Tag: S4Vectors

lazy loading failed, unable to load shared object rtracklayer.so

Hello! I am working on analyzing a dataset I created with the 10x Chromium Single Cell Multiome kit. In order to add gene annotation to the ATAC data, I am trying to install and use the “EnsDb.Mmusculus.v79” and “BSgenome.Mmusculus.UCSC.mm10” packages with bioconductor. The same ERROR has come up repeatedly whenever…

Continue Reading lazy loading failed, unable to load shared object rtracklayer.so

Bioconductor – MafH5.gnomAD.v3.1.1.GRCh38 (development version)

DOI: 10.18129/B9.bioc.MafH5.gnomAD.v3.1.1.GRCh38     This is the development version of MafH5.gnomAD.v3.1.1.GRCh38; for the stable release version, see MafH5.gnomAD.v3.1.1.GRCh38. Minor allele frequency data from gnomAD version 3.1.1 for GRCh38 Bioconductor version: Development (3.16) Store minor allele frequency data from the Genome Aggregation Database (gnomAD version 3.1.1) for the human genome version…

Continue Reading Bioconductor – MafH5.gnomAD.v3.1.1.GRCh38 (development version)

Bioconductor – SNPlocs.Hsapiens.dbSNP155.GRCh37 (development version)

DOI: 10.18129/B9.bioc.SNPlocs.Hsapiens.dbSNP155.GRCh37     This is the development version of SNPlocs.Hsapiens.dbSNP155.GRCh37; to use it, please install the devel version of Bioconductor. Human SNP locations and alleles extracted from dbSNP Build 155 and placed on the GRCh37/hg19 assembly Bioconductor version: Development (3.16) The 929,496,192 SNPs in this package were extracted from…

Continue Reading Bioconductor – SNPlocs.Hsapiens.dbSNP155.GRCh37 (development version)

Log2FC values slightly higher in some genes after DESeq2 shrinkage

Hi, I have a question about DESeq2 LFCshrinkage: Is it possible that some genes have a slightly higher LFC after shrinkage? It happened during my RNAseq DE analysis, I have very deeply sequenced samples with large base means. I tried visualizing using MAplot check, and it looks fine. I’m mainly…

Continue Reading Log2FC values slightly higher in some genes after DESeq2 shrinkage

extendedSequences length is not the required for DeepCpf1 (34bp)

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

Continue Reading extendedSequences length is not the required for DeepCpf1 (34bp)

Error while installing “object I is not exported by namespace:S4Vectors

met a problem while installing the LTLA/SingleR 1.5.3, urgent, thank you very much for help installing to /home/binf0xx/R/x86_64-pc-linux-gnu-library/4.0/00LOCK-SingleR/00new/SingleR/libs ** R ** inst ** byte-compile and prepare package for lazy loading Error: object ‘I’ is not exported by ‘namespace:S4Vectors’ Execution halted ERROR: lazy loading failed for package ‘SingleR’ removing ‘/home/binf0xx/R/x86_64-pc-linux-gnu-library/4.0/SingleR’ Read…

Continue Reading Error while installing “object I is not exported by namespace:S4Vectors

Error in SummarizedExperiment

I have installed DESeq2 version 1.36.0 samples <- colnames(txi$counts) group <- as.factor(c(“control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”, “control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”,”diet”)) coldata <- data.frame(samples, group, stringsAsFactors = F) coldata <- coldata[,c(“samples”,”group”)] coldata$samples <- factor(coldata$samples) coldata$group <- factor(coldata$group) rownames(coldata) <- sub(“fb”, “”, rownames(coldata)) all(rownames(coldata$samples) %in% colnames(txi)) all(rownames(coldata) == colnames(txi)) TRUE library(DESeq2) ddsTxi <- DESeqDataSetFromTximport(txi, colData = coldata, design =…

Continue Reading Error in SummarizedExperiment

deseq2 problem

deseq2 problem 0 Hi I am trying to draw a PCA plot with DESeq2 but somehow I cannot use DESeq2 functions. It is a really simple code i wil be pasting below. > transform <- DESeq2::rlog(eliminated_data, blind = TRUE) Error in (function (classes, fdef, mtable) : unable to find an…

Continue Reading deseq2 problem

3 arguments passed to .Internal(is.unsorted) which requires 2 #95

Kevinrue I am getting this error, using R 4.2.0 and Bioconductor 3.15: library(scRNAseq) > sce <- HermannSpermatogenesisData() […] Error in ..Internal(is.unsorted(x, FALSE, FALSE)) : 3 arguments passed to .Internal(is.unsorted) which requires 2 I’ve chased the issue down to this line (and the next) github.com/Bioconductor/S4Vectors/blob/338534bfb5fb6ada3f2abc144017bc8ce0aab6c3/R/isSorted.R#L149 That’s as far as I managed…

Continue Reading 3 arguments passed to .Internal(is.unsorted) which requires 2 #95

GDCprepare of RNAseq counts produces error

GDCprepare of RNAseq counts produces error 1 @76ac7b25 Last seen 12 minutes ago Canada Hello everyone! I have been using the TCGAbiolinks package for the last couple years to access RNAseq data for the TCGA-LAML project. Just very recently, I had noticed that I could no longer use GDCquery to…

Continue Reading GDCprepare of RNAseq counts produces error

Separate exogenous from endogenous transcripts using Salmon RNAseq DTU

Dear friends, We are trying to use Salmon for DTU analysis. We want to separate exogenous from endogenous transcripts by following this post www.biostars.org/p/443701/ and this paper f1000research.com/articles/7-952 We are focusing on a gene called ASCL1 (endo-ASCL1). We transduced cells with lentiviral vector containing ASCL1 ORF only (Lenti-ASCL1). There should…

Continue Reading Separate exogenous from endogenous transcripts using Salmon RNAseq DTU

GDCquery_Maf error

GDCquery_Maf error 0 @76e1237b Last seen 1 day ago Singapore Hi all, I really need some help. I am trying to run GDCquery_Maf which worked fine until yesterday. Now I get the following error: Error in GDCquery(paste0(“TCGA-“, tumor), data.category = “Simple Nucleotide Variation”, : Please set a valid workflow.type argument…

Continue Reading GDCquery_Maf error

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38 1 @b14a6f0d Last seen 16 hours ago United States Are subpopulation MAFs available for gnomADv.3.1.1 with any package, like they are in MafDb.gnomAD.r2.1.hs37d5? I’m trying to use Genomic Scores to obtain all variants in a genomic range with MAF in any subpopulation >= cutoff. I tried…

Continue Reading subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

Bioconductor Package Installation

When I try to install the gtf for hg38 BiocManager::install(“TxDb.Hsapiens.UCSC.hg38.knownGene”) I get the following error: ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.2 (2021-11-01) Installing package(s) ‘TxDb.Hsapiens.UCSC.hg38.knownGene’ Error in readRDS(dest) : error reading from connection Per stackoverflow.com/questions/67455984/getoptionrepos-replaces-bioconductor-standard-repositories-see-reposito I…

Continue Reading Bioconductor Package Installation

Bioconductor – cytoKernel

DOI: 10.18129/B9.bioc.cytoKernel     Differential expression using kernel-based score test Bioconductor version: Release (3.14) cytoKernel implements a kernel-based score test to identify differentially expressed features in high-dimensional biological experiments. This approach can be applied across many different high-dimensional biological data including gene expression data and dimensionally reduced cytometry-based marker expression…

Continue Reading Bioconductor – cytoKernel

Pathway analysis of RNAseq data using goseq package

Hello, I have finished the RNA seq analysis and I am trying to perform some pathway analysis. I have used the gage package and I was looking online about another package called goseq that takes into account length bias. However, when I run the code I get an error. How…

Continue Reading Pathway analysis of RNAseq data using goseq package

DESeq2 and high prefiltering cutoff

DESeq2 and high prefiltering cutoff 1 @255004b1 Last seen 3 hours ago United States Hi, I am curious about prefiltering with DESeq2. I understand from this site and reading the DESeq2 vignette that prefiletering is really unnecessary as DESeq2 has a stringent filtering that it does. However, I’m seeing better…

Continue Reading DESeq2 and high prefiltering cutoff

Bioconductor – TAPseq

DOI: 10.18129/B9.bioc.TAPseq     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see TAPseq. Targeted scRNA-seq primer design for TAP-seq Bioconductor version: 3.12 Design primers for targeted single-cell RNA-seq used by TAP-seq. Create sequence templates for target gene panels and design gene-specific primers using…

Continue Reading Bioconductor – TAPseq

Bioconductor – branchpointer

DOI: 10.18129/B9.bioc.branchpointer     Prediction of intronic splicing branchpoints Bioconductor version: Release (3.14) Predicts branchpoint probability for sites in intronic branchpoint windows. Queries can be supplied as intronic regions; or to evaluate the effects of mutations, SNPs. Author: Beth Signal Maintainer: Beth Signal <b.signal at garvan.org.au> Citation (from within R,…

Continue Reading Bioconductor – branchpointer

Bioconductor – atena

DOI: 10.18129/B9.bioc.atena     Analysis of Transposable Elements Bioconductor version: Release (3.14) Quantify expression of transposable elements (TEs) from RNA-seq data through different methods, including ERVmap, TEtranscripts and Telescope. A common interface is provided to use each of these methods, which consists of building a parameter object, calling the quantification…

Continue Reading Bioconductor – atena

Bioconductor – adaptest

DOI: 10.18129/B9.bioc.adaptest     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see adaptest. Data-Adaptive Statistics for High-Dimensional Multiple Testing Bioconductor version: 3.11 Data-adaptive test statistics represent a general methodology for performing multiple hypothesis testing on effects sizes while maintaining honest statistical inference when…

Continue Reading Bioconductor – adaptest

Bioconductor – OGRE (development version)

DOI: 10.18129/B9.bioc.OGRE     This is the development version of OGRE; to use it, please install the devel version of Bioconductor. Calculate, visualize and analyse overlap between genomic regions Bioconductor version: Development (3.15) OGRE calculates overlap between user defined genomic region datasets. Any regions can be supplied i.e. genes, SNPs,…

Continue Reading Bioconductor – OGRE (development version)

Bioconductor – txcutr (development version)

DOI: 10.18129/B9.bioc.txcutr     This is the development version of txcutr; for the stable release version, see txcutr. Transcriptome CUTteR Bioconductor version: Development (3.15) Various mRNA sequencing library preparation methods generate sequencing reads specifically from the transcript ends. Analyses that focus on quantification of isoform usage from such data can…

Continue Reading Bioconductor – txcutr (development version)

traviz 1.0.0 installation fails: ERROR: lazy loading failed

Hi, I cannot install traviz package (version 1.0.0) from Bioconductor on a linux machine (from source). I have a conda environment, and I installed traviz from conda, but it cannot be used – when I do library(traviz) R just crashes and quits without any message. So I tried to install…

Continue Reading traviz 1.0.0 installation fails: ERROR: lazy loading failed

Bioconductor – derfinder (development version)

DOI: 10.18129/B9.bioc.derfinder     This is the development version of derfinder; for the stable release version, see derfinder. Annotation-agnostic differential expression analysis of RNA-seq data at base-pair resolution via the DER Finder approach Bioconductor version: Development (3.15) This package provides functions for annotation-agnostic differential expression analysis of RNA-seq data. Two…

Continue Reading Bioconductor – derfinder (development version)

Bioconductor – TBSignatureProfiler (development version)

DOI: 10.18129/B9.bioc.TBSignatureProfiler     This is the development version of TBSignatureProfiler; for the stable release version, see TBSignatureProfiler. Profile RNA-Seq Data Using TB Pathway Signatures Bioconductor version: Development (3.15) Gene signatures of TB progression, TB disease, and other TB disease states have been validated and published previously. This package aggregates…

Continue Reading Bioconductor – TBSignatureProfiler (development version)

Bioconductor – ChIPQC

    This package is for version 3.1 of Bioconductor; for the stable, up-to-date release version, see ChIPQC. Quality metrics for ChIPseq data Bioconductor version: 3.1 Quality metrics for ChIPseq data Author: Tom Carroll, Wei Liu, Ines de Santiago, Rory Stark Maintainer: Tom Carroll <tc.infomatics at gmail.com>, Rory Stark <rory.stark…

Continue Reading Bioconductor – ChIPQC

identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

GenomicFeatures::makeTxDbFromUCSC failing with an error: identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE 1 @mikhail-dozmorov-23744 Last seen 1 day ago United States Hi,The GenomicFeatures::makeTxDbFromUCSC function fails with: library(GenomicFeatures) > hg19.refseq.db <- makeTxDbFromUCSC(genome=”hg19″, table=”refGene”) Download the refGene table … Error in .fetch_UCSC_txtable(genome(session), tablename, transcript_ids = transcript_ids) : identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE OK The…

Continue Reading identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

Bioconductor – monaLisa

DOI: 10.18129/B9.bioc.monaLisa     Binned Motif Enrichment Analysis and Visualization Bioconductor version: Release (3.14) Useful functions to work with sequence motifs in the analysis of genomics data. These include methods to annotate genomic regions or sequences with predicted motif hits and to identify motifs that drive observed changes in accessibility…

Continue Reading Bioconductor – monaLisa

Bioconductor – ProteoDisco

DOI: 10.18129/B9.bioc.ProteoDisco     Generation of customized protein variant databases from genomic variants, splice-junctions and manual sequences Bioconductor version: Release (3.14) ProteoDisco is an R package to facilitate proteogenomics studies. It houses functions to create customized (mutant) protein databases based on user-submitted genomic variants, splice-junctions, fusion genes and manual transcript…

Continue Reading Bioconductor – ProteoDisco

Design formula in DESeq2

Hello, I am using DESeq2 for analysis of RNAseq data. I would like to ask you about the design in the DESEq2 formula. I have tissue from animals treated with a chemical and my animal model is a colorectal cancer model. My variables are gender (male or female), treatment (treated…

Continue Reading Design formula in DESeq2

Issue with installing QIIME2 2021.11 on Windows 10 – Technical Support

Hi QIIME support team, I’m attempting to install QIIME2 on my Windows 10 machine. I installed Anaconda3, then set up conda to run in Git Bash: echo “. ${PWD}/conda.sh” >> ~/.bashrc Once I restarted Git Bash and activated Conda, I installed python-wget because installation of wget kept getting the following…

Continue Reading Issue with installing QIIME2 2021.11 on Windows 10 – Technical Support

Bioconductor – Rariant

    This package is for version 3.0 of Bioconductor; for the stable, up-to-date release version, see Rariant. Identification and Assessment of Single Nucleotide Variants through Shifts in Non-Consensus Base Call Frequencies Bioconductor version: 3.0 The ‘Rariant’ package identifies single nucleotide variants from sequencing data based on the difference of…

Continue Reading Bioconductor – Rariant

Bioconductor – PhIPData

DOI: 10.18129/B9.bioc.PhIPData     Container for PhIP-Seq Experiments Bioconductor version: Release (3.14) PhIPData defines an S4 class for phage-immunoprecipitation sequencing (PhIP-seq) experiments. Buliding upon the RangedSummarizedExperiment class, PhIPData enables users to coordinate metadata with experimental data in analyses. Additionally, PhIPData provides specialized methods to subset and identify beads-only samples, subset…

Continue Reading Bioconductor – PhIPData

Bioconductor – csaw

    This package is for version 3.2 of Bioconductor; for the stable, up-to-date release version, see csaw. ChIP-seq analysis with windows Bioconductor version: 3.2 Detection of differentially bound regions in ChIP-seq data with sliding windows, with methods for normalization and proper FDR control. Author: Aaron Lun <alun at wehi.edu.au>,…

Continue Reading Bioconductor – csaw

Bioconductor – PAIRADISE

DOI: 10.18129/B9.bioc.PAIRADISE     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see PAIRADISE. PAIRADISE: Paired analysis of differential isoform expression Bioconductor version: 3.9 This package implements the PAIRADISE procedure for detecting differential isoform expression between matched replicates in paired RNA-Seq data. Author: Levon…

Continue Reading Bioconductor – PAIRADISE

Bioconductor – girafe

DOI: 10.18129/B9.bioc.girafe     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see girafe. Genome Intervals and Read Alignments for Functional Exploration Bioconductor version: 3.9 The package ‘girafe’ deals with the genome-level representation of aligned reads from next-generation sequencing data. It contains an object…

Continue Reading Bioconductor – girafe

Bioconductor – NBAMSeq

DOI: 10.18129/B9.bioc.NBAMSeq     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see NBAMSeq. Negative Binomial Additive Model for RNA-Seq Data Bioconductor version: 3.9 High-throughput sequencing experiments followed by differential expression analysis is a widely used approach to detect genomic biomarkers. A fundamental step…

Continue Reading Bioconductor – NBAMSeq

Bioconductor – ALDEx2

DOI: 10.18129/B9.bioc.ALDEx2     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see ALDEx2. Analysis Of Differential Abundance Taking Sample Variation Into Account Bioconductor version: 3.9 A differential abundance analysis for the comparison of two or more conditions. Useful for analyzing data from standard…

Continue Reading Bioconductor – ALDEx2

Bioconductor – VanillaICE

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see VanillaICE. A Hidden Markov Model for high throughput genotyping arrays Bioconductor version: 3.4 Hidden Markov Models for characterizing chromosomal alterations in high throughput SNP arrays. Author: Robert Scharpf <rscharpf at jhu.edu>, Kevin Scharpf,…

Continue Reading Bioconductor – VanillaICE

Bioconductor – FunciSNP

DOI: 10.18129/B9.bioc.FunciSNP     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see FunciSNP. Integrating Functional Non-coding Datasets with Genetic Association Studies to Identify Candidate Regulatory SNPs Bioconductor version: 3.11 FunciSNP integrates information from GWAS, 1000genomes and chromatin feature to identify functional SNP in…

Continue Reading Bioconductor – FunciSNP

Bioconductor – ChIPComp

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see ChIPComp. Quantitative comparison of multiple ChIP-seq datasets Bioconductor version: 3.4 ChIPComp detects differentially bound sharp binding sites across multiple conditions considering matching control. Author: Hao Wu, Li Chen, Zhaohui S.Qin, Chi Wang Maintainer:…

Continue Reading Bioconductor – ChIPComp

Bioconductor – chipseq

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see chipseq. chipseq: A package for analyzing chipseq data Bioconductor version: 3.4 Tools for helping process short read data for chipseq experiments Author: Deepayan Sarkar, Robert Gentleman, Michael Lawrence, Zizhen Yao Maintainer: Bioconductor Package…

Continue Reading Bioconductor – chipseq

Bioconductor – MotIV

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see MotIV. Motif Identification and Validation Bioconductor version: 3.4 This package makes use of STAMP for comparing a set of motifs to a given database (e.g. JASPAR). It can also be used to visualize…

Continue Reading Bioconductor – MotIV

Bioconductor – TBSignatureProfiler

DOI: 10.18129/B9.bioc.TBSignatureProfiler     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see TBSignatureProfiler. Profile RA-Seq Data Using TB Pathway Signatures Bioconductor version: 3.12 Signatures of TB progression, TB disease, and other TB disease states have been created. This package makes it easy to…

Continue Reading Bioconductor – TBSignatureProfiler

Converting between UCSC id and gene symbol with bioconductor annotation resources

You need to use the Homo.sapiens package to make that mapping. > library(Homo.sapiens) Loading required package: AnnotationDbi Loading required package: stats4 Loading required package: BiocGenerics Loading required package: parallel Attaching package: ‘BiocGenerics’ The following objects are masked from ‘package:parallel’: clusterApply, clusterApplyLB, clusterCall, clusterEvalQ, clusterExport, clusterMap, parApply, parCapply, parLapply, parLapplyLB, parRapply,…

Continue Reading Converting between UCSC id and gene symbol with bioconductor annotation resources

Accepted r-bioc-deseq2 1.32.0+dfsg-1 (source) into unstable

—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA512 Format: 1.8 Date: Tue, 14 Sep 2021 00:18:17 +0530 Source: r-bioc-deseq2 Architecture: source Version: 1.32.0+dfsg-1 Distribution: unstable Urgency: medium Maintainer: Debian R Packages Maintainers <r-pkg-t…@alioth-lists.debian.net> Changed-By: Nilesh Patra <nil…@debian.org> Changes: r-bioc-deseq2 (1.32.0+dfsg-1) unstable; urgency=medium . [ Andreas Tille ] * Team Upload. * New…

Continue Reading Accepted r-bioc-deseq2 1.32.0+dfsg-1 (source) into unstable

Bioconductor – ramr

DOI: 10.18129/B9.bioc.ramr     Detection of Rare Aberrantly Methylated Regions in Array and NGS Data Bioconductor version: Release (3.13) ramr is an R package for detection of low-frequency aberrant methylation events in large data sets obtained by methylation profiling using array or high-throughput bisulfite sequencing. In addition, package provides functions…

Continue Reading Bioconductor – ramr

Outliers on DESEq2 Results

I have an RNAseq dataset, where one of the genes I intend to analyze has hundreds of counts ranging from 10 to 12, with a few counts > 9000. I process this data in Deseq2 and get that the gene is differentially expressed across several samples of interest. What can…

Continue Reading Outliers on DESEq2 Results

Bioconductor – conclus

DOI: 10.18129/B9.bioc.conclus     ScRNA-seq Workflow CONCLUS – From CONsensus CLUSters To A Meaningful CONCLUSion Bioconductor version: Release (3.13) CONCLUS is a tool for robust clustering and positive marker features selection of single-cell RNA-seq (sc-RNA-seq) datasets. It takes advantage of a consensus clustering approach that greatly simplify sc-RNA-seq data analysis…

Continue Reading Bioconductor – conclus

Bioconductor – traviz (development version)

DOI: 10.18129/B9.bioc.traviz     This is the development version of traviz; to use it, please install the devel version of Bioconductor. Trajectory functions for visualization and interpretation. Bioconductor version: Development (3.14) traviz provides a suite of functions to plot trajectory related objects from Bioconductor packages. It allows plotting trajectories in…

Continue Reading Bioconductor – traviz (development version)

Bioconductor – tRNAdbImport

DOI: 10.18129/B9.bioc.tRNAdbImport     Importing from tRNAdb and mitotRNAdb as GRanges objects Bioconductor version: Release (3.13) tRNAdbImport imports the entries of the tRNAdb and mtRNAdb (trna.bioinf.uni-leipzig.de) as GRanges object. Author: Felix G.M. Ernst [aut, cre] Maintainer: Felix G.M. Ernst <felix.gm.ernst at outlook.com> Citation (from within R, enter citation(“tRNAdbImport”)): Installation To…

Continue Reading Bioconductor – tRNAdbImport

Bioconductor – marr

DOI: 10.18129/B9.bioc.marr     Maximum rank reproducibility Bioconductor version: Release (3.13) marr (Maximum Rank Reproducibility) is a nonparametric approach that detects reproducible signals using a maximal rank statistic for high-dimensional biological data. In this R package, we implement functions that measures the reproducibility of features per sample pair and sample…

Continue Reading Bioconductor – marr

Bioconductor – PICS

DOI: 10.18129/B9.bioc.PICS     Probabilistic inference of ChIP-seq Bioconductor version: Release (3.5) Probabilistic inference of ChIP-Seq using an empirical Bayes mixture model approach. Author: Xuekui Zhang <xzhang at stat.ubc.ca>, Raphael Gottardo <rgottard at fhcrc.org> Maintainer: Renan Sauteraud <rsautera at fhcrc.org> Citation (from within R, enter citation(“PICS”)): Installation To install this…

Continue Reading Bioconductor – PICS

Bioconductor – scRNAseq

DOI: 10.18129/B9.bioc.scRNAseq     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see scRNAseq. Collection of Public Single-Cell RNA-Seq Datasets Bioconductor version: 3.11 Gene-level counts for a collection of public scRNA-seq datasets, provided as SingleCellExperiment objects with cell- and gene-level metadata. Author: Davide Risso…

Continue Reading Bioconductor – scRNAseq

Bioconductor – DESeq2

DOI: 10.18129/B9.bioc.DESeq2     This package is for version 3.10 of Bioconductor; for the stable, up-to-date release version, see DESeq2. Differential gene expression analysis based on the negative binomial distribution Bioconductor version: 3.10 Estimate variance-mean dependence in count data from high-throughput sequencing assays and test for differential expression based on…

Continue Reading Bioconductor – DESeq2

Bioconductor – GGtools

DOI: 10.18129/B9.bioc.GGtools     This package is for version 3.12 of Bioconductor. This package has been removed from Bioconductor. For the last stable, up-to-date release version, see GGtools. software and data for analyses in genetics of gene expression Bioconductor version: 3.12 software and data for analyses in genetics of gene…

Continue Reading Bioconductor – GGtools

weird MAplot or volcano plot of DESeq2 diff result

Hi, every one. I find a werid MAplot or volcano plot of DESeq reuslt. I am wondering whether you can give me some advice. This diff result is from two cell type bulk RNA-seq. I use two specific marker to get these two cell type using Flow cytometer. I alreadly…

Continue Reading weird MAplot or volcano plot of DESeq2 diff result