Tag: relatedness
Natera Announces Data from the
Natera%2C+Inc. (NASDAQ: NTRA), a global leader in cell-free DNA testing, today announced new data on its Prospera test being presented at the American Transplant Congress (ATC) 2023 taking place June 3-7, 2023. The presentations include several interim analyses from ProActive, a prospective donor-derived cell-free DNA (dd-cfDNA) study evaluating Natera’s Prospera…
Discrimination of monozygotic twins using mtDNA heteroplasmy through probe capture enrichment and massively parallel sequencing
Oosthuizen T, Howes LM (2022) The development of forensic DNA analysis: new debates on the issue of fundamental human rights. Forensic Sci Int Genet 56:102606 Article CAS PubMed Google Scholar Nwawuba Stanley U et al (2020) Forensic DNA profiling: autosomal short tandem repeat as a prominent marker in crime investigation….
Why Aren’t The Three Rrna Genes Of Corn One Anothers Closest Relatives?
Ribosomal RNA (rRNA) genes play a crucial role in the process of protein synthesis and are essential components of the ribosome, the cellular machinery responsible for translating genetic information into functional proteins. In many organisms, these genes are found as multiple copies within their genomes, with each copy exhibiting varying…
How Do DNA And mtDNA Differ?
The field of genetics has experienced significant advancements in recent years, shedding light on the complex molecular mechanisms that govern inheritance and the expression of genetic traits. Central to this understanding is the distinction between two distinct types of genetic material, namely deoxyribonucleic acid (DNA) and mitochondrial DNA (mtDNA). While…
Polygenic prediction of preeclampsia and gestational hypertension
Burton, G. J., Redman, C. W., Roberts, J. M. & Moffett, A. Pre-eclampsia: pathophysiology and clinical implications. BMJ 366, l2381 (2019). Article PubMed Google Scholar Jiang, L. et al. A global view of hypertensive disorders and diabetes mellitus during pregnancy. Nat. Rev. Endocrinol. 18, 760–775 (2022). Article PubMed PubMed Central …
Ex vivo RSA and pfkelch13 targeted-amplicon deep sequencing reveal parasites susceptibility to artemisinin in Senegal, 2017 | Malaria Journal
WHO. Guidelines for malaria. WHO/UCN/GMP/2022.01 Rev. 2. Geneva. World Health Organization; 2022. Nzoumbou-Boko R, Panté-Wockama CBG, Ngoagoni C, Petiot N, Legrand E, Vickos U, et al. Molecular assessment of kelch13 non-synonymous mutations in Plasmodium falciparum isolates from central African Republic (2017–2019). Malar J. 2020;19:191. Article CAS PubMed PubMed Central Google…
The impact of rare protein coding genetic variation on adult cognitive function
The UKB is approved by the North West Multi-centre Research Ethics Committee (www.ukbiobank.ac.uk/learn-more-about-uk-biobank/about-us/ethics). The current study was conducted under UKB application no. 26041. The data in the UKB were collected after written informed consent was obtained from all participants. The Human Research Committee of the MGB approved the Biobank research…
Ribosomal RNA – Study Achievement
Ribosomal RNA Definition Ribosomal ribonucleic acid (rRNA) is the RNA component of ribosomes, the molecular machines that catalyze protein synthesis. Ribosomal RNA constitute over sixty percent of the ribosome by weight and are crucial for all its functions – from binding to mRNA and recruiting tRNA to catalyzing the formation…
Genome data sheds light on how Homo sapiens arose in Africa
Our species arose in Africa more than 300,000 years ago, with the oldest-known Homo sapiens fossils discovered at a site in Morocco called Jebel Irhoud, located between Marrakech and the Atlantic coast. But the scarcity of Homo sapiens fossils from early in our evolutionary history and the geographical spread of…
Genetic Origins of Ancient Pict Warriors in Britain
Genetic analysis has uncovered the mysterious origin of the Picts, a people group that lived in many parts of northern Britain roughly 1,500 years ago. Research reveals that the ethnic group, which many thought might have come from Eastern Europe, had a local origin similar to other British Celtic groups….
Genomic Medicine Market is Probable to Influence the Value of USD 75.67 Billion by 2029, Size, Share, Trends, Demand, Growth, Challenges and Competitive Analysis
Genomic Medicine Market is Probable to Influence the Value of USD 75.67 Billion by 2029, Size, Share, Trends, Demand, Growth, Challenges and Competitive Analysis BOSTON, May 16, 2023 (GLOBE NEWSWIRE) — Data Bridge Market Research’s latest report, ” Genomic Medicine Market ” provides a thorough analysis of growth strategies, drivers,…
Microorganisms | Free Full-Text | Whole-Genome Sequencing of Shiga Toxin-Producing Escherichia coli for Characterization and Outbreak Investigation
1. Introduction Shiga toxin-producing Escherichia coli (STEC) is a Gram-negative foodborne pathogen that was estimated to cause ~265,000 infections, 3600 hospitalizations, and 30 deaths in the U.S. each year [1]. Most patients with STEC infections develop diarrhea and abdominal pain, though hemolytic uremic syndrome (HUS) and kidney failure can occur,…
Integrative population genetics and metagenomics reveals urbanization increases pathogen loads and decreases connectivity in a wild bee
As urbanization continues to increase, it is expected that two-thirds of the human population will reside in cities by 2050. Urbanization fragments and degrades natural landscapes, threatening wildlife including economically important species such as bees. In this study, we employ whole genome sequencing to characterize the population genetics, metagenome and…
Resistance of Nosocomial Acinetobacter baumannii
Chenxing Wei,1,* Jian Chen,1,* Tanveer Muhammad Anwar,2,* Lingling Huang,1 Wenjie Yang,3 Xueyan Dong,1 Qiong Chen,1 Min Yue,2,4,5 Daojun Yu1,3 1Department of Medical Laboratory, Affiliated Hangzhou First People’s Hospital, Zhejiang University School of Medicine, Hangzhou, 310006, People’s Republic of China; 2Department of Veterinary Medicine, Institute of Preventive Veterinary Sciences, Zhejiang University…
STAGEs: A web-based tool that integrates data visualization and pathway enrichment analysis for gene expression studies
STAGEs is an interactive web app built using Streamlit (www.streamlit.io), and the running instance of the online app can be accessed via the website (kuanrongchan-stages-stages-vpgh46.streamlitapp.com/). The app can also run locally using the instructions detailed in GitHub (github.com/kuanrongchan/STAGES). Users can directly upload data from Excel spreadsheets, csv or txt files…
DNA study sheds light on Scotland’s Picts, and resolves some myths about them
The people known as the Picts have puzzled archaeologists and historians for centuries. They lived in Scotland during the early medieval period, from around AD300 to AD900, but many aspects of their society remain mysterious. The Picts’ unique cultural characteristics, such as large stones decorated with distinct symbols, and lack…
Genomic and transcriptomic profiling reveal molecular characteristics of parathyroid carcinoma
Clinical and biochemical characteristics of parathyroid carcinoma In total, 50 thyroid tissues were collected from three groups, 12 parathyroid carcinomas, 28 parathyroid adenomas, and 10 normal parathyroid tissues, for genomic and transcriptomic profiling (Fig. 1). The detailed protocols and quality control procedures are described in the Materials and Methods section….
GWAS with OmicsBox – BioBam
Genome-Wide Association Studies (GWAS) is a valuable approach to investigating the relationship between genetic variations and phenotypic traits. However, due to many different analysis options, performing GWAS can be challenging, especially for researchers without a strong background in statistics or bioinformatics. OmicsBox’s Genetic Variation Module provides a solution by offering…
Application of a core genome sequence typing (cgMLST) pipeline for surveillance of Clostridioides difficile in China
Front Cell Infect Microbiol . 2023 Mar 13;13:1109153. doi: 10.3389/fcimb.2023.1109153. eCollection 2023. Affiliations Expand Affiliations 1 State Key Laboratory of Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing, China. 2 Research Center for Micro-Ecological Agent Engineering and…
Public health implications of Yersinia enterocolitica investigation: an ecological modeling and molecular epidemiology study | Infectious Diseases of Poverty
Epidemic profile of Yersinia during 2007–2019 A total of 9031 samples were monitored from 2007 to 2019, with the detection rate of Yersinia ranging from 0.9% to 7.6% (Table 1). The highest detection rate was in 2014 (7.6%), eightfold higher than in 2013 (0.5%). The difference in positivity rates between…
Molecular and expression characterization of insulin-like signaling in development and metabolism of Aedes albopictus | Parasites & Vectors
Molecular and phylogenetic characterization of Ae. albopictus ILP genes Seven putative ILP transcripts in Ae. albopictus genomic assembly were obtained by using sequence blast with known Ae. aegypti ILP1-8 genes [5]. The phylogenetic analysis was performed to discern the evolutionary relatedness of Ae. albopictus ILPs with those identified in other…
Desulfovibrionaceae | 24 Publications | 865 Citations | Top Authors
Abstract: The different nutritional properties of several Desulfovibrio desulfuricans strains suggest that either the strains are misclassified or there is a high degree of phenotypic diversity within the genus Desulfovibrio. The results of partial 16S rRNA and 23S rRNA sequence determinations demonstrated that Desulfovibrio desulfuricans ATCC 27774 and “Desulfovibrio multispirans”…
kinship coefficient negative in multi-sample VCF from exome sequencing
Hi All, I hope you can guide me a hand here. I have a SNP multi-sample vcf file (n=259 people) from target exome sequencing with ~20x coverage; this file has been processed with GATK by a big Center so I fairly trusted their work. This multi-sample vcf file contains ~70…
chromosome identifier not found in FASTA file, prompting ‘skipping’ error, when chr identifier is there
Hi, I have a FASTA file that looks like this: >D00829_0044_ACADL6ANXX_PEdi_Ay_VS_2:6:1214:4434:71826 TGATCTTGGCCAAGTCACTTCCTCCTTCAGGAACATTGCAGTGG >D00829_0044_ACADL6ANXX_PEdi_Ay_VS_2:1:2203:12900:37094 ACTTTGGTCAAGTCACTTCCTCCTTCAGGAACATTGCAGTGG >D00829_0044_ACADL6ANXX_PEdi_Ay_VS_2:1:2213:1470:83635 Which I created through the code below. The .bam file in question is an aDNA file from a Neanderthal (cdna.eva.mpg.de/neandertal/Chagyrskaya/BAM/). samtools bam2fq chr22.rh.bam > chag.22.fq bioawk -c fastx ‘{print “>”$name”\n”$seq}’ chag.22.fq > chag.22.fa I also…
Thermophilic Dehalococcoidia with unusual traits shed light on an unexpected past
Two new Tepidiforma species expand on a small number of cultivated Dehalococcoidia Two bacterial strains were isolated from terrestrial geothermal springs by plating benthic mat and sediment slurries onto R2A medium and were identified by 16S rRNA gene sequencing as members of the recently described genus Tepidiforma [27]. Strain YIM…
15.1. Methods and Mathematics – EN – Deep Learning Bible – 2. Classification
en.wikipedia.org/wiki/Multi-task_learning $\equiv$ CONTENTS Methods 1.1. Task grouping and overlap 1.2. Exploiting unrelated tasks 1.3. Transfer of knowledge 1.4. Group online adaptive learning Mathematics / Reproducing Hilbert space of vector valued functions (RKHSvv) 2.1. RKHSvv concepts 2.2. Separable kernels 2.3. Known task structure $\quad$ 2.3.1. Task structure representations $\quad$ 2.3.2. Task…
The Biostar Herald for Monday, April 10, 2023
The Biostar Herald publishes user submitted links of bioinformatics relevance. It aims to provide a summary of interesting and relevant information you may have missed. You too can submit links here. This edition of the Herald was brought to you by contribution from Istvan Albert, Pavel, and was edited by…
Whole-genome sequencing of Shigella for surveillance purposes shows (inter)national relatedness and multidrug resistance in isolates from men who have sex with men
Whole-genome sequencing of Shigella for surveillance purposes shows (inter)national relatedness and multidrug resistance in isolates from men who have sex with men | Microbiology Society 1887 This is a required field Please enter a valid email address Approval was a Success Invalid data An Error Occurred Approval was…
Phylogenomic analysis uncovers a 9-year variation of Uganda influenza type-A strains from the WHO-recommended vaccines and other Africa strains
Demographic characteristics of sampled patients The Uganda Virus Research Institute National Influenza Centre (UVRI-NIC) laboratory tested 18,353 patients between 22nd October 2010 and 9th May 2018. Thirteen-percent (2404/18,353) were positive for influenza, 69.88% (1680/2404), 29.62% (712/2404), and 0.17% (4/2404) had influenza A, B, and A/B co-infection, respectively (Fig. 1A). IAV positives…
DDX3Y is likely the key spermatogenic factor in the AZFa region that contributes to human non-obstructive azoospermia
Vander Borght, M. & Wyns, C. Fertility and infertility: definition and epidemiology. Clin. Biochem. 62, 2–10 (2018). Article Google Scholar Kasak, L. & Laan, M. Monogenic causes of non-obstructive azoospermia: challenges, established knowledge, limitations and perspectives. Hum. Genet. 140, 135–154 (2021). Article PubMed Google Scholar Punab, M. et al. Causes…
Intraspecific trait variation and species turnover in successional tropical forests: assessing trait imputation for community-weighted means
Adler PB, Salguero-Gómez R, Compagnoni A, Hsu JS, Ray-Mukherjee J, Mbeau-Ache C, Franco M (2014) Functional traits explain variation in plant life history strategies. Proc Natl Acad Sci USA 111:740–745 Article CAS PubMed Google Scholar Albert CH, Thuiller W, Yoccoz NG, Soudant A, Boucher F, Saccone P, Lavorel S (2010)…
The potential to produce tropodithietic acid by Phaeobacter inhibens affects the assembly of microbial biofilm communities in natural seawater
Falkowski, P. G., Barber, R. T. & Smetacek, V. Biogeochemical controls and feedbacks on ocean primary production. Science (1979) 281, 200–206 (1998). CAS Google Scholar Nemergut, D. R. et al. Patterns and processes of microbial community assembly. Microbiol. Mol. Biol. Rev. 77, 342–356 (2013). Article PubMed PubMed Central Google Scholar …
significant sequence identity?
significant sequence identity? 1 Hi, could you tell me when I can define the sequence identity between two proteins significant?In general, I knew that sequences with more 30% sequence identity are considered similar, and below no..Could you confirm that? Thank you very much. Silvia sequence • 1.4k views Yes/No. It…
Rickettsial DNA and a trans-splicing rRNA group I intron in the unorthodox mitogenome of the fern Haplopteris ensiformis
Our choice of the shoestring fern H. ensiformis as a leptosporangiate fern for complete assembly of both organelle genomes was based on pronounced variability in mitochondrial RNA editing and intron (co-)evolution in the monilophyte family Pteridaceae and the sub-family Vittarioideae in particular22. We used next-generation sequencing (NGS) data to assemble…
Intravenous ravulizumab in mechanically ventilated patients hospitalised with severe COVID-19: a phase 3, multicentre, open-label, randomised controlled trial
Introduction Case fatality rates of COVID-19 have decreased globally from 3·7% in March, 2020, to 1·0% in February, 2023, due in part to vaccination, changes in the prevailing SARS-CoV-2 variant, and improvements in clinical care. 1 Global case fatality rate from COVID-19 has decreased by 96·8% during 2·5 years of…
Investigation of a suspected nosocomial transmission of blaKPC3-mediated carbapenem-resistant Klebsiella pneumoniae by whole genome sequencing.
Abstract Whole genome sequencing (WGS) was compared to pulse-field gel electrophoresis (PFGE) of XbaI-digested genomic DNA, as methods by which to evaluate a potential transmission of carbapenem-resistant Klebsiella pneumoniae between 2 hospital inpatients. PFGE result demonstrated only 1-band difference between the isolates, suggesting probable relatedness. In contrast, while WGS data…
Genomic diversity of non-diarrheagenic fecal Escherichia coli from children in sub-Saharan Africa and south Asia and their relatedness to diarrheagenic E. coli
Kaper, J. B., Nataro, J. P. & Mobley, H. L. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2, 123–140 (2004). Article CAS PubMed Google Scholar Nataro, J. P. & Kaper, J. B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11, 142–201 (1998). Article CAS PubMed PubMed Central Google Scholar Croxen, M. A….
From fossils to phylogenies part 2: using blast to identify … | Lecture notes Bioinformatics
Download from fossils to phylogenies part 2: using blast to identify … and more Bioinformatics Lecture notes in PDF only on Docsity! FROM FOSSILS TO PHYLOGENIES PART 2: USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES – TEACHER EDITION HOW CAN BIOINFORMATICS BE USED AS A TOOL…
Discovery and comparative genomic analysis of a novel equine anellovirus, representing the first complete Mutorquevirus genome
Manzin, A., Mallus, F., Macera, L., Maggi, F. & Blois, S. Global impact of Torque teno virus infection in wild and domesticated animals. J. Infect. Dev. Countries 9, 562–570 (2015). Article CAS Google Scholar Biagini, P. et al. Family Anelloviridae. In Virus Taxonomy: Ninth Report of the International Committee on…
Palaeogenomics of Upper Palaeolithic to Neolithic European hunter-gatherers
Prüfer, K. et al. A genome sequence from a modern human skull over 45,000 years old from Zlatý kůň in Czechia. Nat. Ecol. Evol. 5, 820–825 (2021). Article PubMed PubMed Central Google Scholar Hajdinjak, M. et al. Initial Upper Palaeolithic humans in Europe had recent Neanderthal ancestry. Nature 592, 253–257…
A Phylogenomic Analysis of HIV Transmission Pattern among High Risk Groups of North-West India
Abstract Background Molecular techniques can enhance the power of epidemiological investigations for tracing HIV transmission networks. This information could be useful for developing strategies for the prevention of HIV transmission. Hence, we carried out a study on the transmission patterns among newly diagnosed HIV cases among High-Risk Groups (HRGs) of…
Adaptations of Pseudoxylaria towards a comb-associated lifestyle in fungus-farming termite colonies
Genome reduction is associated with a termite comb-associated lifestyle For our studies, we collected fungus comb samples originating from mounds of Macrotermes natalensis, Odontotermes spp., and Microtermes spp. termites and were able to obtain seven viable Pseudoxylaria cultures (X802 [Microtermes sp.], Mn132, Mn153, X187, X3-2 [Macrotermes natalensis], and X167, X170LB [Odontotermes…
A thousand-genome panel retraces the global spread and adaptation of a major fungal crop pathogen
Global genetic structure of the pathogen tracks the historical spread of wheat We assessed the evolutionary trajectory of the pathogen in conjunction with the history of global wheat cultivation (Fig. 1a). For this, we assembled a worldwide collection of Z. tritici isolates from naturally infected fields (Fig. 1b). We selected isolates covering…
Choice of relatedness cutoff for GWAS of a large cohort (>100K samples)
Choice of relatedness cutoff for GWAS of a large cohort (>100K samples) 0 Hi all, When dealing with a large cohort (>100K samples) for GWAS, is there a case for using the more stringent cutoff to exclude 3rd degree related samples instead of 2nd degree related samples? Thank you in…
Phase 3 Study of Uproleselan for R/R AML to Continue to Final OS Events Trigger
A pivotal phase 3 study (NCT03616470) of uproleselan (GMI-1271) in relapsed/refractory (R/R) acute myeloid leukemia (AML) has been reviewed by the Data Monitoring Committee (DMC) and was recommended to continue to the originally planned final overall survival (OS) events trigger, according to GlycoMimetics, Inc.1 The interim utility analysis was added…
Genetic correlates of vitamin D-binding protein and 25-hydroxyvitamin D in neonatal dried blood spots
Samples This study was based on the Lundbeck Foundation Initiative for Integrative Psychiatric Research (iPSYCH) sample37, a population-based case-cohort design to study the genetic and environmental factors associated with severe mental disorders. The iPSYCH2012 sample is nested within the entire Danish population born between 1981 and 2005 (N = 1,472,762). In total,…
Institut Pasteur MLST databases and software
LIN codes General presentation The cgMLST-based Life Identification Numbers (LIN) codes (cgLIN codes, or LIN codes for short) constitute the basis of a novel bacterial strain taxonomy system proposed in 2022. An implementation was initially developed for the Klebsiella pneumoniae species complex (KpSC) by Hennart et al. 2022. This system…
Statistical test on two phylogenetically remote groups
Statistical test on two phylogenetically remote groups 0 I would like to conduct a statistical test to check if some character of interest is significantly different between two groups of species (let’s call them groups A and B). Since A and B belong to different kingdoms, these two groups have…
[Clonality relatedness and molecular characteristics of Richter transformation]
Objective: To investigate the clinical, genetic, and clonality related aspects of individuals with Richter transformation (RT) . Methods: From January 2019 to December 2021, 18 RT patients with diagnoses at the First Affiliated Hospital of Nanjing Medical University (Pukou CLL center) were retrospectively examined. The immunoglobin heavy variable (IGHV) gene…
Virulence and antibiotic-resistance genes in Enterococcus faecalis associated with streptococcosis disease in fish
Isolation, phenotypic identification, pathogenicity and antibiogram profiling Enterococcus faecalis strains BFF1B1, BFFF11 and BFPS6 were cultured in Streptococcus selective agar media (Himedia, India). The culture characteristics such as colony, morphological, physiological and biochemical characteristics of these strains BFF1B1, BFFF11 and BFPS6 were summarized in the Supplementary Table S1. All of…
Quantitative dose-response analysis untangles host bottlenecks to enteric infection
A small number of C. rodentium founders initiates enteric infection To enable monitoring of the pathogen population’s diversity during infection, we introduced short, random, ~20 nucleotide DNA tags (barcodes) at a neutral location in the C. rodentium genome. As previously described5, monitoring barcode diversity using high-throughput DNA sequencing and the…
Inferring genetic structure when there is little: population genetics versus genomics of the threatened bat Miniopterus schreibersii across Europe
Charlesworth, B. & Charlesworth, D. Population genetics from 1966 to 2016. Heredity 118, 2–9 (2017). CAS Google Scholar Orsini, L., Vanoverbeke, J., Swillen, I., Mergeay, J. & Meester, L. Drivers of population genetic differentiation in the wild: Isolation by dispersal limitation, isolation by adaptation and isolation by colonization. Mol. Ecol….
Genetic determinants and absence of breast cancer in Xavante Indians in Sangradouro Reserve, Brazil
Ethics statement Authorization from Fundação Nacional do Índio (FUNAI) was acquired after approval from the Research Ethics Committee of the Faculty of Medicine in the Federal University of Mato Grosso (UFMT), and the National Commission of Research Ethics (authorization #1004/2001). Written consents, which were recorded and archived, were acquired from…
Closed genomes uncover a saltwater species of Candidatus Electronema and shed new light on the boundary between marine and freshwater cable bacteria
Pfeffer C, Larsen S, Song J, Dong M, Besenbacher F, Meyer RL, et al. Filamentous bacteria transport electrons over centimetre distances. Nature. 2012;491:218–21. Article CAS Google Scholar Lovley DR, Holmes DE. Electromicrobiology: the ecophysiology of phylogenetically diverse electroactive microorganisms. Nat Rev Microbiol. 2022;20:5–19. Article CAS Google Scholar Bjerg JT, Boschker…
Reply to: Genotype by sex interactions in ankylosing spondylitis
Bernabeu, E. et al. Sex differences in genetic architecture in the UK Biobank. Nat. Genet. 53, 1283–1289 (2021). Article CAS Google Scholar Li, Z. et al. Genotype by sex interactions in ankylosing spondylitis. Nat. Genet. doi.org/10.1038/s41588-022-01250-5 (2023). Zhou, X. & Reveille, J. D. Imputation-based analysis of MICA alleles in the…
Insights on the bacterial composition of Parmigiano Reggiano Pure Whey Starter by a culture-dependent and 16S rRNA metabarcoding portrait
Smid, E. J. et al. Practical implications of the microbial group construction of undefined mesophilic starter cultures. Microb. Cell Factories 13, S2. doi.org/10.1186/1475-2859-13-S1-S2 (2014). Article Google Scholar Stadhouders, J. & Leenders, G. J. M. Spontaneously developed mixed-strain cheese starters. Their behaviour in direction of phages and their use within the…
As of July 2015, the VCFtools project has been moved to github! Please visit the new website here: vcftools.github.io/man_0112a.html
NAME SYNOPSIS DESCRIPTION EXAMPLES BASIC OPTIONS SITE FILTERING OPTIONS INDIVIDUAL FILTERING OPTIONS GENOTYPE FILTERING OPTIONS OUTPUT OPTIONS COMPARISON OPTIONS AUTHOR NAME VCFtools v0.1.12a − Utilities for the variant call format (VCF) and binary variant call format (BCF) SYNOPSIS vcftools [ –vcf FILE | –gzvcf FILE | –bcf FILE]…
The genus Serratia revisited by genomics
Merlino, C. P. Bartolomeo Bizio’s letter to the most eminent priest, Angelo Bellani, concerning the phenomenon of the red-colored polenta [translated from the Italian]. J. Bacteriol. 9, 527–543 (1924). Grimont, P. A. D. & Dulong de Rosnay, H. L. C. Numerical study of 60 strains of Serratia. J. Gen. Microbiol….
Nitrogen cycling and microbial cooperation in the terrestrial subsurface
Distribution of nitrogen-cycling pathways in groundwater Differences in nitrogen-cycling processes based on oxygen and nitrate concentrations Sixteen metagenomes (Table S4) were obtained from duplicate wells at four sites (A–D) from two unconfined alluvial aquifers (Canterbury, Fig. S1). These sites encompassed varied nitrate (0.45–12.6 g/m3), DO (0.37–7.5 mg/L), and dissolved organic carbon (DOC) (0–26 g/m3)…
CRISPR-Cas technology a new era in genomic engineering
Review doi: 10.1016/j.btre.2022.e00731. eCollection 2022 Jun. Affiliations Expand Affiliation 1 Department of Agriculture and Natural Resources, College of Agriculture, Science, and Technology, Delaware State University, Dover, DE 19901, United States of America. Free PMC article Item in Clipboard Review Ali Parsaeimehr et al. Biotechnol Rep (Amst). 2022. Free PMC article Show…
Genetic and chemotherapeutic influences on germline hypermutation
DNM filtering in 100,000 Genomes Project We analysed DNMs called in 13,949 parent–offspring trios from 12,609 families from the rare disease programme of the 100,000 Genomes Project. The rare disease cohort includes individuals with a wide array of diseases, including neurodevelopmental disorders, cardiovascular disorders, renal and urinary tract disorders, ophthalmological…
About mtDNA
When forensic cases arise where there is insufficient biological material for nuclear DNA typing, mitochondrial DNA analysis can provide valuable supplemental information, even from such limited samples as half-centimeter long hair fragments or single teeth. Because of its usefulness when limited biological material is available, and due to its unique…
Difference Between Mitochondrial DNA and Nuclear DNA
Deoxyribonucleic acid (DNA) carries genetic information that serves as a set of instructions for growth and development, as well as the ultimate function and reproduction of an organism. It is a nucleic acid, one of four major types of macromolecules known to be essential for all life forms. Each DNA molecule…
Bioconductor – SNPRelate
DOI: 10.18129/B9.bioc.SNPRelate This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see SNPRelate. Parallel Computing Toolset for Relatedness and Principal Component Analysis of SNP Data Bioconductor version: 3.12 Genome-wide association studies (GWAS) are widely used to investigate the genetic basis of diseases and…
Phylogenomic analysis of CTX-M-15-producing Enterobacter hormaechei belonging to the high-risk ST78 from animal infection: Another successful One Health clone?
Available online 18 February 2022 doi.org/10.1016/j.jgar.2022.02.010Get rights and content Highlights • ESBL-positive Enterobacter cloacae complex members are critical priority pathogens. • E. hormaechei belonging to sequence type (ST) ST78 is an emergent high-risk clone. • Phylogenomic data of an E. hormaechei ST78/CTX-M-15 infecting a calf is presented. • E. hormaechei…
Postdoctoral Scholar in Microbiology and Bioinformatics, Cumming School of Medicine – University of Calgary – job portal
University of Calgary Home Prospective Students Current Students Alumni Community Faculty & Staff Home Information for Candidates Opportunities by Type Opportunities by Faculty/Unit Home Information for Candidates Opportunities by Type Opportunities by Faculty/Unit Share this Job: Postdoctoral Scholar in Microbiology and Bioinformatics, Cumming School of Medicine Job ID: 24643 Updated:…
Natera launches Prospera with quantification to improve kidney graft rejection testing
Natera has announced the launch of Prospera with quantification, the only cell-free DNA (cfDNA) test for kidney rejection that provides three values—the quantity of donor-derived cfDNA (dd-cfDNA), fraction of dd-cfDNA, and total cfDNA—on every report. Combining these three metrics has been shown to improve sensitivity when evaluating transplant rejection, compared…
Merging genotyping array VCFs and then running kinship analysis
Merging genotyping array VCFs and then running kinship analysis 0 Hello, I have about 4200 array genotyping VCFs (from the Illumina Infinium CoreExome-24 Kit) and I have merged them using bcftools merge. The chip has 500K exonic SNPs. These are trio data – which means 1700 of them are probands,…
Transposition and duplication of MADS-domain transcription factor genes in annual and perennial Arabis species modulates flowering
Annual and perennial species occur in many plant families. Annual plants and some perennials are monocarpic (flowering once in their life cycle), characterized by a massive flowering and typically produce many seeds before the whole plant senesces. By contrast, most perennials live for many years, show delayed reproduction, and are…
Relatedness vs relatedness2 from vcftools give different results
Relatedness vs relatedness2 from vcftools give different results 1 Hello All How to you think about this relatedness results? When I use relatedness2 in vcftools I got this: vcftools –gzvcf p123.vcf.gz –relatedness2 INDV1 INDV2 N_AaAa N_AAaa N1_Aa N2_Aa RELATEDNESS_PHI p1 p1 47388 0 47388 47388 0.5 p1 p2 28084 0…
Genome-wide analysis reveals associations between climate and regional patterns of adaptive divergence and dispersal in American pikas
Alexander DH, Novembre J, Lange K (2009) Fast model-based estimation of ancestry in unrelated individuals. Genome Res 19:1655–1664 CAS PubMed PubMed Central Article Google Scholar Alexander DH, Shringarpure SS, Novembre J, Lange K (2015) Admixture 1.3 software manual. UCLA Hum Genet Softw Distrib, Los Angeles Google Scholar Angert AL, Bontrager…
What is the best QC to do on imputed UK Biobank data?
What is the best QC to do on imputed UK Biobank data? 0 I am receiving imputed data from UK Biobank to conduct a GWAS on. Previously I have carried out GWAS on genotype data, which I have QC’d for missingness per individual and per SNP, sex discrepancy, MAF filter…
Emergence of the Coexistence of mcr-1, blaNDM-5, and blaCTX-M-55 in Kl
Introduction Klebsiella pneumoniae (K. pneumoniae) is an opportunistic pathogen and the leading cause of healthcare-associated infections.1 Multidrug-resistant (MDR) K. pneumoniae isolates are rapidly spreading, thus limiting the choice of antimicrobial agents for empiric treatment of infections caused by these microorganisms; hence, this is a public health challenge.2 Polymyxins are last-resort…
Global phylogenomic analyses of Mycobacterium abscessus provide context for non cystic fibrosis infections and the evolution of antibiotic resistance
1. Lee, M.-R. et al. Mycobacterium abscessus complex infections in humans. Emerg. Infect. Dis. 21, 1638–1646 (2015). CAS PubMed PubMed Central Google Scholar 2. Prince, D. S. et al. Infection with Mycobacterium avium complex in patients without predisposing conditions. N. Engl. J. Med. 321, 863–868 (1989). CAS PubMed Article Google…
Can KING relatedness software be set to ignore FID?
Can KING relatedness software be set to ignore FID? 0 Hi all, I’m using KING to determine relatedness and duplicated samples in a dataset. The FID column in my fam files has been used for batch IDs, and doesn’t refer to family relatedness at all. Will this have an impact…
Filter duplicate ID from PLINK file
Filter duplicate ID from PLINK file 0 Hi All, I am new to SNP-chip data analysis. I have been exploring some SNP-chip data using plink 1.9, while checking the Relatedness using KING, I am getting an error of duplicate ID. I was wondering if there is any method I can…
Plasmid-Encoded VIM-2-pProducing Pseudomonas stutzeri | IDR
Introduction Pseudomonas stutzeri is an aerobic, nonfermenting, active, Gram-negative oxidase-positive bacterium with unique colony morphology.1,2 Burri and Stutzer first described it in 1985,3 and the specific metabolic properties, such as denitrification, degradation of aromatic compounds, and nitrogen fixation, distinguish it from other pseudomonads species.2,4 Historically, P. stutzeri was not commonly…
KING struggle: Relatedness
I struggle to infer relationships in a dataset of 20K exomes from tens of kits. At first I found a well-covered union of regions – check. Second, I performed everything to merge 20K VCFs into one. Removed indels and multi-allelic variants. Check. Still, when I run KING with “kinship” option,…