated with streptococcosis disease in fish

Quantitative dose-response analysis untangles host bottlenecks to enteric infection

A small number of C. rodentium founders initiates enteric infection To enable monitoring of the pathogen population’s diversity during infection, we introduced short, random, ~20 nucleotide DNA tags (barcodes) at a neutral location in the C. rodentium genome. As previously described5, monitoring barcode diversity using high-throughput DNA sequencing and the…

Continue Reading Quantitative dose-response analysis untangles host bottlenecks to enteric infection

Inferring genetic structure when there is little: population genetics versus genomics of the threatened bat Miniopterus schreibersii across Europe

Charlesworth, B. & Charlesworth, D. Population genetics from 1966 to 2016. Heredity 118, 2–9 (2017). CAS  Google Scholar  Orsini, L., Vanoverbeke, J., Swillen, I., Mergeay, J. & Meester, L. Drivers of population genetic differentiation in the wild: Isolation by dispersal limitation, isolation by adaptation and isolation by colonization. Mol. Ecol….

Continue Reading Inferring genetic structure when there is little: population genetics versus genomics of the threatened bat Miniopterus schreibersii across Europe

Genetic determinants and absence of breast cancer in Xavante Indians in Sangradouro Reserve, Brazil

Ethics statement Authorization from Fundação Nacional do Índio (FUNAI) was acquired after approval from the Research Ethics Committee of the Faculty of Medicine in the Federal University of Mato Grosso (UFMT), and the National Commission of Research Ethics (authorization #1004/2001). Written consents, which were recorded and archived, were acquired from…

Continue Reading Genetic determinants and absence of breast cancer in Xavante Indians in Sangradouro Reserve, Brazil

Closed genomes uncover a saltwater species of Candidatus Electronema and shed new light on the boundary between marine and freshwater cable bacteria

Pfeffer C, Larsen S, Song J, Dong M, Besenbacher F, Meyer RL, et al. Filamentous bacteria transport electrons over centimetre distances. Nature. 2012;491:218–21. Article  CAS  Google Scholar  Lovley DR, Holmes DE. Electromicrobiology: the ecophysiology of phylogenetically diverse electroactive microorganisms. Nat Rev Microbiol. 2022;20:5–19. Article  CAS  Google Scholar  Bjerg JT, Boschker…

Continue Reading Closed genomes uncover a saltwater species of Candidatus Electronema and shed new light on the boundary between marine and freshwater cable bacteria

Reply to: Genotype by sex interactions in ankylosing spondylitis

Bernabeu, E. et al. Sex differences in genetic architecture in the UK Biobank. Nat. Genet. 53, 1283–1289 (2021). Article  CAS  Google Scholar  Li, Z. et al. Genotype by sex interactions in ankylosing spondylitis. Nat. Genet. doi.org/10.1038/s41588-022-01250-5 (2023). Zhou, X. & Reveille, J. D. Imputation-based analysis of MICA alleles in the…

Continue Reading Reply to: Genotype by sex interactions in ankylosing spondylitis

Insights on the bacterial composition of Parmigiano Reggiano Pure Whey Starter by a culture-dependent and 16S rRNA metabarcoding portrait

Smid, E. J. et al. Practical implications of the microbial group construction of undefined mesophilic starter cultures. Microb. Cell Factories 13, S2. doi.org/10.1186/1475-2859-13-S1-S2 (2014). Article  Google Scholar  Stadhouders, J. & Leenders, G. J. M. Spontaneously developed mixed-strain cheese starters. Their behaviour in direction of phages and their use within the…

Continue Reading Insights on the bacterial composition of Parmigiano Reggiano Pure Whey Starter by a culture-dependent and 16S rRNA metabarcoding portrait

As of July 2015, the VCFtools project has been moved to github! Please visit the new website here: vcftools.github.io/man_0112a.html

NAME SYNOPSIS DESCRIPTION EXAMPLES BASIC OPTIONS SITE FILTERING OPTIONS INDIVIDUAL FILTERING OPTIONS GENOTYPE FILTERING OPTIONS OUTPUT OPTIONS COMPARISON OPTIONS AUTHOR NAME VCFtools v0.1.12a − Utilities for the variant call format (VCF) and binary variant call format (BCF) SYNOPSIS vcftools [ –vcf FILE | –gzvcf FILE | –bcf FILE]…

Continue Reading As of July 2015, the VCFtools project has been moved to github! Please visit the new website here: vcftools.github.io/man_0112a.html

The genus Serratia revisited by genomics

Merlino, C. P. Bartolomeo Bizio’s letter to the most eminent priest, Angelo Bellani, concerning the phenomenon of the red-colored polenta [translated from the Italian]. J. Bacteriol. 9, 527–543 (1924). Grimont, P. A. D. & Dulong de Rosnay, H. L. C. Numerical study of 60 strains of Serratia. J. Gen. Microbiol….

Continue Reading The genus Serratia revisited by genomics

Nitrogen cycling and microbial cooperation in the terrestrial subsurface

Distribution of nitrogen-cycling pathways in groundwater Differences in nitrogen-cycling processes based on oxygen and nitrate concentrations Sixteen metagenomes (Table S4) were obtained from duplicate wells at four sites (A–D) from two unconfined alluvial aquifers (Canterbury, Fig. S1). These sites encompassed varied nitrate (0.45–12.6 g/m3), DO (0.37–7.5 mg/L), and dissolved organic carbon (DOC) (0–26 g/m3)…

Continue Reading Nitrogen cycling and microbial cooperation in the terrestrial subsurface

CRISPR-Cas technology a new era in genomic engineering

Review doi: 10.1016/j.btre.2022.e00731. eCollection 2022 Jun. Affiliations Expand Affiliation 1 Department of Agriculture and Natural Resources, College of Agriculture, Science, and Technology, Delaware State University, Dover, DE 19901, United States of America. Free PMC article Item in Clipboard Review Ali Parsaeimehr et al. Biotechnol Rep (Amst). 2022. Free PMC article Show…

Continue Reading CRISPR-Cas technology a new era in genomic engineering

Genetic and chemotherapeutic influences on germline hypermutation

DNM filtering in 100,000 Genomes Project We analysed DNMs called in 13,949 parent–offspring trios from 12,609 families from the rare disease programme of the 100,000 Genomes Project. The rare disease cohort includes individuals with a wide array of diseases, including neurodevelopmental disorders, cardiovascular disorders, renal and urinary tract disorders, ophthalmological…

Continue Reading Genetic and chemotherapeutic influences on germline hypermutation

About mtDNA

When forensic cases arise where there is insufficient biological material for nuclear DNA typing, mitochondrial DNA analysis can provide valuable supplemental information, even from such limited samples as half-centimeter long hair fragments or single teeth. Because of its usefulness when limited biological material is available, and due to its unique…

Continue Reading About mtDNA

Difference Between Mitochondrial DNA and Nuclear DNA

Deoxyribonucleic acid (DNA) carries genetic information that serves as a set of instructions for growth and development, as well as the ultimate function and reproduction of an organism. It is a nucleic acid, one of four major types of macromolecules known to be essential for all life forms. Each DNA molecule…

Continue Reading Difference Between Mitochondrial DNA and Nuclear DNA

Bioconductor – SNPRelate

DOI: 10.18129/B9.bioc.SNPRelate     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see SNPRelate. Parallel Computing Toolset for Relatedness and Principal Component Analysis of SNP Data Bioconductor version: 3.12 Genome-wide association studies (GWAS) are widely used to investigate the genetic basis of diseases and…

Continue Reading Bioconductor – SNPRelate

Phylogenomic analysis of CTX-M-15-producing Enterobacter hormaechei belonging to the high-risk ST78 from animal infection: Another successful One Health clone?

Available online 18 February 2022 doi.org/10.1016/j.jgar.2022.02.010Get rights and content Highlights • ESBL-positive Enterobacter cloacae complex members are critical priority pathogens. • E. hormaechei belonging to sequence type (ST) ST78 is an emergent high-risk clone. • Phylogenomic data of an E. hormaechei ST78/CTX-M-15 infecting a calf is presented. • E. hormaechei…

Continue Reading Phylogenomic analysis of CTX-M-15-producing Enterobacter hormaechei belonging to the high-risk ST78 from animal infection: Another successful One Health clone?

Postdoctoral Scholar in Microbiology and Bioinformatics, Cumming School of Medicine – University of Calgary – job portal

University of Calgary Home Prospective Students Current Students Alumni Community Faculty & Staff Home Information for Candidates Opportunities by Type Opportunities by Faculty/Unit Home Information for Candidates Opportunities by Type Opportunities by Faculty/Unit Share this Job: Postdoctoral Scholar in Microbiology and Bioinformatics, Cumming School of Medicine Job ID: 24643 Updated:…

Continue Reading Postdoctoral Scholar in Microbiology and Bioinformatics, Cumming School of Medicine – University of Calgary – job portal

Natera launches Prospera with quantification to improve kidney graft rejection testing

Natera has announced the launch of Prospera with quantification, the only cell-free DNA (cfDNA) test for kidney rejection that provides three values—the quantity of donor-derived cfDNA (dd-cfDNA), fraction of dd-cfDNA, and total cfDNA—on every report. Combining these three metrics has been shown to improve sensitivity when evaluating transplant rejection, compared…

Continue Reading Natera launches Prospera with quantification to improve kidney graft rejection testing

Merging genotyping array VCFs and then running kinship analysis

Merging genotyping array VCFs and then running kinship analysis 0 Hello, I have about 4200 array genotyping VCFs (from the Illumina Infinium CoreExome-24 Kit) and I have merged them using bcftools merge. The chip has 500K exonic SNPs. These are trio data – which means 1700 of them are probands,…

Continue Reading Merging genotyping array VCFs and then running kinship analysis

Transposition and duplication of MADS-domain transcription factor genes in annual and perennial Arabis species modulates flowering

Annual and perennial species occur in many plant families. Annual plants and some perennials are monocarpic (flowering once in their life cycle), characterized by a massive flowering and typically produce many seeds before the whole plant senesces. By contrast, most perennials live for many years, show delayed reproduction, and are…

Continue Reading Transposition and duplication of MADS-domain transcription factor genes in annual and perennial Arabis species modulates flowering

Relatedness vs relatedness2 from vcftools give different results

Relatedness vs relatedness2 from vcftools give different results 1 Hello All How to you think about this relatedness results? When I use relatedness2 in vcftools I got this: vcftools –gzvcf p123.vcf.gz –relatedness2 INDV1 INDV2 N_AaAa N_AAaa N1_Aa N2_Aa RELATEDNESS_PHI p1 p1 47388 0 47388 47388 0.5 p1 p2 28084 0…

Continue Reading Relatedness vs relatedness2 from vcftools give different results

Genome-wide analysis reveals associations between climate and regional patterns of adaptive divergence and dispersal in American pikas

Alexander DH, Novembre J, Lange K (2009) Fast model-based estimation of ancestry in unrelated individuals. Genome Res 19:1655–1664 CAS  PubMed  PubMed Central  Article  Google Scholar  Alexander DH, Shringarpure SS, Novembre J, Lange K (2015) Admixture 1.3 software manual. UCLA Hum Genet Softw Distrib, Los Angeles Google Scholar  Angert AL, Bontrager…

Continue Reading Genome-wide analysis reveals associations between climate and regional patterns of adaptive divergence and dispersal in American pikas

What is the best QC to do on imputed UK Biobank data?

What is the best QC to do on imputed UK Biobank data? 0 I am receiving imputed data from UK Biobank to conduct a GWAS on. Previously I have carried out GWAS on genotype data, which I have QC’d for missingness per individual and per SNP, sex discrepancy, MAF filter…

Continue Reading What is the best QC to do on imputed UK Biobank data?

Emergence of the Coexistence of mcr-1, blaNDM-5, and blaCTX-M-55 in Kl

Introduction Klebsiella pneumoniae (K. pneumoniae) is an opportunistic pathogen and the leading cause of healthcare-associated infections.1 Multidrug-resistant (MDR) K. pneumoniae isolates are rapidly spreading, thus limiting the choice of antimicrobial agents for empiric treatment of infections caused by these microorganisms; hence, this is a public health challenge.2 Polymyxins are last-resort…

Continue Reading Emergence of the Coexistence of mcr-1, blaNDM-5, and blaCTX-M-55 in Kl

Global phylogenomic analyses of Mycobacterium abscessus provide context for non cystic fibrosis infections and the evolution of antibiotic resistance

1. Lee, M.-R. et al. Mycobacterium abscessus complex infections in humans. Emerg. Infect. Dis. 21, 1638–1646 (2015). CAS  PubMed  PubMed Central  Google Scholar  2. Prince, D. S. et al. Infection with Mycobacterium avium complex in patients without predisposing conditions. N. Engl. J. Med. 321, 863–868 (1989). CAS  PubMed  Article  Google…

Continue Reading Global phylogenomic analyses of Mycobacterium abscessus provide context for non cystic fibrosis infections and the evolution of antibiotic resistance

Can KING relatedness software be set to ignore FID?

Can KING relatedness software be set to ignore FID? 0 Hi all, I’m using KING to determine relatedness and duplicated samples in a dataset. The FID column in my fam files has been used for batch IDs, and doesn’t refer to family relatedness at all. Will this have an impact…

Continue Reading Can KING relatedness software be set to ignore FID?

Filter duplicate ID from PLINK file

Filter duplicate ID from PLINK file 0 Hi All, I am new to SNP-chip data analysis. I have been exploring some SNP-chip data using plink 1.9, while checking the Relatedness using KING, I am getting an error of duplicate ID. I was wondering if there is any method I can…

Continue Reading Filter duplicate ID from PLINK file

Plasmid-Encoded VIM-2-pProducing Pseudomonas stutzeri | IDR

Introduction Pseudomonas stutzeri is an aerobic, nonfermenting, active, Gram-negative oxidase-positive bacterium with unique colony morphology.1,2 Burri and Stutzer first described it in 1985,3 and the specific metabolic properties, such as denitrification, degradation of aromatic compounds, and nitrogen fixation, distinguish it from other pseudomonads species.2,4 Historically, P. stutzeri was not commonly…

Continue Reading Plasmid-Encoded VIM-2-pProducing Pseudomonas stutzeri | IDR

KING struggle: Relatedness

I struggle to infer relationships in a dataset of 20K exomes from tens of kits. At first I found a well-covered union of regions – check. Second, I performed everything to merge 20K VCFs into one. Removed indels and multi-allelic variants. Check. Still, when I run KING with “kinship” option,…

Continue Reading KING struggle: Relatedness