Tag: SAM

Provided by: samtools_1.13-2_amd64 NAME samtools reheader – replaces the header in the input file SYNOPSIS samtools reheader [-iP] [-c CMD | in.header.sam ] in.bam DESCRIPTION Replace the header in in.bam with the header in in.header.sam. This command is much faster than replacing the header with a BAM→SAM→BAM conversion. By default…

Unable to convert from sam to bam file. 0 samtools view -S -b BD143_TGACCA_L005.sam -o BD143_TGACCA_L005.bam When I am running this command the following error is appearing: [main_samview] fail to read the header from “BD143_TGACCA_L005.sam”. As a result, if anyone knows how to fix this error and thanks. converting File…

samtools sort 1 I am transforming sam files to bam, to facilitate their ordering I use this command, % cd /Volumes/GENOMA/BWA % samtools sort -n -O V350019555_L03_B5GHUMqcnrRAABA-551.sam | samtools fixmate -m -O bam V350019555_L03_B5GHUMqcnrRAABA-551.bam but it gives me the following error, As elsewhere in samtools, use ‘-‘ as the filename…

PyTorch’s popularity spread only three years after its launch: the open-source ML library posted a 194% user growth in the first half of 2019. Since then PyTorch has not looked back. According to the survey by Stackoverflow, while TensorFlow is the most in-demand library, PyTorch is more preferred. Data from…

HKEY_LOCAL_MACHINE/SECURITY contains information about the machine’s security. Account information, including cached login credentials,, is supposedly stored in the cache. Additionally, the SAM database is also stored here, though it is protected from write access. where does microsoft stores user security information – Related Questions Where does Windows store user information?…

The true power of the state space model is to allow the creation and estimation of custom models.This notebook shows various statespace models that subclass sm. That means your MAGeCK python module is installed in /home/john/.pyenv/versions/2.7.13/lib/python2.7/sitepackages.I use conda to install the latest version of. This twovolume set Diseases and Pathology…

Hi Guys, When I am trying to run bwa mem on multiple processor, I am getting error as : > mpirun -np 16 bwa mem hg19-agilent.fasta R1.fastq R2.fastq | samtools sort -o aln.bam [M::bwa_idx_load_from_disk] read 0 ALT contigs [M::bwa_idx_load_from_disk] read 0 ALT contigs [M::bwa_idx_load_from_disk] read 0 ALT contigs [M::bwa_idx_load_from_disk] read…

Samtools flagstat 1 I aligned my ONT sequencing run with minimap2, subsequently I filtered the file using samtools view -b -F 256 aln_transcriptome_sorted_6.bam -o filtered_aln_transcriptome_6.bam to end up with primary alignments only. When I run samtools flagstat on the filtered file I get the following output: 3502608 + 0 in…

Polygenic Risk Score Calculation: Do we need to apply the same p-value threshold on all 22 chromsomes? 1 Hi there, I am using PRSice-2 to calculate the polygenic risk score for 22 chromosomes one by one. To my understanding, since the 22 chromosomes are independent of each other, and our…

tranfering sam file easy and fast way 0 Hi everyone I was tried to align my fastq files by hisat2 but ı couldnot able done because my computer has 4gb ram and ı get error killed. So ı was perfomed process on my friend computer but now I should solve…

Hello, I’m following the htseq-count tutorial for RNA-seq (counting the overlapping genes and exons) here htseq.readthedocs.io/en/master/tour.html. However, when I get to the point where I need to find the overlaps in the .sam file and .gtf file, I get an error. This is the code I ran originally that gave…

featureCounts output has letters and +/- sign 1 Hello, I have created a featureCounts table and 10 of my files had weird outputs. Some values were my organism name and others were a “+” or “-“. I could not find anything about this in the manual. I tried to re-run…

samtools sorts allocate memory for bam_mem issues 1 Hello everyone ı am trying to convert sam to bam samtools sort -@ 8 -o UHR_Rep1.bam UHR_Rep1.sam and ı got this error samtools sort: couldn’t allocate memory for bam_mem ı check my disk memory and ı see have enough space in my…

[*] I have been trying to follow the GATK Best Practice Workflow for ‘Data pre-processing for variant discovery’ (gatk.broadinstitute.org/hc/en-us/articles/360035535912). This has all been run on Windows Subsystem for Linux 2 on the Bash shell. I started off with FASTQ files from IGSR (www.internationalgenome.org/data-portal) and performed alignment with Bowtie2 (instead of…

BLEND is a mechanism that can efficiently find fuzzy seed matches between sequences to significantly improve the performance and accuracy while reducing the memory space usage of two important applications: 1) finding overlapping reads and 2) read mapping. Finding fuzzy seed matches enable BLEND to find both 1) exact-matching seeds…

Which is @RG read group in the head of bam files? 1 I am not sure which part of the head of bam files is @RG read group. I am curious why all of my samples have the sameA01494:44:H53Y7DMXY:1 part? Are they read groups? samtools view -S Sample_7R-MDV_IGO_09530_H_1_dedup.bam | head…

Hello, I am working with bifacial modules,  To investigate the effect of the distance between the panels on the energy produced, I changed the GCR, expecting this factor to be ineffective for very long distances because it has practically no effect on the shadow, for example for 50 meters, and…

Hello Team, I am not able to test springboot applilcation with AWS lambda in my local using SAM CLI, because it generates classes with very long names , which the SAM Cli is not able to copy tom tmp folder, when deploying as a docker container and I get an…

samtools mpileup error – 1 samples in 1 input files 0 Hi All, I have relatively new to bioinformatics and have encountered an issue when trying to generate an mpileup file with samtools. I have entered the following command samtools mpileup -f /home/path_to_reference/nCoV_Jan31.fa.fasta sorted_sample1.sam > sample.mpileup The message returned is…

How can I make sure certain SNPs are not removed during the clumping stage of PRS calculation using PRSice 1 This is a two part question. First, when implementing PRSice, is there a way to make sure certain SNPs are retained for the PRS calculation? I basically want to avoid…

Attempting to generate a bam.bai file but the output is not readable 1 Hi, I am new a exome sequencing, and have tried to follow tutorials on the subject. I am stuck at the samtools index stage because the output files are in a non-human readable format and I believe…

(ERR): hisat2-align died with signal 6 (ABRT) (core dumped) 0 Hi, run hisat2 ,I encountered an error. hisat2-build -p 10 ~/public_data/genome/Pt_V1.0.fa genome 1>hisat2-build.log 2>&1 ~/software/hisat2-2.2.0/hisat2 -x genome -1 ~/data/clean/NC1_5_clean_R1.fastq.gz -2 ~/data/clean/NC1_5_clean_R2.fastq.gz -S NC1_5.sam 1>NC1_5.log 2>&1 cat NC1_5.log terminate called after throwing an instance of ‘std::bad_alloc’ what(): std::bad_alloc (ERR): hisat2-align died…

BBSplit ambiguous dataset analysis 1 I have used bbsplit to split a metagenomic dataset into reads mapping to three genomes a, b, c. bbsplit.sh in1={fastq_1} in2={fastq_2} ref={ref_str} ambiguous2=split basename={out_path}out_split_%.sam If I want to identify which ambiguous reads align to ‘a’ and any other genome – is this only ‘ambiguous_a’? or…

I’ve got sequencing data for a small 500 bp amplicon from a few samples. GATK best principles suggest running VariantRecalibrator on the GVCF files I generate. I’m trying to get this working, but I get an error about “Found annotations with zero variances”. Reading the gatk manual and other posts…

Why single cell R2 fastq have no read identified by bowtie2 ? 0 When we input R2 fastq.gz into bowtie2, human sequence was not removed ( ${base}_host_removed is zero). for i in $(find ./ -type f -name “.fastq.gz” | while read F; do basename $F | rev | cut -c…

I’ve managed to define a template for a Lambda behind an API GW authenticated via (dedicated) ApiKey by describing everything in the template and with no OpenApi definition. The problem arises when trying to introduce Lambda Integrations for accomplishing the mappings: it seems that they can be defined only in…

htseq-count Error ‘_StepVector_Iterator_obj’ object has no attribute ‘next’ 0 I am trying to run htseq-count (v. 0.13.5) on a sorted and indexed bam file. The command I entered looks like this: htseq-count -f bam -r pos -s yes -t CDS -i gene_id -m union filename_sorted.bam filename.gtf I get the following…

Inscripta was founded in 2015 and recently launched the world’s first benchtop Digital Genome Engineering platform. The company is growing aggressively, investing in its leadership, team, and technology with a recent $150mm financing round led by Fidelity and TRowe price. The company’s advanced CRISPR-based platform, consisting of an instrument, reagents,…

Hello, I’m following the htseq-count tutorial for RNA-seq (counting the overlapping genes and exons) here htseq.readthedocs.io/en/master/tour.html. However, when I get to the point where I need to find the overlaps in the .sam file and .gtf file, I get an error. This is the code I ran originally that gave…

I have written a Nextflow script with three process: The first process takes a pair of fastq files and aligns with reference genome. The process writes the resulting SAM file into sam channel. Second process takes input from the sam channel and creates a BAM file from it, and writes…

Count 5’End Mapped To A Specific Genomic Position 7 I got several SAM/BAM files, and I am interested in 5’ends of the mapped reads. Is there any tools or scripts to count how many 5’ends are mapped at a specific genomic position? N.B. I am not try to count the…

Chunk JavaScript is disabled on your browser. All Implemented Interfaces: java.io.Serializable, java.lang.Cloneable, java.lang.Comparable<Chunk> public class Chunk extends java.lang.Object implements java.lang.Cloneable, java.io.Serializable, java.lang.Comparable<Chunk> A [start,stop) file pointer pairing into the BAM file, stored as a BAM file index. A chunk is represented as a single 64-bit value where the high-order 48…

**AMENDMENT TO EXTEND SOLICITATION DATE ** This is a combined synopsis/solicitation for services in which the government intends to acquire in accordance with FAR Part 13, Simplified Acquisitions Procedures. Department of Commerce (DOC), National Oceanic & Atmospheric Administration (NOAA), National Marine Fisheries Service (NMFS), Alaska Fisheries Science Center, Auke Bay…

converting Bam to fastq while removing clipping(hard/soft clip bases) 0 Hello, I want to do some analysis and my raw data is paired-end reads fastq files. So far: I used BWA mem to convert them to Sam file then used samtools to convert to BAM file. My next step is…

(ERR): bowtie2-align died with signal 24 (XCPU) (core dumped) 0 Hi all, it is my first time using bowtie2, and I have a problem. I conducted the following command for reads mapping: bowtie2 -q –local -x mm10 -U SRR5839956_trimmed.fq -S SRR5839956.sam It created a 600MB sam file then come with…

How to extract unique mapped results from Bowtie2 bam results? I used samtools view -bq 1 WG.bam > unique.bam However, my results contain 54792 lines, why it is not 42097?   After I have the subset of those reads, how can I extract them from sam or bam file to create a…

Dnaman software manual DNADynamo DNA Sequence Analysis SoftwareCLC Genomics Workbench – Qiagen They have sent a man to locate the key. He was making notes with a slim gold pen on a Gucci pad? When I married my husband, that all…

INTRODUCTION Large-scale annual migrations occur in an extraordinary range of animals, from insects to the great whales. While the driving mechanisms of these migrations are varied and sometimes poorly understood, they often represent a way of optimizing conditions for breeding and adult fitness when these are in conflict. Often, populations…

Align fastq SOLiD data 1 Hello everyone, I have downloaded some data from the short read archive using the sratoolkit. The data is SOLiD data. I have seen people using the Lifescope (Life Technologies) to align the reads, as I presume it works for this type of data. But unfortunately,…

PRS using PGS Catalog 1 When using PRSice for PRS calculation of target data using a file of variants from the PGS catalog, does the variant file from the PGS catalog replace the GWAS summary statistics (referred to as “base data” in the tutorial)? I had previously found this similar…

PRS in UK Biobank – no covariate file and no phenotype file 1 Hi there, I am trying to undertake a PRS using UK Biobank plink data. I am trying to generate a PRS using PRSice-2. However, the issue I am having is that I do not have a covariate…

Samtools – [main_samview] fail to read the header 1 Hi everyone, I’m attempting to convert a SAM file to a BAM file using the following command: samtools view -S -b test.sam > test.bam However, I’m getting the error [main_samview] fail to read the header (see figure). The figure attached shows…

bamdst gives error “EOF marker is absent. The input is probably truncated.” 0 I created a set of bam files from Poolseq data using bwa -aln, and all of the output files gave the following error when I ran bamdst to get summary statistics on read depth: “EOF marker is…

Error in merged bam files 0 Hello I am trying to merge unmapped and mapped bam files. I merged the bam files using the picard tool (gatk.broadinstitute.org/hc/en-us/articles/360036883871-MergeBamAlignment-Picard). I checked the merged bam using ValidateSamFile command (gatk.broadinstitute.org/hc/en-us/articles/360036854731-ValidateSamFile-Picard-) and it showed the below errors: Error Type Count ERROR:MATES_ARE_SAME_END 5496 ERROR:MISMATCH_FLAG_MATE_NEG_STRAND 5478 ERROR:MISMATCH_MATE_CIGAR_STRING…

Thinking about launching a SAM program or purchasing a new SAM tool? Learn how to avoid the top 5 common mistakes that buyers encounter when implementing a SAM tool. Software Asset Management was introduced to me many years ago when a dear…

There is a common misconception that Software Asset Management (SAM) tools can completely mitigate your risk of a costly and disruptive audit. In fact, studies show zero correlation between having a SAM tool in place and whether you will end up paying audit fees or how much you will ultimately…

Validation in new sample 0 Hi Sam, I am trying to validate in a new sample a PRS I conceived by PRSice. I would like to ask if using snp_prs function (bigsnpr package in R) is a good way for that or should I use another tool or method. Best…

Segemehl -D option doesnt work for allowing differences 0 I am trying to map short some specific short reads (19~20nts) against long reads of a fasta file (F1.fasta). I used Segemehl tool and indexed the F1.fasta file (long reads) and then used the command line below to perform the alignment:…

samtools mpileup fail to create bcf 1 I have indexed my reference.fasta using bowtie2: bowtie2-build reference.fasta reference.fasta created the bam file form the sam file using samtools, sorted and indexed the bam file: samtools view -S -b Sample1_mapped.sam > Sample1_mapped.bam samtools sort Sample1_mapped.bam -o Sample1_sorted > Sample1_sorted.bam samtools index Sample1_sorted.bam…

This is a combined synopsis/solicitation for commercial items prepared in accordance with the format in subpart 12.6, as supplemented with additional information included in this notice. This announcement constitutes the only solicitation; proposals are being requested and a written solicitation will not be issued.                 (ii) The solicitation number and a…

As a novice to this community (and technology) I have only a basic knowledge regarding how to build and deploy a docker so i was hoping someone could provide some help. The situation is the following: I wanna create a docker container with two conda environments and I wanna call…

How to extract all sequences mapped to a transcript from Kallisto output 0 I ran Kallisto with the –pseudobam option. How do I extract all the short reads that are mapped to a single transcript (e.g. ENST00000367969.8)? As a person without any previous SAM/BAM experience, I tried the following things…

I was just doing something similar about a week ago. You may be able to accomplish this using the GenomicFeatures R package. First load up the following in R: library(GenomicFeatures) library(GenomicRanges) library(rtracklayer) Then you will need to get the chromosome sizes file, which you can generate with directions from this…

Tech giant Cisco has pledged to reach net-zero emissions for operations by 2025 and the supply chain by 2040, while healthcare research and solutions firm Illumina has set a 2050 target. Cisco’s new targets involve reaching net-zero for Scope 1 (direct)…

In a 2014 interview with Lossip, the girl group couldn’t help but gush about Grande and how amazing of a friend she is. Food blogger Alexa Luria (born December 25, 1993) is an American food blogger. Ariana Grande. This is in a large format, it’s appropriate for all ages. So…

Problem with BAM file headers 2 Hello Everyone, I have noticed an issue with my BAM file headers, where the @RG line is either mal-formed or is missing entirely. I think I can sed the files that are mal-formed, and add the sample names necessary to complete my further analyses…

SCENIC-openloom not working 0 I have been trying to open a loom file which was produced by converting seurat object to loom.Using the following command: loom <- open_loom(loomPath) It is showing the following error : Error in H5File.open(filename, mode, file_create_pl, file_access_pl) : It is not possible to open the file….

how to replace a list of headers in fasta file that are not in order 0 That is how my fasta file looks like: >monCan3F9-B-G1795-Map9 TTTATTATACCCTGAACCCATTAAAA(multiple lines) >monJX13F48-L-B718-Map1 AAAATTAATTCAGAATTATGTTTG(multiple lines) . . . the list of new names are not in the same order as in the fasta file, so…

Hisat2 error 1 Hi all I am using this command. hisat2 -p 8 -q -X ${READDIR}/hisat2_index_Cm_genome -1 ${READDIR}/tr.p.UE-2955-CMLib1_S88_L004_R1_001.fastq.gz -2 ${READDIR}/tr.p.UE-2955-CMLib1_S88_L004_R2_001.fastq.gz -S ${Output}/UE-2955-CMLib1.sam Error: Encountered internal HISAT2 exception (#1) Need a help to fix this problem. thanks Hisat2 • 24 views It is a lowercase x, so -x for the index….

Summary At Solvuu, we are building technology to revolutionize bioinformatics and data science. We are seeking an accomplished, self-motivated and ambitious bioinformatics engineer with a strong track record in developing, executing, and maintaining bioinformatics pipelines on AWS for biotech R&D. The successful candidate will have the opportunity to drive and…

The samtools view outputs information from SAM and BAM files in SAM format. You can find a description of the SAM format here: samtools.github.io/hts-specs/SAMv1.pdf Section 1.4 deals with the meaning of each of the manditory coloumns. It includes the following table: Col Field Type Regexp/Range Brief description |—|——|——-|—————————-|—————————————-| 1 QNAME…

Aligning Multiple paired end files together 1 Hi All, I have 72 paired end .fastq file for which i need to do Alignment using BWA. Since its a paired end data and my files are named as sam_001_1.fastq sam_001_2.fastq sam_002_1.fastq sam_002_2.fastq & so on Since its a paired end data…

Truncating alignments in a SAM/BAM file 0 Hi everyone, I am interested in narrowing or truncating the alignment of reads in SAM or BAM formatted files by X NTs from each end. My reason is that the detection of indels is a bit muddied by a percentage of reads reaching…

CHICAGO – Canadian startup BugSeq Bioinformatics has devised a method of detecting pathogens via metagenomic nanopore sequencing that the company says is more accurate and sensitive than PCR and microbial cultures. Notably, the technology does not need to target specific pathogens like PCR and microbial culture tests must. The firm…

hisat2 alignment showing 0% aligned but sam file is 6GB in size. 0 Hello, I am trying to align my fastq files with the reference genome assembly (MRSA ATCC 33591). The sam file formed is some 5-6 GB in size whereas hisat2 output is showing 0.0% alignment rate. I am…

Ok, let’s go through it. The -f 0x2 bitwise flag selection keeps proper pairs, which are read pairs mapped in correct orientation (I suppose illumina reads facing each other) and within insert size (-X and -I) -> concordantly. Now, if you want the uniquely mapped, you should basically exclude all…

How to analyze the generated VCF file, what to do if you have multiple VCF file for the same gene? 0 I have given 40 tumor samples to NGS for the analysis and I gave them a list of specific genes only do the sequencing for lets call that gene…

How can I extract base and read name based on position from bam file? 0 Hello. Sadly, I can’t not use English well…. I want to make primer for many cultivar of my subject. In my primer position, there are two bialleic SNP. ex) …..A/C……….C/G…….. I think reason of this…

Credit: DOI: 10.1126/science.abk2718 Researchers from the group of Stan Brouns (Delft University of Technology) have discovered a new CRISPR-Cas system that cuts RNA. The study will be published on August 26 in Science and is expected to offer many opportunities for the development of new applications in genetic research and…

Abstract A critical challenge for microbiology and medicine is how to cure infections by bacteria that survive antibiotic treatment by persistence or tolerance. Seeking mechanisms behind such high survival, we developed a forward-genetic method for efficient isolation of high-survival mutants in any culturable bacterial species. We found that perturbation of…

Using inspiration from this thread HISAT2 output direct to bam, I’m attempting to run this command. The shell variables in this case represent paths to files/locations that make sense and in fact this command runs fine on my Ubuntu 18.04 LTS server using hisat 2.1 and samtools 1.10 (this seems…

PRSice “command not found” 0 Hi all, When running PRSice (version 2.3.3), I got the “command not found” for the commands: –perm –thread –binary-target T How to make these commands working. Best regards, Redha Command • 17 views • link updated 1 hour ago by Sam &starf; 3.7k • written…

featureCounts: unable to find chromosome in SAM header 0 I am using featureCounts to try and create a count table for some RNA-Seq data I collected using an Oxford Nanopore platform. I have .sam files aligned with minimap2, and am running the following command to try to get a count…

install GenomicFeatures fail 1 @5b9023e7 Last seen 19 hours ago China BiocManager::install(‘GenomicFeatures’) results show ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: mirrors.tuna.tsinghua.edu.cn/CRAN/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.0 (2021-05-18) Installing package(s) ‘GenomicFeatures’ also installing the dependencies ‘Rhtslib’, ‘Rsamtools’, ‘GenomicAlignments’, ‘rtracklayer’ Packages which are only…

Tool:GRIDSS: the Genomic Rearrangement IDentification Software Suite 0 GRIDSS is typically used for detecting structural variation breakpoints from short read sequencing data but is a modular software suite containing a number of tools useful for the detection of genomic rearrangements including: A structural variant caller. The GRIDSS caller uses break-end…

How to align and visualize data with .fasta and .gff3 files in IGV? 1 Hi everyone, I have an issue in aligning and visualizing my data in IGV. As I read in manual of IGV, to align and visualize data, I need to to prepare .BAM/.SAM or other input format…

Significance Class A penicillin-binding proteins (aPBPs) assemble the bacterial cell wall and are the targets of penicillin and related β-lactam antibiotics. In gram-negative bacteria, the aPBPs require outer membrane lipoproteins to function. However, little is known about how these proteins promote the activity of their cognate synthases in cells. Here,…

phase_trio.sh | searchcode PageRenderTime 24ms CodeModel.GetById 16ms app.highlight 5ms RepoModel.GetById 1ms app.codeStats 0ms /Phase/phase_trio.sh github.com/BioinformaticsArchive/fCNV Shell |…

Bwa sampe error 999 25-08-2021 I’m getting the following error message when I try to import into 1aa.vremenagoda54.ru file (using samtools import). [samopen] SAM header I’m using bwa aln to find coordinates and bwa sampe to…

Ask questionssamtools sort not working Hi There, I just found a new issue: samtools sort output is not sorted. Seems it did not do anything. The content is still the same as the unsorted bam or sam files. Here is how I tested it: Upload a sam file 2.sam; samtools…

Exctracting amino acid substitutions 0 Good day, I’m trying to develop a pipeline to determine mutations which are responsible for amino acid changes in genes associated with antibiotic resistance. I have roughly 300 bacrtial isolates. My approach so far has not been fruitful, in short this is what i tried:…

htseq-count returns : does not contain a ‘gene’ attribute 1 Dear BIOSTAR community, I’m trying to make count matrix with htseq-count, htseq-count -s yes -t gene -i gene 01.sorted.sam annotation_cattle.gff > 01.txt even with –idattr=gene , it returns error: Error processing GFF file (line 1864255 of file annotation_cattle.gff): Feature gene-D1Y31_gp1…

samtools returns error – cigar and query sequence are of different length even though cigar and query sequence are the same length 1 I have written a program in python that processes and outputs mapped results as either a bam or sam file. It works fine until I have indels…

Vcfutils error code 20-08-2021 code at line (I think) just to get it to write a proper fq. Second issue is this error: substr outside of string at /usr/local/bin/object91.ru line We can do this in a single…

Name Last modified Size Description Parent Directory   –   bam.c 2011-11-02 14:12 10K   bam.h 2011-11-02 14:12 24K   bam_aux.c 2011-11-02 14:12 4.1K   bam_endian.h 2011-11-02 14:12 1.0K   bam_import.c 2011-11-02 14:12 14K   bam_index.c 2011-11-02 14:12 20K   bam_lpileup.c 2011-11-02 14:12 4.9K   bam_maqcns.c 2011-11-02 14:12 20K  …

Hi, You get a bam (machine readable sam) file after mapping, and it contains information about mapped and unmapped reads. To get the unmapped reads from a bam file use: samtools view -f 4 file.bam > unmapped.sam the output will be in sam to get the output in bam, use:…

How to calculate the Average Insert Size after mapping the reads to the reference genome using BWA 3 Hi, Having mapped the reads to the reference genome using BWA, I am trying to calculate their Average Insert Size. Thereafter, I converted the BAM file to SAM file in order to…

I am trying to run DESeq2 using gene counts generated by HTSeq-Count. I combine files for different conditions: directory <- “~/GeneCountFiles/” WT_Files <- c( “P0CTRS3.aligned.sam.genecount”, “P0CTRS4.aligned.sam.genecount”, “P0CTRS5.aligned.sam.genecount” ) KO_Files <- c( “P0CTRS1.aligned.sam.genecount”, “P0CTRS2.aligned.sam.genecount”, “P0CTRS6.aligned.sam.genecount” ) I then create the sample table: sampleTable <- data.frame( sampleName=c(WT_Files, KO_Files), fileName=c(WT_Files, KO_Files), genotype=c(rep(“WT”, length(WT_Files)),…

TopHat error: IOError [errno 2] No such file or directory: ‘-o’ 2 Hello everyone. I’m now running tophat in our server. First, I just simply tried “tophat -p 8 -G <gtf_file> <ref_genome> <fa1><fa2>” and it worked. Then I wrote a for loop scripts but It reported error: [2019-04-03 10:49:16] Beginning…

How to remove reads mapped to both plasmid and chromosome from the .sam file? 0 I have a .sam file with reads mapped to a plasmid and a bacterial chromosome. I used bowtie to map reads and I allowed multi-mapping. How can I exclude reads which were aligned to both…

Convert Sam To Bigwig Convert BAM into bigwig for chicken Hi, I used functions of “Create a BedGraph of genome coverage” and “Wig/BedGraph-to- … Source link

HISAT2: Question regarding providing file path to indexed genome folder 0 hisat2 -p 1 -x hisatIndex/genome.fa –dta –rna-strandness RF -1 $R1 -2 $R2 -S genome.sam(ERR): “hisatIndex/genome.fa” does not exist Exiting now … this error showing up every time i run the code and I dont know what is the problem…

PLINK ASSOC understanding the results 1 Hello to all, I have 10 vcf files – 5 female fish and 5 male fish I have merged all 10 fish to one vcf file.(all_fish.vcf) I performed the plink association analysis on all 10 fish with the command: -noweb –const-fid –allow-no-sex –allow-extra-chr –pheno…

Alignment using bwa-mem2 0 Hello I need help in aligning the sequence with reference using bwa-mem2. I used the following code: bwa-mem2 mem -t 8 gch38.fa DE98NGSUKBD117612_1_1.fq DE98NGSUKBD117612_1_2.fq > d3_align.sam I got the following error: ERROR! Unable to open the file: gch38.fa.bwt.2bit.64 There is no gch38.fa.bwt.2bit.64 file. I have the…

How to check which genes affect a continuous phenotype 1 I want to test which genes affect a change in a condition. The condition is measured on a continuous scale. The data comes from micro-arrays and there are two batch effects to be accounted for. I thought of performing a…

hisat2 compatibility for long read 0 Hi, I am trying to align PacBio transcriptome reads against the genome to count the gene number. For pair end read i used the following workflow: # convert gff to gtf /home/software/cufflinks-2.2.1/gffread xxx.gff -T -o xxx.gtf # build index /home/software/hisat2-2.2.1/hisat2_extract_exons.py xxx.gtf > xxx.exon /home/software/hisat2-2.2.1/hisat2_extract_splice_sites.py…