Tag: SAM

Twilio unveils CustomerAI; expands Google Cloud partnership

Twilio unveils CustomerAI ahead of SIGNAL, its upcoming user and developer conference, and simultaneously expands on its long-standing partnership with Google Cloud. Debuting in a new video, Twilio’s CustomerAI couples the power of large language models (LLMs) with the rich customer data that flows through Twilio’s Customer Engagement Platform to…

Continue Reading Twilio unveils CustomerAI; expands Google Cloud partnership

Reading same BAM file twice with htslib

I would like to read iteratively the same BAM file twice using htslib. My option is to use hts_open, sam_hdr_read, then sam_read1 as much as needed to read the file until EOF. Is there a possibility to “rewind”, and use sam_read1 again from the beginning of the file, without closing…

Continue Reading Reading same BAM file twice with htslib

Bioinformatics Analyst III job with US Tech Solutions

Job Description Job Description and title: Bioinformatics analyst 3 month contract with possibility of extension Typically between 9AM-5PM Central Time. We have an exciting contract opportunity for a Bioinformatics analyst/programmer to support the Emerging Technology Group in GRC. Primary responsibility include providing analysis support for running standard pooled CRISPR screening…

Continue Reading Bioinformatics Analyst III job with US Tech Solutions

MetaGenomics Market 2023 Dynamics, SWOT Analysis and Business Forecast to 2029:F. Hoffmann-La Roche, PerkinElmer, Thermo Fisher Scientific, The MITRE Corporation, Quest Diagnostics

MetaGenomics Market Scope:  According to MarketInsightsReports, the MetaGenomics market is expected to achieve the greatest growth between 2023 and 2029. The focus of this MetaGenomics market intelligence report is based on skilled research insights and complete MetaGenomics market dynamics to focus on current trends, industry financial overview, and historical data evaluation. The company profile is based on…

Continue Reading MetaGenomics Market 2023 Dynamics, SWOT Analysis and Business Forecast to 2029:F. Hoffmann-La Roche, PerkinElmer, Thermo Fisher Scientific, The MITRE Corporation, Quest Diagnostics

Sexual differentiation in human malaria parasites is regulated by competition between phospholipid metabolism and histone methylation

Drakeley, C., Sutherland, C., Bousema, J. T., Sauerwein, R. W. & Targett, G. A. T. The epidemiology of Plasmodium falciparum gametocytes: weapons of mass dispersion. Trends Parasitol. 22, 424–430 (2006). Article  PubMed  Google Scholar  Kafsack, B. F. C. et al. A transcriptional switch underlies commitment to sexual development in malaria…

Continue Reading Sexual differentiation in human malaria parasites is regulated by competition between phospholipid metabolism and histone methylation

hisat2 Error 137

hisat2 Error 137 0 hi every body, I am running hisat2 with below command: hisat2 –dta -x /home/genetics/apps/Proj/Index/hg38/genom -1 SRR11573854_1P -2 SRR11573854_2P -S SRR11573854.sam -p 4 and I face this error: Killed (ERR): hisat2-align exited with value 137 could you help me to solve this problem? Thank you very much…

Continue Reading hisat2 Error 137

Filtering mitochondrial reads from ATAC-Seq aligned reads- what to do with reads that have MT in RNEXT field

Hi all, I am trying to filter mitochondrial reads from my ATAC-seq data after trimming with Trimmomatic and then aligning with Bowtie2. After searching through many pipelines, I have found 2 ways that people often do this (both using inputs that are sorted and indexed BAM files): 1) with samtools…

Continue Reading Filtering mitochondrial reads from ATAC-Seq aligned reads- what to do with reads that have MT in RNEXT field

Recombinant Enterobacter sp. 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD

货号: CSB-YP394376EIZ 规格: 来源: Yeast 其他: 货号: CSB-EP394376EIZ 规格: 来源: E.coli 其他: 货号:…

Continue Reading Recombinant Enterobacter sp. 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD

Recombinant Human Probable 28S rRNA (cytosine(4447)-C(5))-methyltransferase(NOP2),partial

货号: CSB-YP015938HU 规格: 来源: Yeast 其他: 货号: CSB-EP015938HU 规格: 来源: E.coli 其他: 货号:…

Continue Reading Recombinant Human Probable 28S rRNA (cytosine(4447)-C(5))-methyltransferase(NOP2),partial

Reads with highest MAPQ values from SAM files are showing mismatches to reference sequence and IGV classified them as supplementary reads

Hi all, I am expressing a GFP synonymous variant library in human cells and sequencing its RNA on the nanopore and I am having some trouble analysing the data. Initially, I basecalled all the fast5 files using the super accuracy model in the guppy basecaller, then I discarded the reads…

Continue Reading Reads with highest MAPQ values from SAM files are showing mismatches to reference sequence and IGV classified them as supplementary reads

Not annotated metagenome-assembled genomes recovered from rumen samples from cows

  Protozoa comprise a major fraction of the microbial biomass in the rumen microbiome, of which the genera Entodinium has been consistently observed to be dominant across a diverse genetic and geographical range of ruminant hosts. Despite the apparent core role that species such as Entodinium caudatum exert, their greater…

Continue Reading Not annotated metagenome-assembled genomes recovered from rumen samples from cows

Building Dict File for GATK

Building Dict File for GATK 4 I’m going through the instructions page on gatkforums.broadinstitute.org/gatk/discussion/1601/how-can-i-prepare-a-fasta-file-to-use-as-reference Specifically, the command I don’t see how to do is: java -jar CreateSequenceDictionary.jar R= Homo_sapiens_assembly18.fasta O= Homo_sapiens_assembly18.dict [Fri Jun 19 14:09:11 EDT 2009] net.sf.picard.sam.CreateSequenceDictionary R= Homo_sapiens_assembly18.fasta O= Homo_sapiens_assembly18.dict [Fri Jun 19 14:09:58 EDT 2009] net.sf.picard.sam.CreateSequenceDictionary done….

Continue Reading Building Dict File for GATK

Bioinformatics Analyst II (Remote) Position In North Chicago , IL

Job Description To discuss more about this job opportunity, please reach out to Chitrank Rastogi (LinkedIn URL – www.linkedin.com/in/chitrank-rastogi-55119a102/), email your updated resume at Email – chitrank.rastogi@collabera.com or give me a call at (425) 523-1648. Thank you! Job Description:Job Roles & Responsibilities: We have an exciting contract opportunity for a…

Continue Reading Bioinformatics Analyst II (Remote) Position In North Chicago , IL

Recombinant Human Probable dimethyladenosine transferase(DIMT1)

货号: CSB-EP892161HU 规格: 图片: 其他: 产品详情 纯度: Greater than 90% as determined by SDS-PAGE. 基因名: DIMT1 Uniprot No.: …

Continue Reading Recombinant Human Probable dimethyladenosine transferase(DIMT1)

the monitor in mcallen, texas obituaries

If you are interested in reading The Monitor McAllen Texas obituaries, you can find them online or in the print edition of the newspaper. Learn About Online Memorials 269 talking about this. I was honored to have known Jeannie while living and growing up in McAllen. Mrs. Stroud, may you…

Continue Reading the monitor in mcallen, texas obituaries

Beware of the AI Bubble Burst: Experts

Last week, Bank of America’s chief investment strategist Michael Hartnett warned us of a looming AI bubble. AI is this year’s investment craze and even though the profit potential is huge, this period could go the messy dot-com burst way, stated the Bank of America representative.  On the other hand,…

Continue Reading Beware of the AI Bubble Burst: Experts

Inside Google’s Effort To Use AI To Make ASL Accessible To All

Google is harnessing AI tech to help make ASL more accessible to everyone Google Images Earlier this year, Bay Area-based Google put together a competition intended to use artificial intelligence in decode sign language in real time. According to Google, the goal of the competition is to “classify isolated American…

Continue Reading Inside Google’s Effort To Use AI To Make ASL Accessible To All

Active Recombinant Human FGFR2 protein, GST-tagged FGFR2-18H

Home / Products / Recombinant Proteins / Active Recombinant Human FGFR2 protein, GST-tagged Active Recombinant Human FGFR2 protein, GST-tagged Online Inquiry FGFR2 Related Products By Species By Source By Tag Price Inquiry Welcome! For price inquiries, please feel free to contact us…

Continue Reading Active Recombinant Human FGFR2 protein, GST-tagged FGFR2-18H

Building Serverless APIs with OpenAPI , Sat, Jun 24, 2023, 10:15 AM

This is an in-person, hands-on workshop where you will learn how to design and build serverless RESTful APIs using the API-first design or API-first approach with the OpenAPI version 3 specification. This approach allows you to design and document your API before writing any code, thereby improving communication and agility…

Continue Reading Building Serverless APIs with OpenAPI , Sat, Jun 24, 2023, 10:15 AM

minimap’s SAM file MAPQ value for the unique alignments

minimap’s SAM file MAPQ value for the unique alignments 0 Hi, I have mapped my reads from nanopore RNAseq to the reference database using the minimap. Minimap SAM files have MAPQ values from 0 to 60 in the fifth column. While 0 indicates the reads that can possibly map to…

Continue Reading minimap’s SAM file MAPQ value for the unique alignments

sorting BAM file

sorting BAM file 0 I tried sorting the BAM file i created using gatk-package-4.2.5.0-local.jar SortSam the code is : java -jar gatk-package-4.2.5.0-local.jar SortSam -I {path.bam} -O {path.sorted.bam} -SO coordinate but i encountered this error: INFO: Failed to detect whether we are running on Google Compute Engine. [Tue May 30 16:08:32…

Continue Reading sorting BAM file

VR | VSAM/SAM FILE I/O TUNER

What are the primary challenges that VELOCI-Raptor addresses? The primary challenges faced by data centers are the need to reduce batch processing time, the need and ability to meet service level agreements, the requirement to maximize system performance without extensive programming changes and the ability to determine system-wide impact of…

Continue Reading VR | VSAM/SAM FILE I/O TUNER

htslib-1.15.1-2.fc38 – Fedora Packages

htslib-1.15.1-2.fc38 – Fedora Packages ↵ Return to the main page of htslibView buildSearch for updates Package Info (Data from x86_64 build) Changelog Dependencies Provides Files Changelog Date Author Change 2023-01-19 Fedora Release Engineering <releng at fedoraproject dot org> – 1.15.1-2 – Rebuilt for fedoraproject.org/wiki/Fedora_38_Mass_Rebuild 2022-08-15 John Marshall <jmarshall at hey…

Continue Reading htslib-1.15.1-2.fc38 – Fedora Packages

Bioconductor – CompGO

DOI: 10.18129/B9.bioc.CompGO     This package is deprecated. It will probably be removed from Bioconductor. Please refer to the package end-of-life guidelines for more information. This package is for version 3.13 of Bioconductor. This package has been removed from Bioconductor. For the last stable, up-to-date release version, see CompGO. An…

Continue Reading Bioconductor – CompGO

ABySS Process Killed

ABySS Process Killed 0 Hi everyone! Name is Sam and I’d like to ask for help on my contig assembly using ABySS. I’ve been trying to assemble a contig from paired sequences using ABySS in WSL. I started with a basic script as follows: abyss-pe k=21 B=2G name=A1k21 in=’A1_1.fastq A1_2.fastq’…

Continue Reading ABySS Process Killed

Exploring Tumor Biomarkers in Urothelial Carcinoma: Insights and Advancements in Bladder Cancer Research

Read the Full Video Transcript Sam Chang: Hello everyone. My name is Sam Chang. I’m a urologist in Nashville, Tennessee and work at Vanderbilt University Medical Center. And we’re quite fortunate to have Dr. Chad Ritch from the University of Miami. I’ve known Chad a long time. He’s an associate…

Continue Reading Exploring Tumor Biomarkers in Urothelial Carcinoma: Insights and Advancements in Bladder Cancer Research

Mapping fewer reads to a genome graph than a linear reference

I am seeing a 5-10% reduction in reads mapped to a genome graph compared to a linear reference of the same genome sequence. I have two graphs: one is the reference genome decorated with 5 million SNPs and the other is an empty graph created with vg using the reference…

Continue Reading Mapping fewer reads to a genome graph than a linear reference

pytorch geometric dgcnn

package manager since it installs all dependencies. (defualt: 5), num_electrodes (int) The number of electrodes. I plugged the DGCNN model into my semantic segmentation framework in which I use other models like PointNet or PointNet++ without problems. This commit does not belong to any branch on this repository, and may…

Continue Reading pytorch geometric dgcnn

Deferentially expressed gene with high log2foldchange by DESeq2; but not meaningful at the individual level

Hi all, I am working with the RNA-Seq data on human (24Cases-20 controls) to find differentially expressed genes. my RNA-Seq data is unstranded. Here is the comments that I used to align the fastq files: ls *_1P.fastq.gz | parallel –bar -j8 ‘R2=$(echo {} | sed s/_1/_2/) && out=$(echo {} |…

Continue Reading Deferentially expressed gene with high log2foldchange by DESeq2; but not meaningful at the individual level

Ubuntu Manpage: removeDup – Remove duplicated reads

Provided by: subread_2.0.0+dfsg-1_amd64 NAME removeDup – Remove duplicated reads USAGE removeDup [options] -i <input_file> -o <output_file> Required arguments: -i <string> Name of input file in SAM/BAM format. -o <string> Name of output SAM file including filtered reads. The format is BAM unless ‘-S’ is specified. Optional arguments: -S Generate the…

Continue Reading Ubuntu Manpage: removeDup – Remove duplicated reads

Mindlance hiring Bioinformatics Analyst in United States

Title- Bioinformatics Analyst Duration-3months with extension Location-Remote   Description: We have an exciting contract opportunity for a Bioinformatics analyst/programmer to support the Emerging Technology Group in GRC. Primary responsibility include providing analysis support for running standard pooled CRISPR screening data and differential expression analysis of bulk RNAseq data, and performing…

Continue Reading Mindlance hiring Bioinformatics Analyst in United States

NanoSim Error “Please specify the training reads and its reference genome!”

NanoSim Error “Please specify the training reads and its reference genome!” 1 Hi, I installed nanosim using conda install -c bioconda nanosim and then tried to run the read characterization using read_analysis.py transcriptome -i training_reads.fastq -r reference_genome.fa -rt reference_transcriptome.fa -annot reference_annotation.gtf -o training. However, I get the following error: Please…

Continue Reading NanoSim Error “Please specify the training reads and its reference genome!”

samtools installed but error message: Library not loaded: @rpath/libcrypto.1.0.0.dylib

samtools installed but error message: Library not loaded: @rpath/libcrypto.1.0.0.dylib 1 I would like to convert input.sam to output.bam but I get following error message: kk$ samtools view -bS input.sam > output.bam dyld[88970]: Library not loaded: @rpath/libcrypto.1.0.0.dylib Referenced from: /Users/kk/opt/anaconda3/bin/samtools Reason: tried: ‘/Users/kk/opt/anaconda3/bin/../lib/libcrypto.1.0.0.dylib’ (no such file), ‘/Users/kk/opt/anaconda3/bin/../lib/libcrypto.1.0.0.dylib’ (no such file), ‘/usr/local/lib/libcrypto.1.0.0.dylib’…

Continue Reading samtools installed but error message: Library not loaded: @rpath/libcrypto.1.0.0.dylib

VS-Bioinformatics Analyst (Remote) – Rangam Infotech Private Limited

“Applicants must be authorized to work for ANY employer in the U.S. We are unable to sponsor or take over sponsorship of an employment Visa at this time.” Remote 3 month contract with possibility of extension We have an exciting contract opportunity for a Bioinformatics analyst/programmer to support the Emerging…

Continue Reading VS-Bioinformatics Analyst (Remote) – Rangam Infotech Private Limited

Things Phase 4 Did Perfectly

The one-two punch of Avengers: Infinity War and Avengers: Endgame firmly established the Marvel Cinematic Universe (MCU) as the biggest movie franchise in the world. What helped make the films among the biggest box-office hits ever is that they were the grand culmination of a decade’s worth of storytelling, as…

Continue Reading Things Phase 4 Did Perfectly

Help: LitScan

# Total IDs searched 9,648,246 IDs being used by LitScan 8,939,826 Unique RNA sequences 4,497,573 Articles found 865,179 RNAcentral LitScan is a new text mining pipeline that connects RNA sequences with the latest open access scientific literature. LitScan uses a collection of identifiers (Ids), gene names, and synonyms provided to…

Continue Reading Help: LitScan

Growth Medium 1S – Nordic Biosite

Additional Information This liquid Growth Medium is a complete medium optimized to culture select BPS Bioscience cell lines. Optimized for Use With: CRISPRa (SAM) HeLa Cell Line (BPS Bioscience, #78193), CRISPRa (SAM) HepG2 Cell Line (BPS Bioscience, #78194) Article No BPS-78221 Country Availability SE, FI, DK, NO, IS, EE, LV,…

Continue Reading Growth Medium 1S – Nordic Biosite

Recombinant Saccharopolyspora erythraea rRNA adenine N-6-methyltransferase(ermE)

货号: CSB-YP362098STB 规格: 来源: Yeast 其他: 货号: CSB-EP362098STB 规格: 来源: E.coli 其他: 货号:…

Continue Reading Recombinant Saccharopolyspora erythraea rRNA adenine N-6-methyltransferase(ermE)

Dell’s Project Helix Is a Wide-Reaching Generative AI Service

Dell and NVIDIA joined forces to put generative AI into the hands of Dell’s software-as-a-service customers. Image: Yingyaipumi/Adobe Stock Project Helix will be Dell’s first foray into artificial intelligence for its edge software service, Dell Technologies Senior Vice President of Product Marketing Varun Chhabra announced as part of a preview…

Continue Reading Dell’s Project Helix Is a Wide-Reaching Generative AI Service

Decoding MM and ML tags in .SAM file

Hi all, I am trying to decode the SAM MM and ML tags read by read and create a table of methylation locations on that read. For example, from an aligned sam file: Nanopore_Sequence_Example 4 * 0 0 * * 0 0 GTTATGTAACCTACTTGGTTCCATTACGTATTGCTGGTGCTGAAGATTGTAGGTGTCTTTGTGCAGAGTGTATGATATACACGGCGGTGCTGAAGAAAGTTATTGCGGGTGTATTTGTGCAGAAGTATATGATGTGCGCGGGCGGAGGTGCTGAAGAAAGTTGTCGGTGTCTTTGTGCAGAAGTATATGATGGCGAGGTGTTGAAGAAAGTTGTCGGTGTCTTTGTGCAGAAGTATATGATGTGCGCGGGCGGATCCGCCCGCGCATCCTTCTGCGCAAT “&+*+*)$#$%’&&’)%&'(,)))*1555:>B@7777BBCD10.*.%%&)$$$*14//0.,.-..'(%(%&”..211–‘$$%&+))56<;;998:44892.-,+)(‘&*)’&&((,++/0064:385566;>A>=6@<@AA?;:::=>>?==7=?@=<>>;BA@??@?=:;;;7011+,,).-,++++-&$$%)(,)*,)$%'(((&&'(&&%%%&+0///20877656??BAA@@ABBEFGC>=57793222532110,50-++$$$%&),,,+()) rl:i:0 MM:Z:C+h?,5,5,0,1,1,0,0,1,2,0,2,0,0,1,2,0,4;C+m?,5,5,0,1,1,0,0,1,2,0,2,0,0,1,2,0,4; ML:B:C,159,6,135,2,7,9,3,4,13,11,6,22,6,1,2,2,218,0,4,19,1,2,7,4,1,0,1,4,15,11,2,1,0,0 I’m trying to…

Continue Reading Decoding MM and ML tags in .SAM file

Bioinformatics Software Engineer – Urgent Hiring jobs by Tesa Research in

We are hiring a confident Bioinformatics Software Engineer to join our diverse team at TESA Research in Park City, UT.Growing your career as a Full Time Bioinformatics Software Engineer is a fantastic opportunity to develop relevant skills.If you are strong in people management, cooperation and have the right mindset for…

Continue Reading Bioinformatics Software Engineer – Urgent Hiring jobs by Tesa Research in

Detroit Lions to Begin Phase 3 of Offseason Program

The Detroit Lions are ready to kick off the third phase of the NFL offseason as they commence their OTAs (Other Team Activities) this week. These non-contact practice sessions will take place on Tuesday, Wednesday, and Thursday at the team’s facility in Allen Park. As the team enters this crucial…

Continue Reading Detroit Lions to Begin Phase 3 of Offseason Program

Recombinant Acinetobacter baumannii 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD

货号: CSB-YP536423AWP 规格: 来源: Yeast 其他: 货号: CSB-EP536423AWP 规格: 来源: E.coli 其他: 货号:…

Continue Reading Recombinant Acinetobacter baumannii 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD

ChIP-Seq

ChIP-Seq Input Data (Reference Feature)       LiftOver   LiftOver option] body=[We provide on-the fly lift-over of reference data sets between different genome assemblies for broader comparison among annotations.]”> :    Upload custom Data   File Format] body=[All ChIP-seq tools use SGA (Simplified Genome Annotation) files as an internal working format. SGA intput…

Continue Reading ChIP-Seq

Where to watch Taylor vs Cameron in Canada today

Get ready for an electrifying showdown as the boxing world anticipates an epic clash inside Dublin’s 3Arena. Stepping into the ring is the renowned and undefeated champion, Katie Taylor, boasting an impressive record of 22 wins and zero losses. Holding titles in The Ring, WBA, WBC, IBF, and WBO, Taylor…

Continue Reading Where to watch Taylor vs Cameron in Canada today

Solved 12) You and your research partner Sam have been

Transcribed image text: 12) You and your research partner Sam have been working to understand how treatment with PFAS affects plant growth. You treated your seeds with water (control sample) or with PFAS. You repeated your experiment twice, one week apart, and completed your RNAseq study, and have started analysis….

Continue Reading Solved 12) You and your research partner Sam have been

CRISPR Therapeutics Stock: Hold Until A Firmer Decision Date (NASDAQ:CRSP)

Artur Plawgo/iStock via Getty Images CRISPR Therapeutics (NASDAQ:CRSP) is a large (~$5 billion market cap) gene editing company developing gene-based medicines using its proprietary clustered regularly interspaced short palindromic repeats and the CRISPR-associated protein 9 (CRISPR/Cas9) platform. On April 3, they completed the rolling Biologics License Applications (BLAs) to the…

Continue Reading CRISPR Therapeutics Stock: Hold Until A Firmer Decision Date (NASDAQ:CRSP)

Metagenomi Swiftly Variegates Gene-Editing Palatte

Despite the rapid development of genetic medicines, Simon Harnest, chief investment officer and SVP strategy at Metagenomi, said that attending the annual ASGCT meeting is a good way to keep tabs on the industry. “There are so many specialized groups in gene editing, some that focus on base editing and…

Continue Reading Metagenomi Swiftly Variegates Gene-Editing Palatte

What is CRISPR? – BBC Science Focus Magazine

The CRISPR-Cas9 tool is sometimes described as a ‘wanted’ poster that’s hung in an organism’s immune system. On this is the likeness of a virus, teaching the immune system to recognise the potential invader. Vaccines of various kinds are designed to do the same job: to give your immune system…

Continue Reading What is CRISPR? – BBC Science Focus Magazine

Microbiome Sequencing Services Market Production, Revenue, Price, Trend, Size and Growth Analysis 2032

The Microbiome Sequencing Services Market Size, Scope, and Forecast 2023-2032 report has been added to the Market research collection of Quince Market Insights. Industry experts and researchers have offered an authoritative and concise analysis of the Microbiome Sequencing Services Market with respect to various aspects such as growth factors, challenges, restraints, developments, and opportunities for growth. This…

Continue Reading Microbiome Sequencing Services Market Production, Revenue, Price, Trend, Size and Growth Analysis 2032

Babraham Bioinformatics – FastQC A Quality Control tool for High Throughput Sequence Data

FastQC Function AMPERE quality control tool for elevated throughput sequence data. Your Java What A match Java Runtime Ecology This Picard BAM/SAM Libraries (included in download) Code Maturation Robust. Mature code, but feedback exists comprehended. Code Released No, under GPL v3 or later. Initial Contact Simon Andrews Download Now Views…

Continue Reading Babraham Bioinformatics – FastQC A Quality Control tool for High Throughput Sequence Data

filter reads in BAM having a tag

filter reads in BAM having a tag 3 Anyone has a simple solution for filtering reads in a BAM/SAM file having a certain TAG? This came up trying to filter out reads from 10x without a proper CB tag defined (which is causing troubles in downstream analysis tools). I’m surprised…

Continue Reading filter reads in BAM having a tag

Fast BAM header editing

Fast BAM header editing 2 I would like to change some information in the BAM header (specifically, chromosome size information). Is there a smarter/faster way to do this without extracting to an intermediate SAM file and remaking the BAM file from the edited SAM file? bam • 94 views You…

Continue Reading Fast BAM header editing

CABANA workshop: Advanced RNAseq and network analysis in genomics

This course will provide training on RNAseq data production and interpretation. The course starts with a brief introduction to RNA-seq and discusses quality control issues. Next, we will present the alignment step, quantification of expression and differential expression analysis. We will dedicate some time to analysing and constructing networks from…

Continue Reading CABANA workshop: Advanced RNAseq and network analysis in genomics

Answer: Estimate sizes of repeats in a especific Gene

Tell me if I’m in the way. I have the CRAM file and the respective CRAI (index). So I just ran the SAM like this, clipping my area of interest: > $ samtools view -b NG1PSZ7BE9.mm2.sortdup.bqsr.cram “chrX:147912050-147912110” > result.bam Then I indexed the .bam file: > $ samtools index result.bam…

Continue Reading Answer: Estimate sizes of repeats in a especific Gene

The Glue of Genomics: Will Science’s Unsung Data Heroes Abandon Academia?

Advances in the last twenty years of genomics have turbocharged our ability to decode DNA and other nucleic acids. At the turn of the century, the Human Genome Project completed a 13-year journey to produce the first complete human genome at a great financial cost. In 2023, genome sequencing is a routine…

Continue Reading The Glue of Genomics: Will Science’s Unsung Data Heroes Abandon Academia?

amazon web services – How to add policy to aws sam file to put value in secrets mangaer with mabda

Policies: – AWSXrayWriteOnlyAccess – AWSSecretsManagerGetSecretValuePolicy: SecretArn: !Sub – AWSSecretsManagerRotationPolicy: SecretArn: !Sub arn:${AWS::Partition}:secretsmanager:${AWS::Region}:${AWS::AccountId}:secret:/${EnvironmentTagName}/* Effect: Allow FunctionName: !Sub ${AWS::StackName}-**** Action: – secretsmanager:UpdateSecret – secretsmanager:GetSecretValue – secretsmanager:PutSecretValue Resource: I want to change secrets value by lambda , but I got this error:- AccessDeniedException: User: arn:aws:sts:::assumed-role/LambdaName is not authorized to perform: secretsmanager:PutSecretValue on resource:…

Continue Reading amazon web services – How to add policy to aws sam file to put value in secrets mangaer with mabda

How to load inidividual ADT and RNA data to the same AnnData structure

How to load inidividual ADT and RNA data to the same AnnData structure 0 High guys, I’m a beginner using scanpy. I’m trying to load som CITE-seq data but only find how to use the “sc.read_10x_h5” function which demands a 5h file. The data I want to load is in…

Continue Reading How to load inidividual ADT and RNA data to the same AnnData structure

Animal Genetics Market Size, Growth Analysis Forecast Report 2023-2032

Exclusive Updated Report by Quince Market Insights: Animal Genetics Market The global animal genetics market is estimated to be worth of USD 8.53 Billion in 2023 and is growing at a CAGR of 5.8% during the forecast period from 2023 to 2032. The animal genetics market has seen consistent growth in…

Continue Reading Animal Genetics Market Size, Growth Analysis Forecast Report 2023-2032

Microsoft bets that a fusion power plant from Helion Energy will be operating this decade

Microsoft agreed to buy electricity from a fusion power plant being developed by Helion Energy. Helion said the plant will be online by 2028, sooner than scientists thought fusion would be viable. Fusion energy doesn’t produce the greenhouse gas emissions that are fueling the climate crisis. The timeline for pumping…

Continue Reading Microsoft bets that a fusion power plant from Helion Energy will be operating this decade

Integrated microbiome-metabolome-genome axis data of Laiwu and Lulai pigs

Animal rearing and samples collection Our experiment was designed to compare eight female Laiwu pigs (LW) with eight female Lulai pigs (LU) which crossbred between LW and Yorkshire breeds. All pigs were born and raised for approximately two years (715 ± 33 days, Table 1) under uniform housing and feeding conditions at Jing-Qi-Shen…

Continue Reading Integrated microbiome-metabolome-genome axis data of Laiwu and Lulai pigs

Racon empty output (non-memory issue)

Racon empty output (non-memory issue) 1 Hello, I’ve been trying to run Racon for the first time on one ONT metagenomic dataset (here) Each time I try to run it, with or without the specified options, it runs very quickly with no errors and spits out an empty file. What…

Continue Reading Racon empty output (non-memory issue)

samtools and Rsamtools in r

samtools and Rsamtools in r 2 Hello, How can I use Rsamtools, so I can import the results from a bam file. E.g. if I use samtools view sample.bam > sample.sam I can import this sam file easily into R. However, if I run Rsamtools, and do something like input_bam…

Continue Reading samtools and Rsamtools in r

Gluconeogenic enzyme PCK1 supports S-adenosylmethionine biosynthesis and promotes H3K9me3 modification to suppress hepatocellular carcinoma progression

doi: 10.1172/JCI161713. Online ahead of print. Dongmei Gou  1 , Rui Liu  1 , Xiaoqun Shan  1 , Haijun Deng  1 , Chang Chen  2 , Jin Xiang  1 , Yi Liu  1 , Qingzhu Gao  1 , Zhi Li  3 , Ailong Huang  4 , Kai Wang  4 , Ni Tang  1 Affiliations Expand Affiliations 1 Institute for Viral Hepatitis,…

Continue Reading Gluconeogenic enzyme PCK1 supports S-adenosylmethionine biosynthesis and promotes H3K9me3 modification to suppress hepatocellular carcinoma progression

Two New York Genome Center research teams selected as grant recipients

NEW YORK, NY (May 11, 2023) – The National Institutes of Health (NIH) Common Fund has selected the New York Genome Center (NYGC) as a multi-grant recipient under the Somatic Mosaicism across Human Tissues (SMaHT) Network. NEW YORK, NY (May 11, 2023) – The National Institutes of Health (NIH) Common Fund…

Continue Reading Two New York Genome Center research teams selected as grant recipients

Two New York Genome Center research teams sel

image: NYGC Logo view more  Credit: New York Genome Center NEW YORK, NY (May 11, 2023) – The National Institutes of Health (NIH) Common Fund has selected the New York Genome Center (NYGC) as a multi-grant recipient under the Somatic Mosaicism across Human Tissues (SMaHT) Network. The awarded grants will fund two…

Continue Reading Two New York Genome Center research teams sel

NewBiologix Launches with $50M to Advance Novel Technology Platform for the Manufacturing of Gene and Cell Therapies

– Co-founded by cell line development pioneers, Igor Fisch and Nicolas Mermod – New state-of-the-art facility designed explicitly for gene and cell therapy development – Supported by world-class scientific advisory board LAUSANNE, Switzerland–(BUSINESS WIRE)–NewBiologix SA emerged from stealth today as a technology innovation company developing a proprietary and breakthrough platform…

Continue Reading NewBiologix Launches with $50M to Advance Novel Technology Platform for the Manufacturing of Gene and Cell Therapies

No differentially expressed genes after multiple testing correction in mice

No differentially expressed genes after multiple testing correction in mice 0 Hi all, I am working with the RNA-seq data on mice (group A N=3 vs group B N=3). Mice are littermates, of which group A overexpresses a human transgene which I verified. I have had .cram files from mouse…

Continue Reading No differentially expressed genes after multiple testing correction in mice

How Secret Invasion Connects MCU Phases 3 & 5 According To Sam Jackson

Samuel L. Jackson shares how Secret Invasion ties Marvel Cinematic Universe’s Phase 3 and 5. The Infinity Saga wrapped up almost four years ago, and Marvel Studios has been focused on building the Multiverse Saga. Secret Invasion, however, will revisit the tail end of the Infinity Saga, and connect it…

Continue Reading How Secret Invasion Connects MCU Phases 3 & 5 According To Sam Jackson

KEGG ENZYME: 2.1.1.308

Entry EC 2.1.1.308                Enzyme                                  Name cytidylyl-2-hydroxyethylphosphonate methyltransferase;Fom3;S-adenosyl-L-methionine:methylcob(III)alamin:2-hydroxyethylphosphonate methyltransferase (incorrect);2-hydroxyethylphosphonate methyltransferase (incorrect) Class Transferases;Transferring one-carbon groups;MethyltransferasesBRITE hierarchy Sysname S-adenosyl-L-methionine:cytidine 5′-{[hydroxy(2-hydroxyethyl)phosphonoyl]phosphate} C-methyltransferase Reaction(IUBMB) 2 S-adenosyl-L-methionine + cytidine 5′-{[hydroxy(2-hydroxyethyl)phosphonoyl]phosphate} + reduced acceptor = S-adenosyl-L-homocysteine + 5′-deoxyadenosine + L-methionine + cytidine 5′-{[hydroxy(2-hydroxypropyl)phosphonoyl]phosphate} + oxidized acceptor [RN:R12497] Reaction(KEGG) Substrate S-adenosyl-L-methionine [CPD:C00019]; cytidine 5′-{[hydroxy(2-hydroxyethyl)phosphonoyl]phosphate} [CPD:C22216]; reduced acceptor [CPD:C00030]…

Continue Reading KEGG ENZYME: 2.1.1.308

IJMS | Free Full-Text | Engineering Human Cells Expressing CRISPR/Cas9-Synergistic Activation Mediators for Recombinant Protein Production

1. Introduction Peptides are employed for a multitude of therapeutic approaches and can be obtained from the native organ or tissue in which they are produced as well as through recombinant methods where nucleic acids encoding a candidate gene(s) are delivered to and expressed in cells in vitro. As an…

Continue Reading IJMS | Free Full-Text | Engineering Human Cells Expressing CRISPR/Cas9-Synergistic Activation Mediators for Recombinant Protein Production

Chan Zuckerberg ID Makes Strides in Enabling Pathogen Identification From Metagenomic Data

NEW YORK – A free, cloud-based data analysis platform to identify pathogens and other microbes from sequencing data dubbed Chan Zuckerberg ID (CZ ID) has been making inroads with infectious disease researchers around the world. The platform, developed by the Chan Zuckerberg Initiative and first released in 2019, recently added…

Continue Reading Chan Zuckerberg ID Makes Strides in Enabling Pathogen Identification From Metagenomic Data

Software Asset Management Tools Market Size Investigation Report 2023-2030 by Absolute Reports in Information & Communication Technology , Information Technology Industry

PRESS RELEASE Published May 7, 2023 [101] pages Software Asset Management Tools market report is segmented by geographical regions (Europe, Asia Pacific, Latin America, Middle East & Africa), manufactures (Company 1, Company 2, Company 3, Company 4, Company 5, Company 6, Company 7, Company 8, Company 9, Company 10, Company…

Continue Reading Software Asset Management Tools Market Size Investigation Report 2023-2030 by Absolute Reports in Information & Communication Technology , Information Technology Industry

Insert Size Metrics of ATAC-Seq data

Insert Size Metrics of ATAC-Seq data 2 I have paired-end sequencing data from ATAC-Seq and the fastq files had nextera adaptors. So I trimmed them the following way: trim_galore –paired –nextera ${names[${SLURM_ARRAY_TASK_ID}]}_R1.fastq ${names[${SLURM_ARRAY_TASK_ID}]}_R2.fastq Then did Bowtie bowtie2 -p 4 -q –very-sensitive -x genome -1 ${names[${SLURM_ARRAY_TASK_ID}]}_R1_val_1.fq -2 ${names[${SLURM_ARRAY_TASK_ID}]}_R2_val_2.fq -S “${names[${SLURM_ARRAY_TASK_ID}]}”_aln_unsorted.sam While…

Continue Reading Insert Size Metrics of ATAC-Seq data

Invalid Contig error when using bamfile.fetch

Invalid Contig error when using bamfile.fetch 0 Hey all, I am new to using Pysam module in vs code. I am having issues getting my code to work. So I have two files: first is a CSV that I imported as pandas df and it has two columns: chromosome and…

Continue Reading Invalid Contig error when using bamfile.fetch

DNA-based Data Storage Platform Market Aims to Expand

DNA-based Data Storage Platform Market The process of using DNA molecules as a storage medium is well known as deoxyribonucleic acid (DNA) data storage. In this process, there is encoding and decoding of binary data onto and from synthesized strands of DNA. The DNA data is encoded into DNA nucleotide…

Continue Reading DNA-based Data Storage Platform Market Aims to Expand

base modifications tags in SAM file

Hi everyone ! I’m currently working on parsing SAM file to extract methyllation site from a nanopore sequencing. According to the SAM documentation, it’s possible thanks to MM:Z and ML:B:C tags. You can find bellow, a read, the MM:Z and ML:B:C tags extracted from my SAM file: TGATCGCGCGGACCTGTTCTACCAGGTAGGTCACCGGGTCAAATGATATTTTGATGGTGTTGGACACCACCGTCTGGCTGGCGCTCAGGGTGCCGGAGTTCAGAGCGTAGATGAATGTCTCAAACGCGGAGGATTTCTCGCCTCCCAGCATGTAAATTGGCCACTGCAGGGCGCTGCTCTTGTCAGTATAGCGGAAATGTATGGGGAGCGGCATATTTCGTTAAGGACGGTTGCAATGGCTACCCCAGAATCTTGGCTGCTGTTGCCTTCGACCGCCGCGTTCACGCGCTCAATTGTGGGGTGGAGCACAGCGATCGCTGAAGCGGCGCACGAAAAACGCGAAAGCGTTTCACGATAAATGCGAAAACCACAAAGACACCGACAACTTTCTTCGAGCAAATTCACCTACGCCAGCAACTGAACGAAGTAC MM:Z:C+m?,1,2,1,0,1,1,0,1,0,0,0,1,2,0,9,0,0,0,0,0,10,2,1,7,4,8,3,0,3,4,4,4,9,6,0,0; ML:B:C,234,246,49,84,5,0,11,228,254,0,0,2,8,1,3,1,1,0,146,0,10,0,1,115,19,0,167,19,0,121,21,9,188,112,93,6…

Continue Reading base modifications tags in SAM file

Unable to extract unmapped reads from sam file – MetaPhlAn

Hi,We used MetaPhlAn version 4.0.4 to perform taxonomy profiling using the lastest vOct22 marker database. It worked well on the majority of our samples but there were 90% unclassified reads for 2 samples. It maybe because of the sample conditions but we were curious about the unclassified reads and wanted…

Continue Reading Unable to extract unmapped reads from sam file – MetaPhlAn

Ovid buys big stake in Waksal company to pursue brain treatments

Over glasses of Chablis at Fleming by Le Bilboquet in Manhattan, two longtime friends and biotech lifers hashed out the deal that will bring their wending and colorful careers back together after three decades. Jeremy Levin, the professorial executive who has become one of the industry’s loudest voices on matters…

Continue Reading Ovid buys big stake in Waksal company to pursue brain treatments

RNA SEQ reads assembly for illumina sequenced data

RNA SEQ reads assembly for illumina sequenced data 0 Hi, everyone, I have 10 samples paired end . I have done the quality check and trimming then I merged the trimmed reads and after that I have done the mapping using minimap2. using this command . minimap2 -ax map-ont ref.fna(reference…

Continue Reading RNA SEQ reads assembly for illumina sequenced data

Brain cell type deconvolution

Brain cell type deconvolution 2 Hi all! I am interested in understanding the % of main cell types composing my bulk RNA-seq data from brain (e.g., astrocytes, microglia, neurons, oligodendrocytes). However, from what I gathered, this appears to be an extremely complicated task. I came across CiberSortX, but I couldn’t…

Continue Reading Brain cell type deconvolution

ERROR using CIBERSORTx Docker version

ERROR using CIBERSORTx Docker version 0 Dear Biostars, I have been working with the web version and the docker version of CIBERSORTx. However, I have been getting a very strange result in the docker version, and I don’t know what I am doing wrong. Even using the same data and…

Continue Reading ERROR using CIBERSORTx Docker version

What statistical test to apply for DE after CibersortX deconvolution

What statistical test to apply for DE after CibersortX deconvolution 0 I am running CibersortX in high-resolution mode (which yields estimates of gene values per sample). After that, I want to perform DE between two conditions on the resulting gene estimates. What statistical test would one need to apply to…

Continue Reading What statistical test to apply for DE after CibersortX deconvolution

RNA-DNA interactomes of three prokaryotes uncovered by proximity ligation

Cell strains E. coli DH5α and B. subtilis 168 strains were grown overnight in Luria-Bertani broth at 37 °C and 180 rpm to a final OD600 ~1.7. B. subtilis strain 168 was kindly provided by Dr. S.A. Dubiley (Institute of Gene Biology, Russian Academy of Sciences, Moscow, Russia). T. adornatum strain…

Continue Reading RNA-DNA interactomes of three prokaryotes uncovered by proximity ligation

UniProt: A0A6P8XQ90_DROAB

ID A0A6P8XQ90_DROAB Unreviewed; 717 AA. AC A0A6P8XQ90; DT 02-DEC-2020, integrated into UniProtKB/TrEMBL. DT 02-DEC-2020, sequence version 1. DT 22-FEB-2023, entry version 9. DE SubName: Full=RUN and FYVE domain-containing protein 2 isoform X5 {ECO:0000313|RefSeq:XP_034113470.1}; GN Name=LOC117574004 {ECO:0000313|RefSeq:XP_034113470.1}; OS Drosophila albomicans (Fruit fly). OC Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; OC…

Continue Reading UniProt: A0A6P8XQ90_DROAB

How to convert SAM/BAM file to GTF/GFF file?

How to convert SAM/BAM file to GTF/GFF file? 1 Hello, Curious to know if there’s a way to convert SAM/BAM file generated using minimap2 to GTF/GFF file. The purpose is to use it as transcript alignment evidence for EVM. Kindly suggest! Regards, B GTF SAM BAM GFF minimap2 • 32…

Continue Reading How to convert SAM/BAM file to GTF/GFF file?

Nextflow process for samtools sort and variant calling

Nextflow process for samtools sort and variant calling 2 Hi everybody ! I’m currently try to learn nextflow scripting. I’m a novice and I just begin with a script in order to sort and convert a SAM file to a BAM file and then call variants thanks to a reference…

Continue Reading Nextflow process for samtools sort and variant calling

Fastqs different lanes

Fastqs different lanes 1 Can anyone please confirm the following. You should generate sam/bams with read groups for downstream analysis (GATK) If you have fastqs from the same sample run over different lanes of the flowcell these would have different read groups Therefore you should keep the fastqs seperate, align…

Continue Reading Fastqs different lanes

bash – Issue With Script To Remove Manta Limitations

I keep getting an interesting error from a relatively small script I wrote in a .sh file. I developed a script to deal with 3 limitations Manta has. The limitations are quoted below Alignments cannot have an unknown read sequence (SEQ=”*”) Alignments cannot contain the “=” character in the SEQ…

Continue Reading bash – Issue With Script To Remove Manta Limitations

Multi-mapping read adjacency in alignment tool outputs

Multi-mapping read adjacency in alignment tool outputs 0 Hello friends, I often work with SAM/BAM formatted short read alignments in a context where it is beneficial to know all alignments for each read rather than best/primary/secondary. My question: Among short read alignment tools and their configurations, is there ever a…

Continue Reading Multi-mapping read adjacency in alignment tool outputs

Licorice extract inhibits the cGAS-STING pathway and protects against non-alcoholic steatohepatitis

doi: 10.3389/fphar.2023.1160445. eCollection 2023. Affiliations Expand Affiliations 1 School of Pharmacy, Chengdu University of Traditional Chinese Medicine, Chengdu, China. 2 Department of Hepatology, The Fifth Medical Center of PLA General Hospital, Beijing, China. 3 Military Institute of Chinese Materia, Fifth Medical Center of Chinese PLA General Hospital, Beijing, China. 4…

Continue Reading Licorice extract inhibits the cGAS-STING pathway and protects against non-alcoholic steatohepatitis

Expected number of haplotype IDs per path in PHG

Expected number of haplotype IDs per path in PHG 0 Hello! I have recently managed to run the Pathfinding step of the Practical Haplotype Graph pipeline (see here; PHG v1.4). With this I now wanted to get the calculated best path, i.e. the list of haplotype IDs that are part…

Continue Reading Expected number of haplotype IDs per path in PHG

Counting number of start positions from SAM file that fall between start and stop coordinates of an exon that belongs to a gene in the GTF file

Deleted:Counting number of start positions from SAM file that fall between start and stop coordinates of an exon that belongs to a gene in the GTF file 0 Hi, sorry if this a stupid question but I am struggling to figure it out. I am working in Python. I have…

Continue Reading Counting number of start positions from SAM file that fall between start and stop coordinates of an exon that belongs to a gene in the GTF file

Overlap File for RACON Genome Polisher

Overlap File for RACON Genome Polisher 0 This seems like a dumb question, but I have no idea how to generate an overlap file that is required for RACON. According to the documentation: github.com/isovic/racon Racon takes as input only three files: contigs in FASTA/FASTQ format, reads in FASTA/FASTQ format and…

Continue Reading Overlap File for RACON Genome Polisher

“.sam” file – should it contain multiple samples?

“.sam” file – should it contain multiple samples? 1 Hi. I feel like this might be a stupid question, but I can’t seem to find an answer anywhere. I’m currently trying to align my paired-end reads to a reference genome. To do this, I believe I need to create a…

Continue Reading “.sam” file – should it contain multiple samples?

10 Biggest Changes Phase 4 Made To The MCU

The Marvel Cinematic Universe‘s first three phases were the Infinity Saga, a sweeping storyline that assembled the Avengers and introduced the six Infinity Stones before Thanos seized them to change the universe forever. Phase 3 ended with Thanos’ final defeat, throwing the doors to Phase 4 and beyond open. RELATED:…

Continue Reading 10 Biggest Changes Phase 4 Made To The MCU

Why Phase 3 of the MCU was a turning point in Marvel history

The Marvel Cinematic Universe has become a cultural phenomenon, captivating audiences with its thrilling action sequences, charismatic heroes, and intricate storylines. But the third phase of the MCU genuinely set the franchise apart. From the introduction of new heroes to the epic conclusion of beloved character arcs, Phase 3 was…

Continue Reading Why Phase 3 of the MCU was a turning point in Marvel history

Blue Earth Diagnostics Highlights Upcoming Presentation of Additional Results from Investigational Phase 3 SPOTLIGHT Study of PET Imaging Agent 18F-rhPSMA-7.3 in Biochemical Recurrence of Prostate Cancer

− Results to be presented at American Urological Association’s 2023 Annual Meeting (AUA2023) – MONROE TOWNSHIP, N.J. & OXFORD, England, April 19, 2023–(BUSINESS WIRE)–Blue Earth Diagnostics, a Bracco company and recognized leader in the development and commercialization of innovative PET radiopharmaceuticals, today announced the presentation of additional results from its…

Continue Reading Blue Earth Diagnostics Highlights Upcoming Presentation of Additional Results from Investigational Phase 3 SPOTLIGHT Study of PET Imaging Agent 18F-rhPSMA-7.3 in Biochemical Recurrence of Prostate Cancer

New Drug Boosts Stem Cell Transplant for Multiple Myeloma

The standard treatment for patients with multiple myeloma often includes stem cell transplantation in which the patient’s own stem cells are harvested and stored while the patient receives intensive chemotherapy to kill the cancer. Then, the patient’s stem cells are returned to the patient to help with recovery. But for…

Continue Reading New Drug Boosts Stem Cell Transplant for Multiple Myeloma