Tag: SAM
Twilio unveils CustomerAI; expands Google Cloud partnership
Twilio unveils CustomerAI ahead of SIGNAL, its upcoming user and developer conference, and simultaneously expands on its long-standing partnership with Google Cloud. Debuting in a new video, Twilio’s CustomerAI couples the power of large language models (LLMs) with the rich customer data that flows through Twilio’s Customer Engagement Platform to…
Reading same BAM file twice with htslib
I would like to read iteratively the same BAM file twice using htslib. My option is to use hts_open, sam_hdr_read, then sam_read1 as much as needed to read the file until EOF. Is there a possibility to “rewind”, and use sam_read1 again from the beginning of the file, without closing…
Bioinformatics Analyst III job with US Tech Solutions
Job Description Job Description and title: Bioinformatics analyst 3 month contract with possibility of extension Typically between 9AM-5PM Central Time. We have an exciting contract opportunity for a Bioinformatics analyst/programmer to support the Emerging Technology Group in GRC. Primary responsibility include providing analysis support for running standard pooled CRISPR screening…
MetaGenomics Market 2023 Dynamics, SWOT Analysis and Business Forecast to 2029:F. Hoffmann-La Roche, PerkinElmer, Thermo Fisher Scientific, The MITRE Corporation, Quest Diagnostics
MetaGenomics Market Scope: According to MarketInsightsReports, the MetaGenomics market is expected to achieve the greatest growth between 2023 and 2029. The focus of this MetaGenomics market intelligence report is based on skilled research insights and complete MetaGenomics market dynamics to focus on current trends, industry financial overview, and historical data evaluation. The company profile is based on…
Sexual differentiation in human malaria parasites is regulated by competition between phospholipid metabolism and histone methylation
Drakeley, C., Sutherland, C., Bousema, J. T., Sauerwein, R. W. & Targett, G. A. T. The epidemiology of Plasmodium falciparum gametocytes: weapons of mass dispersion. Trends Parasitol. 22, 424–430 (2006). Article PubMed Google Scholar Kafsack, B. F. C. et al. A transcriptional switch underlies commitment to sexual development in malaria…
hisat2 Error 137
hisat2 Error 137 0 hi every body, I am running hisat2 with below command: hisat2 –dta -x /home/genetics/apps/Proj/Index/hg38/genom -1 SRR11573854_1P -2 SRR11573854_2P -S SRR11573854.sam -p 4 and I face this error: Killed (ERR): hisat2-align exited with value 137 could you help me to solve this problem? Thank you very much…
Filtering mitochondrial reads from ATAC-Seq aligned reads- what to do with reads that have MT in RNEXT field
Hi all, I am trying to filter mitochondrial reads from my ATAC-seq data after trimming with Trimmomatic and then aligning with Bowtie2. After searching through many pipelines, I have found 2 ways that people often do this (both using inputs that are sorted and indexed BAM files): 1) with samtools…
Recombinant Enterobacter sp. 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
货号: CSB-YP394376EIZ 规格: 来源: Yeast 其他: 货号: CSB-EP394376EIZ 规格: 来源: E.coli 其他: 货号:…
Recombinant Human Probable 28S rRNA (cytosine(4447)-C(5))-methyltransferase(NOP2),partial
货号: CSB-YP015938HU 规格: 来源: Yeast 其他: 货号: CSB-EP015938HU 规格: 来源: E.coli 其他: 货号:…
Reads with highest MAPQ values from SAM files are showing mismatches to reference sequence and IGV classified them as supplementary reads
Hi all, I am expressing a GFP synonymous variant library in human cells and sequencing its RNA on the nanopore and I am having some trouble analysing the data. Initially, I basecalled all the fast5 files using the super accuracy model in the guppy basecaller, then I discarded the reads…
Not annotated metagenome-assembled genomes recovered from rumen samples from cows
Protozoa comprise a major fraction of the microbial biomass in the rumen microbiome, of which the genera Entodinium has been consistently observed to be dominant across a diverse genetic and geographical range of ruminant hosts. Despite the apparent core role that species such as Entodinium caudatum exert, their greater…
Building Dict File for GATK
Building Dict File for GATK 4 I’m going through the instructions page on gatkforums.broadinstitute.org/gatk/discussion/1601/how-can-i-prepare-a-fasta-file-to-use-as-reference Specifically, the command I don’t see how to do is: java -jar CreateSequenceDictionary.jar R= Homo_sapiens_assembly18.fasta O= Homo_sapiens_assembly18.dict [Fri Jun 19 14:09:11 EDT 2009] net.sf.picard.sam.CreateSequenceDictionary R= Homo_sapiens_assembly18.fasta O= Homo_sapiens_assembly18.dict [Fri Jun 19 14:09:58 EDT 2009] net.sf.picard.sam.CreateSequenceDictionary done….
Bioinformatics Analyst II (Remote) Position In North Chicago , IL
Job Description To discuss more about this job opportunity, please reach out to Chitrank Rastogi (LinkedIn URL – www.linkedin.com/in/chitrank-rastogi-55119a102/), email your updated resume at Email – chitrank.rastogi@collabera.com or give me a call at (425) 523-1648. Thank you! Job Description:Job Roles & Responsibilities: We have an exciting contract opportunity for a…
Recombinant Human Probable dimethyladenosine transferase(DIMT1)
货号: CSB-EP892161HU 规格: 图片: 其他: 产品详情 纯度: Greater than 90% as determined by SDS-PAGE. 基因名: DIMT1 Uniprot No.: …
the monitor in mcallen, texas obituaries
If you are interested in reading The Monitor McAllen Texas obituaries, you can find them online or in the print edition of the newspaper. Learn About Online Memorials 269 talking about this. I was honored to have known Jeannie while living and growing up in McAllen. Mrs. Stroud, may you…
Beware of the AI Bubble Burst: Experts
Last week, Bank of America’s chief investment strategist Michael Hartnett warned us of a looming AI bubble. AI is this year’s investment craze and even though the profit potential is huge, this period could go the messy dot-com burst way, stated the Bank of America representative. On the other hand,…
Inside Google’s Effort To Use AI To Make ASL Accessible To All
Google is harnessing AI tech to help make ASL more accessible to everyone Google Images Earlier this year, Bay Area-based Google put together a competition intended to use artificial intelligence in decode sign language in real time. According to Google, the goal of the competition is to “classify isolated American…
Active Recombinant Human FGFR2 protein, GST-tagged FGFR2-18H
Home / Products / Recombinant Proteins / Active Recombinant Human FGFR2 protein, GST-tagged Active Recombinant Human FGFR2 protein, GST-tagged Online Inquiry FGFR2 Related Products By Species By Source By Tag Price Inquiry Welcome! For price inquiries, please feel free to contact us…
Building Serverless APIs with OpenAPI , Sat, Jun 24, 2023, 10:15 AM
This is an in-person, hands-on workshop where you will learn how to design and build serverless RESTful APIs using the API-first design or API-first approach with the OpenAPI version 3 specification. This approach allows you to design and document your API before writing any code, thereby improving communication and agility…
minimap’s SAM file MAPQ value for the unique alignments
minimap’s SAM file MAPQ value for the unique alignments 0 Hi, I have mapped my reads from nanopore RNAseq to the reference database using the minimap. Minimap SAM files have MAPQ values from 0 to 60 in the fifth column. While 0 indicates the reads that can possibly map to…
sorting BAM file
sorting BAM file 0 I tried sorting the BAM file i created using gatk-package-4.2.5.0-local.jar SortSam the code is : java -jar gatk-package-4.2.5.0-local.jar SortSam -I {path.bam} -O {path.sorted.bam} -SO coordinate but i encountered this error: INFO: Failed to detect whether we are running on Google Compute Engine. [Tue May 30 16:08:32…
VR | VSAM/SAM FILE I/O TUNER
What are the primary challenges that VELOCI-Raptor addresses? The primary challenges faced by data centers are the need to reduce batch processing time, the need and ability to meet service level agreements, the requirement to maximize system performance without extensive programming changes and the ability to determine system-wide impact of…
htslib-1.15.1-2.fc38 – Fedora Packages
htslib-1.15.1-2.fc38 – Fedora Packages ↵ Return to the main page of htslibView buildSearch for updates Package Info (Data from x86_64 build) Changelog Dependencies Provides Files Changelog Date Author Change 2023-01-19 Fedora Release Engineering <releng at fedoraproject dot org> – 1.15.1-2 – Rebuilt for fedoraproject.org/wiki/Fedora_38_Mass_Rebuild 2022-08-15 John Marshall <jmarshall at hey…
Bioconductor – CompGO
DOI: 10.18129/B9.bioc.CompGO This package is deprecated. It will probably be removed from Bioconductor. Please refer to the package end-of-life guidelines for more information. This package is for version 3.13 of Bioconductor. This package has been removed from Bioconductor. For the last stable, up-to-date release version, see CompGO. An…
ABySS Process Killed
ABySS Process Killed 0 Hi everyone! Name is Sam and I’d like to ask for help on my contig assembly using ABySS. I’ve been trying to assemble a contig from paired sequences using ABySS in WSL. I started with a basic script as follows: abyss-pe k=21 B=2G name=A1k21 in=’A1_1.fastq A1_2.fastq’…
Exploring Tumor Biomarkers in Urothelial Carcinoma: Insights and Advancements in Bladder Cancer Research
Read the Full Video Transcript Sam Chang: Hello everyone. My name is Sam Chang. I’m a urologist in Nashville, Tennessee and work at Vanderbilt University Medical Center. And we’re quite fortunate to have Dr. Chad Ritch from the University of Miami. I’ve known Chad a long time. He’s an associate…
Mapping fewer reads to a genome graph than a linear reference
I am seeing a 5-10% reduction in reads mapped to a genome graph compared to a linear reference of the same genome sequence. I have two graphs: one is the reference genome decorated with 5 million SNPs and the other is an empty graph created with vg using the reference…
pytorch geometric dgcnn
package manager since it installs all dependencies. (defualt: 5), num_electrodes (int) The number of electrodes. I plugged the DGCNN model into my semantic segmentation framework in which I use other models like PointNet or PointNet++ without problems. This commit does not belong to any branch on this repository, and may…
Deferentially expressed gene with high log2foldchange by DESeq2; but not meaningful at the individual level
Hi all, I am working with the RNA-Seq data on human (24Cases-20 controls) to find differentially expressed genes. my RNA-Seq data is unstranded. Here is the comments that I used to align the fastq files: ls *_1P.fastq.gz | parallel –bar -j8 ‘R2=$(echo {} | sed s/_1/_2/) && out=$(echo {} |…
Ubuntu Manpage: removeDup – Remove duplicated reads
Provided by: subread_2.0.0+dfsg-1_amd64 NAME removeDup – Remove duplicated reads USAGE removeDup [options] -i <input_file> -o <output_file> Required arguments: -i <string> Name of input file in SAM/BAM format. -o <string> Name of output SAM file including filtered reads. The format is BAM unless ‘-S’ is specified. Optional arguments: -S Generate the…
Mindlance hiring Bioinformatics Analyst in United States
Title- Bioinformatics Analyst Duration-3months with extension Location-Remote Description: We have an exciting contract opportunity for a Bioinformatics analyst/programmer to support the Emerging Technology Group in GRC. Primary responsibility include providing analysis support for running standard pooled CRISPR screening data and differential expression analysis of bulk RNAseq data, and performing…
NanoSim Error “Please specify the training reads and its reference genome!”
NanoSim Error “Please specify the training reads and its reference genome!” 1 Hi, I installed nanosim using conda install -c bioconda nanosim and then tried to run the read characterization using read_analysis.py transcriptome -i training_reads.fastq -r reference_genome.fa -rt reference_transcriptome.fa -annot reference_annotation.gtf -o training. However, I get the following error: Please…
samtools installed but error message: Library not loaded: @rpath/libcrypto.1.0.0.dylib
samtools installed but error message: Library not loaded: @rpath/libcrypto.1.0.0.dylib 1 I would like to convert input.sam to output.bam but I get following error message: kk$ samtools view -bS input.sam > output.bam dyld[88970]: Library not loaded: @rpath/libcrypto.1.0.0.dylib Referenced from: /Users/kk/opt/anaconda3/bin/samtools Reason: tried: ‘/Users/kk/opt/anaconda3/bin/../lib/libcrypto.1.0.0.dylib’ (no such file), ‘/Users/kk/opt/anaconda3/bin/../lib/libcrypto.1.0.0.dylib’ (no such file), ‘/usr/local/lib/libcrypto.1.0.0.dylib’…
VS-Bioinformatics Analyst (Remote) – Rangam Infotech Private Limited
“Applicants must be authorized to work for ANY employer in the U.S. We are unable to sponsor or take over sponsorship of an employment Visa at this time.” Remote 3 month contract with possibility of extension We have an exciting contract opportunity for a Bioinformatics analyst/programmer to support the Emerging…
Things Phase 4 Did Perfectly
The one-two punch of Avengers: Infinity War and Avengers: Endgame firmly established the Marvel Cinematic Universe (MCU) as the biggest movie franchise in the world. What helped make the films among the biggest box-office hits ever is that they were the grand culmination of a decade’s worth of storytelling, as…
Help: LitScan
# Total IDs searched 9,648,246 IDs being used by LitScan 8,939,826 Unique RNA sequences 4,497,573 Articles found 865,179 RNAcentral LitScan is a new text mining pipeline that connects RNA sequences with the latest open access scientific literature. LitScan uses a collection of identifiers (Ids), gene names, and synonyms provided to…
Growth Medium 1S – Nordic Biosite
Additional Information This liquid Growth Medium is a complete medium optimized to culture select BPS Bioscience cell lines. Optimized for Use With: CRISPRa (SAM) HeLa Cell Line (BPS Bioscience, #78193), CRISPRa (SAM) HepG2 Cell Line (BPS Bioscience, #78194) Article No BPS-78221 Country Availability SE, FI, DK, NO, IS, EE, LV,…
Recombinant Saccharopolyspora erythraea rRNA adenine N-6-methyltransferase(ermE)
货号: CSB-YP362098STB 规格: 来源: Yeast 其他: 货号: CSB-EP362098STB 规格: 来源: E.coli 其他: 货号:…
Dell’s Project Helix Is a Wide-Reaching Generative AI Service
Dell and NVIDIA joined forces to put generative AI into the hands of Dell’s software-as-a-service customers. Image: Yingyaipumi/Adobe Stock Project Helix will be Dell’s first foray into artificial intelligence for its edge software service, Dell Technologies Senior Vice President of Product Marketing Varun Chhabra announced as part of a preview…
Recombinant Erwinia carotovora subsp. atroseptica 23S rRNA (guanosine-2′-O-)-methyltransferase RlmB(rlmB)
货号: CSB-YP738437EAAB 规格: 来源: Yeast 其他: 货号: CSB-EP738437EAAB 规格: 来源: E.coli 其他: 货号:…
Decoding MM and ML tags in .SAM file
Hi all, I am trying to decode the SAM MM and ML tags read by read and create a table of methylation locations on that read. For example, from an aligned sam file: Nanopore_Sequence_Example 4 * 0 0 * * 0 0 GTTATGTAACCTACTTGGTTCCATTACGTATTGCTGGTGCTGAAGATTGTAGGTGTCTTTGTGCAGAGTGTATGATATACACGGCGGTGCTGAAGAAAGTTATTGCGGGTGTATTTGTGCAGAAGTATATGATGTGCGCGGGCGGAGGTGCTGAAGAAAGTTGTCGGTGTCTTTGTGCAGAAGTATATGATGGCGAGGTGTTGAAGAAAGTTGTCGGTGTCTTTGTGCAGAAGTATATGATGTGCGCGGGCGGATCCGCCCGCGCATCCTTCTGCGCAAT “&+*+*)$#$%’&&’)%&'(,)))*1555:>B@7777BBCD10.*.%%&)$$$*14//0.,.-..'(%(%&”..211–‘$$%&+))56<;;998:44892.-,+)(‘&*)’&&((,++/0064:385566;>A>=6@<@AA?;:::=>>?==7=?@=<>>;BA@??@?=:;;;7011+,,).-,++++-&$$%)(,)*,)$%'(((&&'(&&%%%&+0///20877656??BAA@@ABBEFGC>=57793222532110,50-++$$$%&),,,+()) rl:i:0 MM:Z:C+h?,5,5,0,1,1,0,0,1,2,0,2,0,0,1,2,0,4;C+m?,5,5,0,1,1,0,0,1,2,0,2,0,0,1,2,0,4; ML:B:C,159,6,135,2,7,9,3,4,13,11,6,22,6,1,2,2,218,0,4,19,1,2,7,4,1,0,1,4,15,11,2,1,0,0 I’m trying to…
Bioinformatics Software Engineer – Urgent Hiring jobs by Tesa Research in
We are hiring a confident Bioinformatics Software Engineer to join our diverse team at TESA Research in Park City, UT.Growing your career as a Full Time Bioinformatics Software Engineer is a fantastic opportunity to develop relevant skills.If you are strong in people management, cooperation and have the right mindset for…
Detroit Lions to Begin Phase 3 of Offseason Program
The Detroit Lions are ready to kick off the third phase of the NFL offseason as they commence their OTAs (Other Team Activities) this week. These non-contact practice sessions will take place on Tuesday, Wednesday, and Thursday at the team’s facility in Allen Park. As the team enters this crucial…
Recombinant Acinetobacter baumannii 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
货号: CSB-YP536423AWP 规格: 来源: Yeast 其他: 货号: CSB-EP536423AWP 规格: 来源: E.coli 其他: 货号:…
ChIP-Seq
ChIP-Seq Input Data (Reference Feature) LiftOver LiftOver option] body=[We provide on-the fly lift-over of reference data sets between different genome assemblies for broader comparison among annotations.]”> : Upload custom Data File Format] body=[All ChIP-seq tools use SGA (Simplified Genome Annotation) files as an internal working format. SGA intput…
Where to watch Taylor vs Cameron in Canada today
Get ready for an electrifying showdown as the boxing world anticipates an epic clash inside Dublin’s 3Arena. Stepping into the ring is the renowned and undefeated champion, Katie Taylor, boasting an impressive record of 22 wins and zero losses. Holding titles in The Ring, WBA, WBC, IBF, and WBO, Taylor…
Solved 12) You and your research partner Sam have been
Transcribed image text: 12) You and your research partner Sam have been working to understand how treatment with PFAS affects plant growth. You treated your seeds with water (control sample) or with PFAS. You repeated your experiment twice, one week apart, and completed your RNAseq study, and have started analysis….
CRISPR Therapeutics Stock: Hold Until A Firmer Decision Date (NASDAQ:CRSP)
Artur Plawgo/iStock via Getty Images CRISPR Therapeutics (NASDAQ:CRSP) is a large (~$5 billion market cap) gene editing company developing gene-based medicines using its proprietary clustered regularly interspaced short palindromic repeats and the CRISPR-associated protein 9 (CRISPR/Cas9) platform. On April 3, they completed the rolling Biologics License Applications (BLAs) to the…
Metagenomi Swiftly Variegates Gene-Editing Palatte
Despite the rapid development of genetic medicines, Simon Harnest, chief investment officer and SVP strategy at Metagenomi, said that attending the annual ASGCT meeting is a good way to keep tabs on the industry. “There are so many specialized groups in gene editing, some that focus on base editing and…
What is CRISPR? – BBC Science Focus Magazine
The CRISPR-Cas9 tool is sometimes described as a ‘wanted’ poster that’s hung in an organism’s immune system. On this is the likeness of a virus, teaching the immune system to recognise the potential invader. Vaccines of various kinds are designed to do the same job: to give your immune system…
Microbiome Sequencing Services Market Production, Revenue, Price, Trend, Size and Growth Analysis 2032
The Microbiome Sequencing Services Market Size, Scope, and Forecast 2023-2032 report has been added to the Market research collection of Quince Market Insights. Industry experts and researchers have offered an authoritative and concise analysis of the Microbiome Sequencing Services Market with respect to various aspects such as growth factors, challenges, restraints, developments, and opportunities for growth. This…
Babraham Bioinformatics – FastQC A Quality Control tool for High Throughput Sequence Data
FastQC Function AMPERE quality control tool for elevated throughput sequence data. Your Java What A match Java Runtime Ecology This Picard BAM/SAM Libraries (included in download) Code Maturation Robust. Mature code, but feedback exists comprehended. Code Released No, under GPL v3 or later. Initial Contact Simon Andrews Download Now Views…
filter reads in BAM having a tag
filter reads in BAM having a tag 3 Anyone has a simple solution for filtering reads in a BAM/SAM file having a certain TAG? This came up trying to filter out reads from 10x without a proper CB tag defined (which is causing troubles in downstream analysis tools). I’m surprised…
Fast BAM header editing
Fast BAM header editing 2 I would like to change some information in the BAM header (specifically, chromosome size information). Is there a smarter/faster way to do this without extracting to an intermediate SAM file and remaking the BAM file from the edited SAM file? bam • 94 views You…
CABANA workshop: Advanced RNAseq and network analysis in genomics
This course will provide training on RNAseq data production and interpretation. The course starts with a brief introduction to RNA-seq and discusses quality control issues. Next, we will present the alignment step, quantification of expression and differential expression analysis. We will dedicate some time to analysing and constructing networks from…
Answer: Estimate sizes of repeats in a especific Gene
Tell me if I’m in the way. I have the CRAM file and the respective CRAI (index). So I just ran the SAM like this, clipping my area of interest: > $ samtools view -b NG1PSZ7BE9.mm2.sortdup.bqsr.cram “chrX:147912050-147912110” > result.bam Then I indexed the .bam file: > $ samtools index result.bam…
The Glue of Genomics: Will Science’s Unsung Data Heroes Abandon Academia?
Advances in the last twenty years of genomics have turbocharged our ability to decode DNA and other nucleic acids. At the turn of the century, the Human Genome Project completed a 13-year journey to produce the first complete human genome at a great financial cost. In 2023, genome sequencing is a routine…
amazon web services – How to add policy to aws sam file to put value in secrets mangaer with mabda
Policies: – AWSXrayWriteOnlyAccess – AWSSecretsManagerGetSecretValuePolicy: SecretArn: !Sub – AWSSecretsManagerRotationPolicy: SecretArn: !Sub arn:${AWS::Partition}:secretsmanager:${AWS::Region}:${AWS::AccountId}:secret:/${EnvironmentTagName}/* Effect: Allow FunctionName: !Sub ${AWS::StackName}-**** Action: – secretsmanager:UpdateSecret – secretsmanager:GetSecretValue – secretsmanager:PutSecretValue Resource: I want to change secrets value by lambda , but I got this error:- AccessDeniedException: User: arn:aws:sts:::assumed-role/LambdaName is not authorized to perform: secretsmanager:PutSecretValue on resource:…
How to load inidividual ADT and RNA data to the same AnnData structure
How to load inidividual ADT and RNA data to the same AnnData structure 0 High guys, I’m a beginner using scanpy. I’m trying to load som CITE-seq data but only find how to use the “sc.read_10x_h5” function which demands a 5h file. The data I want to load is in…
Animal Genetics Market Size, Growth Analysis Forecast Report 2023-2032
Exclusive Updated Report by Quince Market Insights: Animal Genetics Market The global animal genetics market is estimated to be worth of USD 8.53 Billion in 2023 and is growing at a CAGR of 5.8% during the forecast period from 2023 to 2032. The animal genetics market has seen consistent growth in…
Microsoft bets that a fusion power plant from Helion Energy will be operating this decade
Microsoft agreed to buy electricity from a fusion power plant being developed by Helion Energy. Helion said the plant will be online by 2028, sooner than scientists thought fusion would be viable. Fusion energy doesn’t produce the greenhouse gas emissions that are fueling the climate crisis. The timeline for pumping…
Integrated microbiome-metabolome-genome axis data of Laiwu and Lulai pigs
Animal rearing and samples collection Our experiment was designed to compare eight female Laiwu pigs (LW) with eight female Lulai pigs (LU) which crossbred between LW and Yorkshire breeds. All pigs were born and raised for approximately two years (715 ± 33 days, Table 1) under uniform housing and feeding conditions at Jing-Qi-Shen…
Racon empty output (non-memory issue)
Racon empty output (non-memory issue) 1 Hello, I’ve been trying to run Racon for the first time on one ONT metagenomic dataset (here) Each time I try to run it, with or without the specified options, it runs very quickly with no errors and spits out an empty file. What…
samtools and Rsamtools in r
samtools and Rsamtools in r 2 Hello, How can I use Rsamtools, so I can import the results from a bam file. E.g. if I use samtools view sample.bam > sample.sam I can import this sam file easily into R. However, if I run Rsamtools, and do something like input_bam…
Gluconeogenic enzyme PCK1 supports S-adenosylmethionine biosynthesis and promotes H3K9me3 modification to suppress hepatocellular carcinoma progression
doi: 10.1172/JCI161713. Online ahead of print. Dongmei Gou 1 , Rui Liu 1 , Xiaoqun Shan 1 , Haijun Deng 1 , Chang Chen 2 , Jin Xiang 1 , Yi Liu 1 , Qingzhu Gao 1 , Zhi Li 3 , Ailong Huang 4 , Kai Wang 4 , Ni Tang 1 Affiliations Expand Affiliations 1 Institute for Viral Hepatitis,…
Two New York Genome Center research teams selected as grant recipients
NEW YORK, NY (May 11, 2023) – The National Institutes of Health (NIH) Common Fund has selected the New York Genome Center (NYGC) as a multi-grant recipient under the Somatic Mosaicism across Human Tissues (SMaHT) Network. NEW YORK, NY (May 11, 2023) – The National Institutes of Health (NIH) Common Fund…
Two New York Genome Center research teams sel
image: NYGC Logo view more Credit: New York Genome Center NEW YORK, NY (May 11, 2023) – The National Institutes of Health (NIH) Common Fund has selected the New York Genome Center (NYGC) as a multi-grant recipient under the Somatic Mosaicism across Human Tissues (SMaHT) Network. The awarded grants will fund two…
NewBiologix Launches with $50M to Advance Novel Technology Platform for the Manufacturing of Gene and Cell Therapies
– Co-founded by cell line development pioneers, Igor Fisch and Nicolas Mermod – New state-of-the-art facility designed explicitly for gene and cell therapy development – Supported by world-class scientific advisory board LAUSANNE, Switzerland–(BUSINESS WIRE)–NewBiologix SA emerged from stealth today as a technology innovation company developing a proprietary and breakthrough platform…
No differentially expressed genes after multiple testing correction in mice
No differentially expressed genes after multiple testing correction in mice 0 Hi all, I am working with the RNA-seq data on mice (group A N=3 vs group B N=3). Mice are littermates, of which group A overexpresses a human transgene which I verified. I have had .cram files from mouse…
How Secret Invasion Connects MCU Phases 3 & 5 According To Sam Jackson
Samuel L. Jackson shares how Secret Invasion ties Marvel Cinematic Universe’s Phase 3 and 5. The Infinity Saga wrapped up almost four years ago, and Marvel Studios has been focused on building the Multiverse Saga. Secret Invasion, however, will revisit the tail end of the Infinity Saga, and connect it…
KEGG ENZYME: 2.1.1.308
Entry EC 2.1.1.308 Enzyme Name cytidylyl-2-hydroxyethylphosphonate methyltransferase;Fom3;S-adenosyl-L-methionine:methylcob(III)alamin:2-hydroxyethylphosphonate methyltransferase (incorrect);2-hydroxyethylphosphonate methyltransferase (incorrect) Class Transferases;Transferring one-carbon groups;MethyltransferasesBRITE hierarchy Sysname S-adenosyl-L-methionine:cytidine 5′-{[hydroxy(2-hydroxyethyl)phosphonoyl]phosphate} C-methyltransferase Reaction(IUBMB) 2 S-adenosyl-L-methionine + cytidine 5′-{[hydroxy(2-hydroxyethyl)phosphonoyl]phosphate} + reduced acceptor = S-adenosyl-L-homocysteine + 5′-deoxyadenosine + L-methionine + cytidine 5′-{[hydroxy(2-hydroxypropyl)phosphonoyl]phosphate} + oxidized acceptor [RN:R12497] Reaction(KEGG) Substrate S-adenosyl-L-methionine [CPD:C00019]; cytidine 5′-{[hydroxy(2-hydroxyethyl)phosphonoyl]phosphate} [CPD:C22216]; reduced acceptor [CPD:C00030]…
IJMS | Free Full-Text | Engineering Human Cells Expressing CRISPR/Cas9-Synergistic Activation Mediators for Recombinant Protein Production
1. Introduction Peptides are employed for a multitude of therapeutic approaches and can be obtained from the native organ or tissue in which they are produced as well as through recombinant methods where nucleic acids encoding a candidate gene(s) are delivered to and expressed in cells in vitro. As an…
Chan Zuckerberg ID Makes Strides in Enabling Pathogen Identification From Metagenomic Data
NEW YORK – A free, cloud-based data analysis platform to identify pathogens and other microbes from sequencing data dubbed Chan Zuckerberg ID (CZ ID) has been making inroads with infectious disease researchers around the world. The platform, developed by the Chan Zuckerberg Initiative and first released in 2019, recently added…
Software Asset Management Tools Market Size Investigation Report 2023-2030 by Absolute Reports in Information & Communication Technology , Information Technology Industry
PRESS RELEASE Published May 7, 2023 [101] pages Software Asset Management Tools market report is segmented by geographical regions (Europe, Asia Pacific, Latin America, Middle East & Africa), manufactures (Company 1, Company 2, Company 3, Company 4, Company 5, Company 6, Company 7, Company 8, Company 9, Company 10, Company…
Insert Size Metrics of ATAC-Seq data
Insert Size Metrics of ATAC-Seq data 2 I have paired-end sequencing data from ATAC-Seq and the fastq files had nextera adaptors. So I trimmed them the following way: trim_galore –paired –nextera ${names[${SLURM_ARRAY_TASK_ID}]}_R1.fastq ${names[${SLURM_ARRAY_TASK_ID}]}_R2.fastq Then did Bowtie bowtie2 -p 4 -q –very-sensitive -x genome -1 ${names[${SLURM_ARRAY_TASK_ID}]}_R1_val_1.fq -2 ${names[${SLURM_ARRAY_TASK_ID}]}_R2_val_2.fq -S “${names[${SLURM_ARRAY_TASK_ID}]}”_aln_unsorted.sam While…
Invalid Contig error when using bamfile.fetch
Invalid Contig error when using bamfile.fetch 0 Hey all, I am new to using Pysam module in vs code. I am having issues getting my code to work. So I have two files: first is a CSV that I imported as pandas df and it has two columns: chromosome and…
DNA-based Data Storage Platform Market Aims to Expand
DNA-based Data Storage Platform Market The process of using DNA molecules as a storage medium is well known as deoxyribonucleic acid (DNA) data storage. In this process, there is encoding and decoding of binary data onto and from synthesized strands of DNA. The DNA data is encoded into DNA nucleotide…
base modifications tags in SAM file
Hi everyone ! I’m currently working on parsing SAM file to extract methyllation site from a nanopore sequencing. According to the SAM documentation, it’s possible thanks to MM:Z and ML:B:C tags. You can find bellow, a read, the MM:Z and ML:B:C tags extracted from my SAM file: TGATCGCGCGGACCTGTTCTACCAGGTAGGTCACCGGGTCAAATGATATTTTGATGGTGTTGGACACCACCGTCTGGCTGGCGCTCAGGGTGCCGGAGTTCAGAGCGTAGATGAATGTCTCAAACGCGGAGGATTTCTCGCCTCCCAGCATGTAAATTGGCCACTGCAGGGCGCTGCTCTTGTCAGTATAGCGGAAATGTATGGGGAGCGGCATATTTCGTTAAGGACGGTTGCAATGGCTACCCCAGAATCTTGGCTGCTGTTGCCTTCGACCGCCGCGTTCACGCGCTCAATTGTGGGGTGGAGCACAGCGATCGCTGAAGCGGCGCACGAAAAACGCGAAAGCGTTTCACGATAAATGCGAAAACCACAAAGACACCGACAACTTTCTTCGAGCAAATTCACCTACGCCAGCAACTGAACGAAGTAC MM:Z:C+m?,1,2,1,0,1,1,0,1,0,0,0,1,2,0,9,0,0,0,0,0,10,2,1,7,4,8,3,0,3,4,4,4,9,6,0,0; ML:B:C,234,246,49,84,5,0,11,228,254,0,0,2,8,1,3,1,1,0,146,0,10,0,1,115,19,0,167,19,0,121,21,9,188,112,93,6…
Unable to extract unmapped reads from sam file – MetaPhlAn
Hi,We used MetaPhlAn version 4.0.4 to perform taxonomy profiling using the lastest vOct22 marker database. It worked well on the majority of our samples but there were 90% unclassified reads for 2 samples. It maybe because of the sample conditions but we were curious about the unclassified reads and wanted…
Ovid buys big stake in Waksal company to pursue brain treatments
Over glasses of Chablis at Fleming by Le Bilboquet in Manhattan, two longtime friends and biotech lifers hashed out the deal that will bring their wending and colorful careers back together after three decades. Jeremy Levin, the professorial executive who has become one of the industry’s loudest voices on matters…
RNA SEQ reads assembly for illumina sequenced data
RNA SEQ reads assembly for illumina sequenced data 0 Hi, everyone, I have 10 samples paired end . I have done the quality check and trimming then I merged the trimmed reads and after that I have done the mapping using minimap2. using this command . minimap2 -ax map-ont ref.fna(reference…
Brain cell type deconvolution
Brain cell type deconvolution 2 Hi all! I am interested in understanding the % of main cell types composing my bulk RNA-seq data from brain (e.g., astrocytes, microglia, neurons, oligodendrocytes). However, from what I gathered, this appears to be an extremely complicated task. I came across CiberSortX, but I couldn’t…
ERROR using CIBERSORTx Docker version
ERROR using CIBERSORTx Docker version 0 Dear Biostars, I have been working with the web version and the docker version of CIBERSORTx. However, I have been getting a very strange result in the docker version, and I don’t know what I am doing wrong. Even using the same data and…
What statistical test to apply for DE after CibersortX deconvolution
What statistical test to apply for DE after CibersortX deconvolution 0 I am running CibersortX in high-resolution mode (which yields estimates of gene values per sample). After that, I want to perform DE between two conditions on the resulting gene estimates. What statistical test would one need to apply to…
RNA-DNA interactomes of three prokaryotes uncovered by proximity ligation
Cell strains E. coli DH5α and B. subtilis 168 strains were grown overnight in Luria-Bertani broth at 37 °C and 180 rpm to a final OD600 ~1.7. B. subtilis strain 168 was kindly provided by Dr. S.A. Dubiley (Institute of Gene Biology, Russian Academy of Sciences, Moscow, Russia). T. adornatum strain…
UniProt: A0A6P8XQ90_DROAB
ID A0A6P8XQ90_DROAB Unreviewed; 717 AA. AC A0A6P8XQ90; DT 02-DEC-2020, integrated into UniProtKB/TrEMBL. DT 02-DEC-2020, sequence version 1. DT 22-FEB-2023, entry version 9. DE SubName: Full=RUN and FYVE domain-containing protein 2 isoform X5 {ECO:0000313|RefSeq:XP_034113470.1}; GN Name=LOC117574004 {ECO:0000313|RefSeq:XP_034113470.1}; OS Drosophila albomicans (Fruit fly). OC Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; OC…
How to convert SAM/BAM file to GTF/GFF file?
How to convert SAM/BAM file to GTF/GFF file? 1 Hello, Curious to know if there’s a way to convert SAM/BAM file generated using minimap2 to GTF/GFF file. The purpose is to use it as transcript alignment evidence for EVM. Kindly suggest! Regards, B GTF SAM BAM GFF minimap2 • 32…
Nextflow process for samtools sort and variant calling
Nextflow process for samtools sort and variant calling 2 Hi everybody ! I’m currently try to learn nextflow scripting. I’m a novice and I just begin with a script in order to sort and convert a SAM file to a BAM file and then call variants thanks to a reference…
Fastqs different lanes
Fastqs different lanes 1 Can anyone please confirm the following. You should generate sam/bams with read groups for downstream analysis (GATK) If you have fastqs from the same sample run over different lanes of the flowcell these would have different read groups Therefore you should keep the fastqs seperate, align…
bash – Issue With Script To Remove Manta Limitations
I keep getting an interesting error from a relatively small script I wrote in a .sh file. I developed a script to deal with 3 limitations Manta has. The limitations are quoted below Alignments cannot have an unknown read sequence (SEQ=”*”) Alignments cannot contain the “=” character in the SEQ…
Multi-mapping read adjacency in alignment tool outputs
Multi-mapping read adjacency in alignment tool outputs 0 Hello friends, I often work with SAM/BAM formatted short read alignments in a context where it is beneficial to know all alignments for each read rather than best/primary/secondary. My question: Among short read alignment tools and their configurations, is there ever a…
Licorice extract inhibits the cGAS-STING pathway and protects against non-alcoholic steatohepatitis
doi: 10.3389/fphar.2023.1160445. eCollection 2023. Affiliations Expand Affiliations 1 School of Pharmacy, Chengdu University of Traditional Chinese Medicine, Chengdu, China. 2 Department of Hepatology, The Fifth Medical Center of PLA General Hospital, Beijing, China. 3 Military Institute of Chinese Materia, Fifth Medical Center of Chinese PLA General Hospital, Beijing, China. 4…
Expected number of haplotype IDs per path in PHG
Expected number of haplotype IDs per path in PHG 0 Hello! I have recently managed to run the Pathfinding step of the Practical Haplotype Graph pipeline (see here; PHG v1.4). With this I now wanted to get the calculated best path, i.e. the list of haplotype IDs that are part…
Counting number of start positions from SAM file that fall between start and stop coordinates of an exon that belongs to a gene in the GTF file
Deleted:Counting number of start positions from SAM file that fall between start and stop coordinates of an exon that belongs to a gene in the GTF file 0 Hi, sorry if this a stupid question but I am struggling to figure it out. I am working in Python. I have…
Overlap File for RACON Genome Polisher
Overlap File for RACON Genome Polisher 0 This seems like a dumb question, but I have no idea how to generate an overlap file that is required for RACON. According to the documentation: github.com/isovic/racon Racon takes as input only three files: contigs in FASTA/FASTQ format, reads in FASTA/FASTQ format and…
“.sam” file – should it contain multiple samples?
“.sam” file – should it contain multiple samples? 1 Hi. I feel like this might be a stupid question, but I can’t seem to find an answer anywhere. I’m currently trying to align my paired-end reads to a reference genome. To do this, I believe I need to create a…
10 Biggest Changes Phase 4 Made To The MCU
The Marvel Cinematic Universe‘s first three phases were the Infinity Saga, a sweeping storyline that assembled the Avengers and introduced the six Infinity Stones before Thanos seized them to change the universe forever. Phase 3 ended with Thanos’ final defeat, throwing the doors to Phase 4 and beyond open. RELATED:…
Why Phase 3 of the MCU was a turning point in Marvel history
The Marvel Cinematic Universe has become a cultural phenomenon, captivating audiences with its thrilling action sequences, charismatic heroes, and intricate storylines. But the third phase of the MCU genuinely set the franchise apart. From the introduction of new heroes to the epic conclusion of beloved character arcs, Phase 3 was…
Blue Earth Diagnostics Highlights Upcoming Presentation of Additional Results from Investigational Phase 3 SPOTLIGHT Study of PET Imaging Agent 18F-rhPSMA-7.3 in Biochemical Recurrence of Prostate Cancer
− Results to be presented at American Urological Association’s 2023 Annual Meeting (AUA2023) – MONROE TOWNSHIP, N.J. & OXFORD, England, April 19, 2023–(BUSINESS WIRE)–Blue Earth Diagnostics, a Bracco company and recognized leader in the development and commercialization of innovative PET radiopharmaceuticals, today announced the presentation of additional results from its…
New Drug Boosts Stem Cell Transplant for Multiple Myeloma
The standard treatment for patients with multiple myeloma often includes stem cell transplantation in which the patient’s own stem cells are harvested and stored while the patient receives intensive chemotherapy to kill the cancer. Then, the patient’s stem cells are returned to the patient to help with recovery. But for…