Tag: rtracklayer

extendedSequences length is not the required for DeepCpf1 (34bp)

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

Continue Reading extendedSequences length is not the required for DeepCpf1 (34bp)

[BioC] rtracklayer 1.6: invalid class “ucscCart” object

Dear Bioc, Following the rtracklayer documentation, section 2.2.4, ‘A Shortcut’, I encounter the following error browseGenome (subTargetTrack) Error in validObject(.Object) :invalid class “ucscCart” object: superclass “ANYTHING” not defined in the environment of the object’s class traceback () 13: stop(msg, ” “, errors, domain = NA)12: validObject(.Object)11: initialize(value, …)10: initialize(value, …)9:…

Continue Reading [BioC] rtracklayer 1.6: invalid class “ucscCart” object

Error in SummarizedExperiment

I have installed DESeq2 version 1.36.0 samples <- colnames(txi$counts) group <- as.factor(c(“control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”, “control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”,”diet”)) coldata <- data.frame(samples, group, stringsAsFactors = F) coldata <- coldata[,c(“samples”,”group”)] coldata$samples <- factor(coldata$samples) coldata$group <- factor(coldata$group) rownames(coldata) <- sub(“fb”, “”, rownames(coldata)) all(rownames(coldata$samples) %in% colnames(txi)) all(rownames(coldata) == colnames(txi)) TRUE library(DESeq2) ddsTxi <- DESeqDataSetFromTximport(txi, colData = coldata, design =…

Continue Reading Error in SummarizedExperiment

deseq2 problem

deseq2 problem 0 Hi I am trying to draw a PCA plot with DESeq2 but somehow I cannot use DESeq2 functions. It is a really simple code i wil be pasting below. > transform <- DESeq2::rlog(eliminated_data, blind = TRUE) Error in (function (classes, fdef, mtable) : unable to find an…

Continue Reading deseq2 problem

GDCprepare of RNAseq counts produces error

GDCprepare of RNAseq counts produces error 1 @76ac7b25 Last seen 12 minutes ago Canada Hello everyone! I have been using the TCGAbiolinks package for the last couple years to access RNAseq data for the TCGA-LAML project. Just very recently, I had noticed that I could no longer use GDCquery to…

Continue Reading GDCprepare of RNAseq counts produces error

Separate exogenous from endogenous transcripts using Salmon RNAseq DTU

Dear friends, We are trying to use Salmon for DTU analysis. We want to separate exogenous from endogenous transcripts by following this post www.biostars.org/p/443701/ and this paper f1000research.com/articles/7-952 We are focusing on a gene called ASCL1 (endo-ASCL1). We transduced cells with lentiviral vector containing ASCL1 ORF only (Lenti-ASCL1). There should…

Continue Reading Separate exogenous from endogenous transcripts using Salmon RNAseq DTU

GDCquery_Maf error

GDCquery_Maf error 0 @76e1237b Last seen 1 day ago Singapore Hi all, I really need some help. I am trying to run GDCquery_Maf which worked fine until yesterday. Now I get the following error: Error in GDCquery(paste0(“TCGA-“, tumor), data.category = “Simple Nucleotide Variation”, : Please set a valid workflow.type argument…

Continue Reading GDCquery_Maf error

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38 1 @b14a6f0d Last seen 16 hours ago United States Are subpopulation MAFs available for gnomADv.3.1.1 with any package, like they are in MafDb.gnomAD.r2.1.hs37d5? I’m trying to use Genomic Scores to obtain all variants in a genomic range with MAF in any subpopulation >= cutoff. I tried…

Continue Reading subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

Bioconductor Package Installation

When I try to install the gtf for hg38 BiocManager::install(“TxDb.Hsapiens.UCSC.hg38.knownGene”) I get the following error: ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.2 (2021-11-01) Installing package(s) ‘TxDb.Hsapiens.UCSC.hg38.knownGene’ Error in readRDS(dest) : error reading from connection Per stackoverflow.com/questions/67455984/getoptionrepos-replaces-bioconductor-standard-repositories-see-reposito I…

Continue Reading Bioconductor Package Installation

Pathway analysis of RNAseq data using goseq package

Hello, I have finished the RNA seq analysis and I am trying to perform some pathway analysis. I have used the gage package and I was looking online about another package called goseq that takes into account length bias. However, when I run the code I get an error. How…

Continue Reading Pathway analysis of RNAseq data using goseq package

Bioconductor – GeuvadisTranscriptExpr

DOI: 10.18129/B9.bioc.GeuvadisTranscriptExpr     This package is for version 3.8 of Bioconductor; for the stable, up-to-date release version, see GeuvadisTranscriptExpr. Data package with transcript expression and bi-allelic genotypes from the GEUVADIS project Bioconductor version: 3.8 Provides transcript expression and bi-allelic genotypes corresponding to the chromosome 19 for CEU individuals from…

Continue Reading Bioconductor – GeuvadisTranscriptExpr

Bioconductor – TAPseq

DOI: 10.18129/B9.bioc.TAPseq     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see TAPseq. Targeted scRNA-seq primer design for TAP-seq Bioconductor version: 3.12 Design primers for targeted single-cell RNA-seq used by TAP-seq. Create sequence templates for target gene panels and design gene-specific primers using…

Continue Reading Bioconductor – TAPseq

Bioconductor – branchpointer

DOI: 10.18129/B9.bioc.branchpointer     Prediction of intronic splicing branchpoints Bioconductor version: Release (3.14) Predicts branchpoint probability for sites in intronic branchpoint windows. Queries can be supplied as intronic regions; or to evaluate the effects of mutations, SNPs. Author: Beth Signal Maintainer: Beth Signal <b.signal at garvan.org.au> Citation (from within R,…

Continue Reading Bioconductor – branchpointer

Bioconductor – txcutr (development version)

DOI: 10.18129/B9.bioc.txcutr     This is the development version of txcutr; for the stable release version, see txcutr. Transcriptome CUTteR Bioconductor version: Development (3.15) Various mRNA sequencing library preparation methods generate sequencing reads specifically from the transcript ends. Analyses that focus on quantification of isoform usage from such data can…

Continue Reading Bioconductor – txcutr (development version)

Bioconductor – r3Cseq

    This package is for version 3.3 of Bioconductor; for the stable, up-to-date release version, see r3Cseq. Analysis of Chromosome Conformation Capture and Next-generation Sequencing (3C-seq) Bioconductor version: 3.3 This package is an implementation of data analysis for the long-range interactions from 3C-seq assay. Author: Supat Thongjuea, MRC Molecular…

Continue Reading Bioconductor – r3Cseq

Bioconductor – derfinder (development version)

DOI: 10.18129/B9.bioc.derfinder     This is the development version of derfinder; for the stable release version, see derfinder. Annotation-agnostic differential expression analysis of RNA-seq data at base-pair resolution via the DER Finder approach Bioconductor version: Development (3.15) This package provides functions for annotation-agnostic differential expression analysis of RNA-seq data. Two…

Continue Reading Bioconductor – derfinder (development version)

identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

GenomicFeatures::makeTxDbFromUCSC failing with an error: identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE 1 @mikhail-dozmorov-23744 Last seen 1 day ago United States Hi,The GenomicFeatures::makeTxDbFromUCSC function fails with: library(GenomicFeatures) > hg19.refseq.db <- makeTxDbFromUCSC(genome=”hg19″, table=”refGene”) Download the refGene table … Error in .fetch_UCSC_txtable(genome(session), tablename, transcript_ids = transcript_ids) : identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE OK The…

Continue Reading identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

Bioconductor – ProteoDisco

DOI: 10.18129/B9.bioc.ProteoDisco     Generation of customized protein variant databases from genomic variants, splice-junctions and manual sequences Bioconductor version: Release (3.14) ProteoDisco is an R package to facilitate proteogenomics studies. It houses functions to create customized (mutant) protein databases based on user-submitted genomic variants, splice-junctions, fusion genes and manual transcript…

Continue Reading Bioconductor – ProteoDisco

How to convert bedgraph file with bins into GRanges object?

You could convert your bedGraph bins from hg18 to hg19 using liftover, so you can overlap them with your peaks. You would read them into a GRanges object, then hand this to the liftover function to translate from hg18 to hg19, then unlist the results to get back a regular…

Continue Reading How to convert bedgraph file with bins into GRanges object?

Bioconductor – interactiveDisplay

    This package is for version 3.2 of Bioconductor; for the stable, up-to-date release version, see interactiveDisplay. Package for enabling powerful shiny web displays of Bioconductor objects Bioconductor version: 3.2 The interactiveDisplay package contains the methods needed to generate interactive Shiny based display methods for Bioconductor objects. Author: Shawn…

Continue Reading Bioconductor – interactiveDisplay

Convertion Of Gff3 To Gtf

Convertion Of Gff3 To Gtf 3 How do I convert GFF file to a GTF file? Is there any tool available? gtf gff • 79k views The easiest way is to use the gffread program that comes with the Cufflinks software suite (Tuxedo) gffread my.gff3 -T -o my.gtf See gffread…

Continue Reading Convertion Of Gff3 To Gtf

Bioconductor – FunciSNP

DOI: 10.18129/B9.bioc.FunciSNP     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see FunciSNP. Integrating Functional Non-coding Datasets with Genetic Association Studies to Identify Candidate Regulatory SNPs Bioconductor version: 3.11 FunciSNP integrates information from GWAS, 1000genomes and chromatin feature to identify functional SNP in…

Continue Reading Bioconductor – FunciSNP

Bioconductor – ChIPComp

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see ChIPComp. Quantitative comparison of multiple ChIP-seq datasets Bioconductor version: 3.4 ChIPComp detects differentially bound sharp binding sites across multiple conditions considering matching control. Author: Hao Wu, Li Chen, Zhaohui S.Qin, Chi Wang Maintainer:…

Continue Reading Bioconductor – ChIPComp

Bioconductor – MotIV

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see MotIV. Motif Identification and Validation Bioconductor version: 3.4 This package makes use of STAMP for comparing a set of motifs to a given database (e.g. JASPAR). It can also be used to visualize…

Continue Reading Bioconductor – MotIV

Bioconductor – Ringo

DOI: 10.18129/B9.bioc.Ringo     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see Ringo. R Investigation of ChIP-chip Oligoarrays Bioconductor version: 3.9 The package Ringo facilitates the primary analysis of ChIP-chip data. The main functionalities of the package are data read-in, quality assessment, data…

Continue Reading Bioconductor – Ringo

Bioconductor – dsQTL

DOI: 10.18129/B9.bioc.dsQTL     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see dsQTL. dsQTL, data excerpt from Degner et al. 2012 Nature letter Bioconductor version: 3.11 dsQTL, excerpt from Degner et al. 2012 Nature letter on DNA variants associated with DnaseI hypersensitivity Author:…

Continue Reading Bioconductor – dsQTL

Bioconductor – fcScan

DOI: 10.18129/B9.bioc.fcScan     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see fcScan. fcScan for detecting clusters of coordinates with user defined options Bioconductor version: 3.12 This package is used to detect combination of genomic coordinates falling within a user defined window size…

Continue Reading Bioconductor – fcScan

Extracting exons and transcripts from gff3/gtf

I was just doing something similar about a week ago. You may be able to accomplish this using the GenomicFeatures R package. First load up the following in R: library(GenomicFeatures) library(GenomicRanges) library(rtracklayer) Then you will need to get the chromosome sizes file, which you can generate with directions from this…

Continue Reading Extracting exons and transcripts from gff3/gtf

Bioconductor – tRNAdbImport

DOI: 10.18129/B9.bioc.tRNAdbImport     Importing from tRNAdb and mitotRNAdb as GRanges objects Bioconductor version: Release (3.13) tRNAdbImport imports the entries of the tRNAdb and mtRNAdb (trna.bioinf.uni-leipzig.de) as GRanges object. Author: Felix G.M. Ernst [aut, cre] Maintainer: Felix G.M. Ernst <felix.gm.ernst at outlook.com> Citation (from within R, enter citation(“tRNAdbImport”)): Installation To…

Continue Reading Bioconductor – tRNAdbImport

Bioconductor – PICS

DOI: 10.18129/B9.bioc.PICS     Probabilistic inference of ChIP-seq Bioconductor version: Release (3.5) Probabilistic inference of ChIP-Seq using an empirical Bayes mixture model approach. Author: Xuekui Zhang <xzhang at stat.ubc.ca>, Raphael Gottardo <rgottard at fhcrc.org> Maintainer: Renan Sauteraud <rsautera at fhcrc.org> Citation (from within R, enter citation(“PICS”)): Installation To install this…

Continue Reading Bioconductor – PICS

Bioconductor – HiTC

DOI: 10.18129/B9.bioc.HiTC     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see HiTC. High Throughput Chromosome Conformation Capture analysis Bioconductor version: 3.9 The HiTC package was developed to explore high-throughput ‘C’ data such as 5C or Hi-C. Dedicated R classes as well as…

Continue Reading Bioconductor – HiTC

install GenomicFeatures fail

install GenomicFeatures fail 1 @5b9023e7 Last seen 19 hours ago China BiocManager::install(‘GenomicFeatures’) results show ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: mirrors.tuna.tsinghua.edu.cn/CRAN/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.0 (2021-05-18) Installing package(s) ‘GenomicFeatures’ also installing the dependencies ‘Rhtslib’, ‘Rsamtools’, ‘GenomicAlignments’, ‘rtracklayer’ Packages which are only…

Continue Reading install GenomicFeatures fail

Bioconductor – GGtools

DOI: 10.18129/B9.bioc.GGtools     This package is for version 3.12 of Bioconductor. This package has been removed from Bioconductor. For the last stable, up-to-date release version, see GGtools. software and data for analyses in genetics of gene expression Bioconductor version: 3.12 software and data for analyses in genetics of gene…

Continue Reading Bioconductor – GGtools

When importing my quant.sf files into R using tximport, should I set ‘ignoreTxVersion’ to True or False?

Hello, I’m working through my first batch of RNA-Seq analysis and unfortunately I don’t have an experienced bioinformatician to work with. My question is regarding tximport of my quant.sf files into R. I have been working with the EquCab3.0 reference transcriptome from NCBI to generate these quant.sf files, but I…

Continue Reading When importing my quant.sf files into R using tximport, should I set ‘ignoreTxVersion’ to True or False?

Bioconductor – SingscoreAMLMutations

DOI: 10.18129/B9.bioc.SingscoreAMLMutations     Using singscore to predict mutations in AML from transcriptomic signatures Bioconductor version: Release (3.13) This workflow package shows how transcriptomic signatures can be used to infer phenotypes. The workflow begins by showing how the TCGA AML transcriptomic data can be downloaded and processed using the TCGAbiolinks…

Continue Reading Bioconductor – SingscoreAMLMutations

To find total genes on favorable chromosome

To find total genes on favorable chromosome 2 How can I find how many genes exist on each chromosome? genes total • 52 views Counting from GENCODE for the vM27 mouse reference: wget ftp.ebi.ac.uk/pub/databases/gencode/Gencode_mouse/release_M27/gencode.vM27.annotation.gtf.gz #/ In R: library(rtracklayer) gtf <- rtracklayer::import(“~/gencode.vM27.annotation.gtf.gz”) table(as.character(seqnames(gtf[gtf$type==”gene”]))) chr1 chr10 chr11 chr12 chr13 chr14 chr15 chr16…

Continue Reading To find total genes on favorable chromosome

Error when trying to import GTF files using rtracklayer’s import function

Error when trying to import GTF files using rtracklayer’s import function 0 I’m trying to use rtracklayer’s import function to import a GTF file. I downloaded the current comprehensive genome annotation for human from GENCODE, gunzipped the .gz file and tried the following: library(rtracklayer) granges <-import(“gencode.v36.annotation.gtf”) I am getting the…

Continue Reading Error when trying to import GTF files using rtracklayer’s import function

Highly used R packages with no Python equivalent

The biggies are obviously DESeq2, limma and edgeR, but they are massive packages doing some very complex statistics, and also have dependency trees that would need to be considered. Depending on your background, you might want to look into the rtracklayer/GenomicRanges eco-system. While I personally am not a fan, I…

Continue Reading Highly used R packages with no Python equivalent