Tag: shRNA

What is shrna transfection? | 4 Answers from Research papers

What are the applications of gene transfer in the treatment of various diseases?5 answersGene transfer has various applications in the treatment of different diseases. It can be used for gene therapy, where new genes are inserted into cancer cells to slow down their growth or induce cell death. Gene transfer…

Continue Reading What is shrna transfection? | 4 Answers from Research papers

(Open Access) A simple approach for multi-targeted shRNA-mediated inducible knockdowns using Sleeping Beauty vectors. (2018) | Severin Fink

Abstract: It is estimated that only 0.02% of disseminated tumor cells are able to seed overt metastases1. While this indicates the presence of environmental constraints to metastatic seeding, the landscape of host factors controlling this process remains largely unknown. Combining transposon technology2 and fluorescent niche labeling3, we developed an in…

Continue Reading (Open Access) A simple approach for multi-targeted shRNA-mediated inducible knockdowns using Sleeping Beauty vectors. (2018) | Severin Fink

pPLK GFP Puro Luc shRNA Plasmid

Catalog number PVTB80045-3a Price 356 EUR Size 2 ug Kit Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most…

Continue Reading pPLK GFP Puro Luc shRNA Plasmid

IKK gamma (IKBKG) Human shRNA Plasmid Kit (Locus ID 8517)

Product Data Locus ID 8517 Synonyms AMCBX1; EDAID1; FIP-3; FIP3; Fip3p; IKK-gamma; IKKAP1; IKKG; IMD33; IP; IP1; IP2; IPD2; NEMO; ZC2HC9 Vector pGFP-C-shLenti E. coli Selection Chloramphenicol (34 ug/ml) Mammalian Cell Selection Puromycin Format Lentiviral plasmids Kit Components IKBKG – Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene…

Continue Reading IKK gamma (IKBKG) Human shRNA Plasmid Kit (Locus ID 8517)

ZCWCC1 (MORC2) Human shRNA Lentiviral Particle (Locus)

Product Data Locus ID 22880 Synonyms CMT2Z; DIGFAN; ZCW3; ZCWCC1 Vector pGFP-C-shLenti Format Lentiviral particles RefSeq NM_001303256, NM_001303257, NM_014941, NM_014941.1, NM_014941.2, NM_014941.3, NM_001303257.1, NM_001303257.2, NM_001303256.1, NM_001303256.2, BC019257, BC136782, BC141657, BM683680, NM_001303256.3 UniProt ID Q9Y6X9 Summary This gene encodes a member of the Microrchidia (MORC) protein superfamily. The encoded protein is…

Continue Reading ZCWCC1 (MORC2) Human shRNA Lentiviral Particle (Locus)

An shRNA screen identifies MEIS1 as a driver of malignant peripheral nerve sheath tumors

An shRNA screen identifies MEIS1 as a driver of malignant peripheral nerve sheath tumors | 10.1016/j.ebiom.2016.06.007_Scihub ◂ ↓ 下载 ♥ 互助社区 Patel, Ami V.; Chaney, Katherine…

Continue Reading An shRNA screen identifies MEIS1 as a driver of malignant peripheral nerve sheath tumors

FRK Human shRNA Lentiviral Particle (Locus ID 2444) Clinisciences

Product Data Locus ID 2444 Synonyms GTK; PTK5; RAK Vector pGFP-C-shLenti Format Lentiviral particles RefSeq NM_002031, NM_002031.1, NM_002031.2, BC012916, BC012916.1, NM_002031.3 UniProt ID P42685 Summary The protein encoded by this gene belongs to the TYR family of protein kinases. This tyrosine kinase is a nuclear protein and may function during…

Continue Reading FRK Human shRNA Lentiviral Particle (Locus ID 2444) Clinisciences

Spatial, temporal and reversible regulation of endogenous gene in vivo using RNA interference

Abstract RNA interference is a powerful tool for controlling gene expression in mammalian systems; as such, it has become an effective alternative to conventional knockout approaches. RNAi has proven to be an efficient method to inhibit tumor suppressor gene function and yield insight into the important players in cancer biology….

Continue Reading Spatial, temporal and reversible regulation of endogenous gene in vivo using RNA interference

Stk3 Mouse shRNA Plasmid (Locus ID 56274) Clinisciences

Product Data Locus ID 56274 Synonyms 0610042I06Rik; mess1; MST; Mst2; Mst3; Ste20 Vector pGFP-C-shLenti E. coli Selection Chloramphenicol (34 ug/ml) Mammalian Cell Selection Puromycin Format Lentiviral plasmids Kit Components Stk3 – Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 56274). 5µg purified plasmid DNA per construct29-mer…

Continue Reading Stk3 Mouse shRNA Plasmid (Locus ID 56274) Clinisciences

Endometrial cancer PDX-derived organoids (PDXOs) and PDXs with FGFR2c isoform expression are sensitive to FGFR inhibition

Patients, tumour Implantation, PDX expansion and characterization The study was conducted according to the Declaration of Helsinki. Tumours were collected from EC patients following Human Research Ethics Committee (HREC) approval (HREC/15/MHS/127) and QUT HREC (#1500000169, 1500000323). All participants provided written informed consent that their excess tissue could be used for…

Continue Reading Endometrial cancer PDX-derived organoids (PDXOs) and PDXs with FGFR2c isoform expression are sensitive to FGFR inhibition

miR-92a-3p-inspired shRNA exhibits pro-chondrogenic and chondrocyte protective effects in osteoarthritis treatment through targeting SMAD6/7

Introduction: Osteoarthritis (OA) compromises patients’ quality of life and requires further study. Although miR-92a-3p was reported to possess chondroprotective effects, the underlying mechanism requires further clarification. The objectives of this study were to elucidate the mechanism by which miR-92a-3p alleviates OA and to examine the efficacy of shRNA-92a-3p, which was…

Continue Reading miR-92a-3p-inspired shRNA exhibits pro-chondrogenic and chondrocyte protective effects in osteoarthritis treatment through targeting SMAD6/7

Cathleen Lutz, MD, on the Potential of Stathmin-2 as an ALS-Specific Biomarker

Amyotrophic lateral sclerosis (ALS), a neuromuscular disease characterized by selective degeneration of upper and lower motor neurons, is currently lacking validating disease-specific biomarkers. The field has seen significant progress in expanding the therapeutic options available to patients, highlighted by the approvals of AMX0035 (Relyvrio; Amylyx) and tofersen (Qalsody; Biogen), the…

Continue Reading Cathleen Lutz, MD, on the Potential of Stathmin-2 as an ALS-Specific Biomarker

Acd Rat shRNA Plasmid (Locus ID 307798) Clinisciences

Product Data Locus ID 307798 Synonyms MGC116400 Vector pRS E. coli Selection Ampicillin Mammalian Cell Selection Puromycin Format Retroviral plasmids Kit Components Acd – Rat, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 307798). 5µg purified plasmid DNA per construct29-mer scrambled shRNA cassette in pRS Vector, TR30012,…

Continue Reading Acd Rat shRNA Plasmid (Locus ID 307798) Clinisciences

Electroporation of Oct4-specific shRNA expression vectors.

(A) Blastocyst development following electroporation of zygotes with custom Oct4-specific shRNA expression vectors at different concentrations and cultured for 3.5 d. (B) Blastocyst development following electroporation of zygotes with different shRNA expression vectors with a concentration of 100 µg/ml. (C) Morphological appearance of electroporated zygotes obtained from the control and…

Continue Reading Electroporation of Oct4-specific shRNA expression vectors.

TMEM154 siRNA Oligos set (Human)

siRNA and shRNA have the same intention and they are to silent gene expression by cleaving the target mRNA. However, their differences are as follows: a) siRNA (small interfering RNA) is a linear sequence that binds to the target mRNA and cleaves it, preventing the unwanted protein from being made…

Continue Reading TMEM154 siRNA Oligos set (Human)

Researchers study the link between the bacteria H. pylori and stomach cancer

NOD1 maintains epithelial homoeostasis in response to H. pylori infection. a, b Human AGS gastric epithelial cells stably expressing shRNA to either EGFP (shEGFP) or NOD1 (shNOD1) were stimulated with H. pylori (HP) 251 or left untreated (UT). c Confocal microscopy images of Nod1+/+ and Nod1−/− organoids showing E-cadherin+ epithelial…

Continue Reading Researchers study the link between the bacteria H. pylori and stomach cancer

Researchers study link between Helicobacter pylori and stomach cancer

This article has been reviewed in accordance with Science X’s editorial procedures and policies. Editors have emphasized the following attributes while ensuring the credibility of the content: Fact checked peer-reviewed publications Trusted source Proofreading OK! NOD1 maintains epithelial cell homeostasis in response to Helicobacter pylori infection. a, b Human AGS…

Continue Reading Researchers study link between Helicobacter pylori and stomach cancer

A two-kinesin mechanism controls neurogenesis in the developing brain

Reduced Kif13b expression increases the ratio of neurons to progenitors in the developing rat brain To compare the roles of Kif13B vs. Kif1A in rat brain cortical development, we injected embryonic day 16 (E16) rat embryos in utero with an empty GFP control plasmid, or shRNAs designed for knockdown of…

Continue Reading A two-kinesin mechanism controls neurogenesis in the developing brain

OAS2 Human shRNA Plasmid Kit (Locus ID 4939) Clinisciences

Product Data Locus ID 4939 Vector pRS E. coli Selection Ampicillin Mammalian Cell Selection Puromycin Format Retroviral plasmids Kit Components OAS2 – Human, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 4939). 5µg purified plasmid DNA per construct29-mer scrambled shRNA cassette in pRS Vector, TR30012, included for…

Continue Reading OAS2 Human shRNA Plasmid Kit (Locus ID 4939) Clinisciences

Addgene: pAAV-HDC-DIO-GFP-shRNA.scramble Sequences

> Addgene NGS Result CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGG CCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCCA TATGACCACCCCCCATGAAGTCTGTTGTGTAAGTACAGGTAATGCTTTAGACACTGTTTTTCTCAGATTG TGTTCAAGCTCTTGGGTGCAGGCATCCGCAGTCCAGAGCCTCTGAGGAACAAAGGGACCTCGATATAAAG AACAAAAAGCTCTCGGTATTCGGGAAAACTCCGAAGGATTTTTGTTGTTTTGTGGCAGTGTTGGGGTTCA GGACAAACACACCACCCCAGAATATGATTTCAGGAGAAACTGCCATCCCCGCCCCCACTAGTACGCTTCC TTTGTGTTATCTCGAGAAGCCCTGGACGTAGGAGGAGTTCTCAAAAGCTGTTCTTTCGTAAGAGATGGTC AGGAAGAAACGTTGATTAGGAAAAGTACTCGACTCAGGAAGAGGAGGGGTACAGATAACTGCTGTCACCA GAAAGATTTCCATCTGACAAAGTGGCAATTCTTCCCCCTTACGAATGTGTGTCCCGCACTCTGCTGCACC CAGGCTCCGCTCTGTTCTCCAGCTCTGCTTGCTGTAGAAGCGTCCATCCACTAAAGGGACTTCCAGATTT ATTGGCACTGAACAGGTTTTTCCTCCGTTAGCTTAAACAGTAGTCGAGGCAAAGAACCCAGAACAAGTGC TATGTAGTAATGGATAAAAAGAATCCTTCATATCCTGTTGTTGATCTGTCCTGAGCTCAGCCTGGCTAGC TATGGGCTTCTCTGAGCCGGCTCTGCCCTCACCTCATAGAGAAGCCAGGGCAGGAGCAACTCCACCCTCT GTGCTACTTATTGTGAATGCCCTTGGCCTATTTCTGGCCTCTGAGCTAGGAGCTTTATTCAAGGCTGGGG CTCTATGGTCTGAATGCAGGGGCAGGGATGATAGAGGGCTCTTTTACCTTGTCTATCCAGAGCTGCTTGT AGGCTTGGGAGGCTAGGTGCCCCAACTGGTCTAAAAACACCATGTTCTCTGATTCTGTTGATCAAAGTTC AAATCAGAAAGGACGGGGACAAGAGAGGCTGAAATTAAGCCTGAAGGAAGGGACTTTATGGGGGCGGGGC TAAAGGAGGGGAATAGGGAACTCCTTAAATAAGAGATGCACTGGCTGCCAGAGAGTGCACAGCACAGACA AAGGCGACCAAGAAGCCCTGTTGACAGCTGCCTTCCAGCCTCCTCTGTCTGTCTGCCAGGAGGAGCAATC CAAGGTCGACTCCGGAATAACTTCGTATAGGATACTTTATACGAAGTTATGCAGAATGGTAGCTGGATTG TAGCTGCTATTAGCAATATGAAACCTCTTAATAACTTCGTATAGCATACATTATACGAAGTTATGGCGCG CCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTT ATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGGTCGAACGCGTCGCCGCGTGTTTAAACG CATTAGTCTTCCAATTGAAAAAAGTGATTTAATTTATACCATTTTAATTCAGCTTTGTAAAAATGTATCA AAGAGATAGCAAGGTATTCAGTTTTAGTAAACAAGATAATTGCTCCTAAAGTAGCCCCTTGAATTCCGAG GCAGTAGGCAGGCTCCCGCTGAATTGGAATCCTACATCTGTGGCTTCACTAGGATTCCAATTCACGGGAG CTCGCTCACTGTCAACAGCAATATACCTTCTCGAGCCTTCTGTTGGGTTAACCTGAAGAAGTAATCCCAG CAAGTGTTTCCAAGATGTGCAGGCAACGATTCTGTAAAGTACTGAAGCCTCATTCAACATAGTATATGTG CTGCCGAAGCGAGCACTTAACAAGGCTTGCGGCCGCTACTTGTACAGCTCGTCCATGCCGAGAGTGATCC CGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTCAGGGCGGA CTGGGTGCTCAGGTAGTGGTTGTCGGGCAGCAGCACGGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAG TGGTCGGCGAGCTGCACGCTGCCGTCCTCGATGTTGTGGCGGATCTTGAAGTTCACCTTGATGCCGTTCT TCTGCTTGTCGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTT GCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCGAACTTCACC TCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGGGCA TGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGT CAGGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGC TTGCCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTACGTCGCCGTCCA GCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATGGTGGCGACCGGTAG CGCTAGCATAACTTCGTATAAAGTATCCTATACGAAGTTATTTGCCTTAACCCAGAAATTATCACTGTTA TTCTTTAGAATGGTGCAAAGAATAACTTCGTATAATGTATGCTATACGAAGTTATGAATTCGATATCAAG CTTATCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTC CTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCAT TTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGT GGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCC TTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTG…

Continue Reading Addgene: pAAV-HDC-DIO-GFP-shRNA.scramble Sequences

NFIB Human shRNA Plasmid Kit (Locus ID 4781) Clinisciences

Product Data Locus ID 4781 Synonyms CTF; HMGIC/NFIB; MACID; NF-I/B; NF1-B; NFI-B; NFI-RED; NFIB2; NFIB3 Vector pGFP-V-RS E. coli Selection Kanamycin Mammalian Cell Selection Puromycin Format Retroviral plasmids Kit Components NFIB – Human, 4 unique 29mer shRNA constructs in retroviral GFP vector(Gene ID = 4781). 5µg purified plasmid DNA per…

Continue Reading NFIB Human shRNA Plasmid Kit (Locus ID 4781) Clinisciences

GYPB Human shRNA Plasmid Kit (Locus ID 2994) Clinisciences

Product Data Locus ID 2994 Synonyms CD235b; GPB; GYP; GYPA; MNS; PAS-3; SS Vector pGFP-C-shLenti E. coli Selection Chloramphenicol (34 ug/ml) Mammalian Cell Selection Puromycin Format Lentiviral plasmids Kit Components GYPB – Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 2994). 5µg purified plasmid DNA per…

Continue Reading GYPB Human shRNA Plasmid Kit (Locus ID 2994) Clinisciences

AK2 Human shRNA Plasmid Kit (Locus ID 204) Clinisciences

Product Data Locus ID 204 Synonyms ADK2 Vector pGFP-C-shLenti E. coli Selection Chloramphenicol (34 ug/ml) Mammalian Cell Selection Puromycin Format Lentiviral plasmids Kit Components AK2 – Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 204). 5µg purified plasmid DNA per construct29-mer scrambled shRNA cassette in pGFP-C-shLenti…

Continue Reading AK2 Human shRNA Plasmid Kit (Locus ID 204) Clinisciences

[Research on the mechanism of mechanical ventilation induced endoplasmic reticulum stress promoting mechanical ventilation-induced pulmonary fibrosis]

Objective: To demonstrate the mechanism of mechanical ventilation (MV) induced endoplasmic reticulum stress (ERS) promoting mechanical ventilation-induced pulmonary fibrosis (MVPF), and to clarify the role of angiotensin receptor 1 (AT1R) during the process. Methods: The C57BL/6 mice were randomly divided into four groups: Sham group, MV group, AT1R-shRNA group and…

Continue Reading [Research on the mechanism of mechanical ventilation induced endoplasmic reticulum stress promoting mechanical ventilation-induced pulmonary fibrosis]

SIGIRR Human shRNA Lentiviral Particle (Locus ID 59307)

Product Data Locus ID 59307 Synonyms IL-1R8; TIR8 Vector pGFP-C-shLenti Format Lentiviral particles RefSeq NM_001135053, NM_001135054, NM_021805, NM_021805.1, NM_021805.2, NM_001135053.1, NM_001135054.1, BC003591, BC003591.1, BC025953, BC106007, NM_001135054.2, NM_001135053.2 UniProt ID Q6IA17 Summary Acts as a negative regulator of the Toll-like and IL-1R receptor signaling pathways. Attenuates the recruitment of receptor-proximal signaling…

Continue Reading SIGIRR Human shRNA Lentiviral Particle (Locus ID 59307)

IL6 Human shRNA Plasmid Kit (Locus ID 3569) Clinisciences

Product Data Locus ID 3569 Synonyms BSF-2; BSF2; CDF; HGF; HSF; IFN-beta-2; IFNB2; IL-6 Vector pRS E. coli Selection Ampicillin Mammalian Cell Selection Puromycin Format Retroviral plasmids Kit Components IL6 – Human, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 3569). 5µg purified plasmid DNA per construct29-mer…

Continue Reading IL6 Human shRNA Plasmid Kit (Locus ID 3569) Clinisciences

Gradalis wins $9.9m grant to fund Phase II trial for bi-shRNA therapy

Gradalis plans to conduct a Phase II trial that is intended to support an accelerated approval application for Vigil. Image Credit: Nemes Laszlo / Shutterstock. Gradalis has received a $9.9m product development research grant from the Cancer Prevention and Research Institute of Texas (CPRIT) to fund the Phase II ovarian…

Continue Reading Gradalis wins $9.9m grant to fund Phase II trial for bi-shRNA therapy

Gene Knockdown Market: Beating Growth Expectations

Gene Knockdown Market Latest Study on Industrial Growth of Gene Knockdown Market 2023-2029. A detailed study accumulated to offer the Latest insights about acute features of the Gene Knockdown market. The report contains different market predictions related to revenue size, production, CAGR, Consumption, gross margin, price, and other substantial factors….

Continue Reading Gene Knockdown Market: Beating Growth Expectations

CD96 Human shRNA Lentiviral Particle (Locus ID 10225)

Product Data Locus ID 10225 Synonyms TACTILE Vector pGFP-C-shLenti Format Lentiviral particles RefSeq NM_001318889, NM_005816, NM_198196, NR_134917, NM_198196.1, NM_198196.2, NM_005816.1, NM_005816.2, NM_005816.3, NM_005816.4, BC020749, BC027914, BM561433, NM_005816.5 UniProt ID P40200 Summary The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein. The…

Continue Reading CD96 Human shRNA Lentiviral Particle (Locus ID 10225)

Human DAZAP1 shRNA-Silencing Adenovirus, DAZ associated protein 1, NM_170711, NM_018959, BC012062, [Cat #shADV-206611]

About Storage Conditions All our viral products should be kept at -80°C. At this temperature, the virus will remain stable for 6-12 months (and in some cases, up to 2 years). Once thawed, the product can be stored at 4°C for 2-3 weeks without significant loss of biological activity.We recommend…

Continue Reading Human DAZAP1 shRNA-Silencing Adenovirus, DAZ associated protein 1, NM_170711, NM_018959, BC012062, [Cat #shADV-206611]

AMH Human shRNA Plasmid Kit (Locus ID 268) Clinisciences

Product Data Locus ID 268 Synonyms MIF; MIS Vector pRS E. coli Selection Ampicillin Mammalian Cell Selection Puromycin Format Retroviral plasmids Kit Components AMH – Human, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 268). 5µg purified plasmid DNA per construct29-mer scrambled shRNA cassette in pRS Vector,…

Continue Reading AMH Human shRNA Plasmid Kit (Locus ID 268) Clinisciences

IGF1 Receptor (IGF1R) Human shRNA Plasmid Kit (Locus ID)

Product Data Locus ID 3480 Synonyms CD221; IGFIR; IGFR; JTK13 Vector pRS E. coli Selection Ampicillin Mammalian Cell Selection Puromycin Format Retroviral plasmids Kit Components IGF1R – Human, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 3480). 5µg purified plasmid DNA per construct29-mer scrambled shRNA cassette in…

Continue Reading IGF1 Receptor (IGF1R) Human shRNA Plasmid Kit (Locus ID)

Advillin (AVIL) Human shRNA Plasmid Kit (Locus ID 10677)

Product Data Locus ID 10677 Synonyms ADVIL; DOC6; NPHS21; p92 Vector pGFP-C-shLenti E. coli Selection Chloramphenicol (34 ug/ml) Mammalian Cell Selection Puromycin Format Lentiviral plasmids Kit Components AVIL – Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 10677). 5µg purified plasmid DNA per construct29-mer scrambled shRNA…

Continue Reading Advillin (AVIL) Human shRNA Plasmid Kit (Locus ID 10677)

Celyad Oncology reports third quarter 2023 financial

Publication of data detailing the development of our microRNA (miRNA)-based multiplex shRNA approach, which allows to down-regulate several genes simultaneously, in Molecular Therapy – Nucleic Acids Five posters were presented at the 38th SITC Annual Meeting and two posters were presented at the 4th ICLE conference, with further developments in…

Continue Reading Celyad Oncology reports third quarter 2023 financial

CHRNA2 Human shRNA Plasmid Kit (Locus ID 1135) Quimigen

Product Data Locus ID 1135 Vector pRS E. coli Selection Ampicillin Mammalian Cell Selection Puromycin Format Retroviral plasmids Kit Components CHRNA2 – Human, 4 unique 29mer shRNA constructs in retroviral untagged vector(Gene ID = 1135). 5µg purified plasmid DNA per construct29-mer scrambled shRNA cassette in pRS Vector, TR30012, included for…

Continue Reading CHRNA2 Human shRNA Plasmid Kit (Locus ID 1135) Quimigen

MISSION pLKO.1-puro TurboGFP shRNA Control Transduction Particles High Titer – Effective Gene Silencing

Product Name: MISSION® pLKO.1-puro TurboGFP™ shRNA Control Transduction Particles, High Titer The MISSION® pLKO.1-puro TurboGFP™ shRNA Control Transduction Particles, High Titer, provide a highly efficient solution for targeted gene silencing. These particles offer a high titer shRNA sequence specifically designed to target tGFP, ensuring effective knockdown of the desired gene…

Continue Reading MISSION pLKO.1-puro TurboGFP shRNA Control Transduction Particles High Titer – Effective Gene Silencing

MISSION TRC2 pLKO.5-puro Non-Target shRNA Control Transduction Particles – Reliable Negative Control

MISSION TRC2 pLKO.5-puro Non-Target shRNA Control Transduction Particles – Reliable Negative Control Are you in search of a reliable non-target shRNA control for your experiments? Look no further than the MISSION TRC2 pLKO.5-puro Non-Target shRNA Control Transduction Particles. These particles are designed to target no known genes from any species,…

Continue Reading MISSION TRC2 pLKO.5-puro Non-Target shRNA Control Transduction Particles – Reliable Negative Control

Fibronectin (FN1) Human shRNA Plasmid Kit (Locus ID 2335)

Product Data Locus ID 2335 Synonyms CIG; ED-B; FINC; FN; FNZ; GFND; GFND2; LETS; MSF; SMDCF Vector pGFP-V-RS E. coli Selection Kanamycin Mammalian Cell Selection Puromycin Format Retroviral plasmids Kit Components FN1 – Human, 4 unique 29mer shRNA constructs in retroviral GFP vector(Gene ID = 2335). 5µg purified plasmid DNA…

Continue Reading Fibronectin (FN1) Human shRNA Plasmid Kit (Locus ID 2335)

ncRNA | Free Full-Text | Dysregulation of Non-Coding RNAs: Roles of miRNAs and lncRNAs in the Pathogenesis of Multiple Myeloma

4. Dysregulation of lncRNAs in MM In recent years, numerous studies have focused on the role of lncRNAs in MM pathogenesis. Since then, the role of aberrantly expressed lncRNAs in MM has been reported, highlighting the potential in clinical applications. For instance, lncRNAs participate in the differentiation of erythroid, myeloid,…

Continue Reading ncRNA | Free Full-Text | Dysregulation of Non-Coding RNAs: Roles of miRNAs and lncRNAs in the Pathogenesis of Multiple Myeloma

Carisma to Present First Results From in vivo CAR-M Collaboration with Moderna at SITC 2023

PHILADELPHIA, PA — Carisma Therapeutics Inc. (Nasdaq: CARM) announced that new pre-clinical data leveraging an mRNA platform to develop in-vivo chimeric antigen receptor macrophage (“CAR-M”) will be presented as a late-breaking abstract (#LBA1514) at the upcoming Society for Immunotherapy of Cancer (SITC) 38th Annual Meeting held from Wednesday, November 1, to Sunday, November 5, 2023, in San Diego,…

Continue Reading Carisma to Present First Results From in vivo CAR-M Collaboration with Moderna at SITC 2023

Lenti-hU6 (MCS)-CBh (gcGFP)-Puro, RNAi, 3 shRNA (Lenti-GTK0001WQ)

Online Inquiry For Research Use Only. Do NOT use in humans or animals. For Research Use Only. Do NOT use in humans or animals. The product Cat#Lenti-GTK0001WQ contains 3 shRNA encoding lentivirus and 1 negative control lentivirus. The product is suitable for the study of gene function using the same…

Continue Reading Lenti-hU6 (MCS)-CBh (gcGFP)-Puro, RNAi, 3 shRNA (Lenti-GTK0001WQ)

A. (1 pt) A small hairpin RNA (shRNA) is used to

Transcribed image text: A. (1 pt) A small hairpin RNA (shRNA) is used to knockdown the CB1 receptor. What impact does this have on LTD relative to the control, whose data is represented by the black tringles labeled “Scrambled sequence” (Panel D, right)? B. (1 pt) In the middle graph…

Continue Reading A. (1 pt) A small hairpin RNA (shRNA) is used to

Carisma to Present First Results From in vivo CAR-M Collaboration with Moderna at SITC 2023 | DNA RNA and Cells

Carisma to Present First Results From in vivo CAR-M Collaboration with Moderna at SITC 2023 Details Category: DNA RNA and Cells Published on Thursday, 26 October 2023 11:41 Hits: 269 -Late-breaking abstract to be presented on November 3rd at 11:30 am PT highlighting pre-clinical data with Moderna -Two additional…

Continue Reading Carisma to Present First Results From in vivo CAR-M Collaboration with Moderna at SITC 2023 | DNA RNA and Cells

B4GALT5 shRNA Plasmid Mouse) – Gentaur.com

Catalog number MBS8274761 Price Please ask Size 0,15 mg Other size please contact us to order other different size Test Mouse or mice from the Mus musculus species are used for production of mouse monoclonal antibodies or mabs and as research model for humans in your lab. Mouse are mature after 40…

Continue Reading B4GALT5 shRNA Plasmid Mouse) – Gentaur.com

WDR47 shRNA Plasmid | Technique alternative

Kit Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however,…

Continue Reading WDR47 shRNA Plasmid | Technique alternative

GPP Web Portal – Gene Details

Gene: Human LOC642131 (642131) immunoglobulin IGHV1OR15-3-like pseudogene Source: NCBI, updated 2019-09-11 Taxon: Homo sapiens (human) Chromosome: 15 Wildtype Transcripts: NR_135667.1 Additional Resources: NBCI Gene record: LOC642131 (642131) NCBI Gene records for discontinued versions of this gene: LOC102724835 (102724835) sgRNA constructs originally intended to target this gene (CRISPRko, NGG PAM) NOTE:…

Continue Reading GPP Web Portal – Gene Details

Intrinsic targeting of host RNA by Cas13 constrains its utility

Abudayyeh, O. O. et al. C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science 353, aaf5573 (2016). Article  PubMed  PubMed Central  Google Scholar  Terns, M. P. CRISPR-based technologies: impact of RNA-targeting systems. Mol. Cell 72, 404–412 (2018). Article  CAS  PubMed  PubMed Central  Google Scholar  Abudayyeh, O. O. et al….

Continue Reading Intrinsic targeting of host RNA by Cas13 constrains its utility

CBS shRNA Plasmid | Technique alternative

About Rats are used to make rat monoclonal anti mouse antibodies. There are less rat- than mouse clones however. Rats genes from rodents of the genus Rattus norvegicus are often studied in vivo as a model of human genes in Sprague-Dawley or Wistar rats. Kit Plasmid mini made and maxi DNA purification kits…

Continue Reading CBS shRNA Plasmid | Technique alternative

Pseudogene MAPK6P4-encoded functional peptide promotes glioblastoma vasculogenic mimicry development

Gusyatiner, O. & Hegi, M. E. Glioma epigenetics: from subclassification to novel treatment options. Semin. Cancer Biol. 51, 50–58 (2018). Article  PubMed  Google Scholar  Kunnakkat, S. & Narayana, A. Bevacizumab in the treatment of high-grade gliomas: an overview. Angiogenesis 14, 423–430 (2011). Article  PubMed  Google Scholar  Luo, Q. et al….

Continue Reading Pseudogene MAPK6P4-encoded functional peptide promotes glioblastoma vasculogenic mimicry development

Generation of UL128-shRNA transduced fibroblasts for the release of cell-free virus from clinical human cytomegalovirus isolates

Human cytomegalovirus (HCMV) is a herpesvirus that is widespread in the population worldwide [1,2], where it remains latent after infection in its host for a lifetime [3–5]. While primary infection or reactivation in immunocompetent individuals usually remains subclinical and causes little or no symptoms, it can cause severe damage in…

Continue Reading Generation of UL128-shRNA transduced fibroblasts for the release of cell-free virus from clinical human cytomegalovirus isolates

The Therapeutic Effects of MUC1-C shRNA@Fe3O4 Magnetic Nanoparticles in Alternating Magnetic Fields on Triple-Negative Breast Cancer

Purpose: Improving the treatment of triple-negative breast cancer (TNBC) is a serious challenge today. The primary objective of this study was to construct MUC1-C shRNA@ Fe3O4 magnetic nanoparticles (MNPs) and investigate their potential therapeutic benefits in alternating magnetic fields (AMF) on TNBC. Methods: Firstly, we verified the high expression of…

Continue Reading The Therapeutic Effects of MUC1-C shRNA@Fe3O4 Magnetic Nanoparticles in Alternating Magnetic Fields on Triple-Negative Breast Cancer

PSBPC2 shRNA Plasmid Rat) – Gentaur.com

Catalog number MBS8288712 Price Please ask Size 0,15 mg Other size please contact us to order other different size Kit Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell…

Continue Reading PSBPC2 shRNA Plasmid Rat) – Gentaur.com

ROLE OF CATECHOLAMINERGIC A2 NEURONS OF NUCLEUS OF THE SOLITARY TRACT (NTS) IN CARDIOVASCULAR AND RESPIRATORY ADAPTATIONS TO CHRONIC INTERMITTENT HYPOXIA (CIH) IN RATS

Purpose: To understand the effect of CIH on the mRNA expression levels of AT1a, AT1b and excitatory amino acid (EAAs) receptor subunits in the A2 neurons of NTS and to assess the effect of tyrosine hydroxylase (TH) knockdown in A2 neurons on the cardiovascular responses to CIH Methods: Adult male…

Continue Reading ROLE OF CATECHOLAMINERGIC A2 NEURONS OF NUCLEUS OF THE SOLITARY TRACT (NTS) IN CARDIOVASCULAR AND RESPIRATORY ADAPTATIONS TO CHRONIC INTERMITTENT HYPOXIA (CIH) IN RATS

Government Funding Propels Global Synthetic Biology Market, Valued at $11.24 Billion in 2022

Company Logo Dublin, Oct. 05, 2023 (GLOBE NEWSWIRE) — The “Synthetic Biology Market by Product, Application, Technology, End User, and by Region – Global Forecast to 2023-2033” report has been added to ResearchAndMarkets.com‘s offering. The global synthetic biology market, which was valued at USD 11.24 billion in 2022, is poised…

Continue Reading Government Funding Propels Global Synthetic Biology Market, Valued at $11.24 Billion in 2022

The Therapeutic Effects of MUC1-C shRNA@Fe3O4 Magnetic Nanoparticles i

Introduction Breast cancer (BC) is a malignant tumor originating from the epithelial tissue of the breast and is the most common malignancy in women.1 It is estimated that by 2040, there will be 3,000,000 new cases of BC and 100,000 deaths worldwide. Triple-negative breast cancer (TNBC), which accounts for 15–20%…

Continue Reading The Therapeutic Effects of MUC1-C shRNA@Fe3O4 Magnetic Nanoparticles i

Direct screening for effective shRNA with a single mismatch in human cells without laborious cloning

Biosci Biotechnol Biochem . 2023 Oct 4:zbad143. doi: 10.1093/bbb/zbad143. Online ahead of print. Affiliations Expand Affiliation 1 Department of Chemistry and Bioengineering, Division of Science and Engineering for Materials, Chemistry and Biology, Graduate School of Engineering, Osaka Metropolitan University, Sugimoto 3-3-138, Sumiyoshi-ku, Osaka, Japan. Item in Clipboard Mayu Tachibana et al….

Continue Reading Direct screening for effective shRNA with a single mismatch in human cells without laborious cloning

Custom shRNA Library Cloning

Complex pooled RNAi Libraries for genetic screening Cellecta offers custom shRNA libraries for functional gene screening in addition to their off-shelf shRNA libraries. Custom shRNA libraries for any set of genes in 7 weeks RNA-specific barcodes obviate the need to PCR and sequence difficult hairpin structures Libraries can be provided…

Continue Reading Custom shRNA Library Cloning

SL-scan identifies synthetic lethal interactions in cancer using metabolic networks

Datasets The gene expression data, mutation data, CRISPR, and drug perturbation data sets used in this study were obtained from the Depmap project depmap.org/portal/download/all/. The gene expression data set consists of the log2 transformed transcript per million (TPM) values of 19,221 protein-coding genes from 1406 cell lines across 33 cancer…

Continue Reading SL-scan identifies synthetic lethal interactions in cancer using metabolic networks

Upregulation of WDR6 drives hepatic de novo lipogenesis in insulin resistance in mice

WDR6 is upregulated in response to insulin during insulin resistance We created an IR mouse model by feeding animals a HFD for 6 weeks20. Insulin injection was then performed (Fig. 1a). The phosphorylation of AKT, a key readout of the insulin signalling pathway21, showed decreased response to insulin, indicating resistance…

Continue Reading Upregulation of WDR6 drives hepatic de novo lipogenesis in insulin resistance in mice

Research identifies new drug target to beat cancer drug resistance

Inhibition of OGT blocks therapy-induced cellular reprogramming preventing tumor recurrence. a, Crystal violet staining of shOGT and shControl WM164 and A549 following exposure to dabrafenib (50nM) or docetaxel (5nM), respectively, for 45 days (left panels). Immunoblotting of OGT in WM164 and A549 (right panels) following transfection with shRNA targeting OGT….

Continue Reading Research identifies new drug target to beat cancer drug resistance

Combination of HBV Immunotherapy with shRNA

DID YOU KNOW? DTIC has over 3.5 million final reports on DoD funded research, development, test, and evaluation activities available to our registered users. Click HERE to register or log in. AD1208686 Combination of HBV Immunotherapy with shRNA – Mediated PD-1/PDL Checkpoint Inhibition for Treatment of Chronic HBV 2023-10-01 More…

Continue Reading Combination of HBV Immunotherapy with shRNA

MAST4 promotes primary ciliary resorption through phosphorylation of Tctex-1

Introduction The primary cilium (9 + 0 architecture) is a microtubule-based immotile sensory organelle in vertebrates (Tucker et al, 1979). Enormous progress has been made in the past several decades concerning our understanding of the structure and functions of the primary cilium (Sung & Leroux, 2013). The subdomain between the…

Continue Reading MAST4 promotes primary ciliary resorption through phosphorylation of Tctex-1

Orthogonal Validation: A Means To Strengthen Gene Editing and Gene Modulation Research

From RNA interference (RNAi) to CRISPR, there are several methods that researchers can use to manipulate gene function, each with its own strengths and weaknesses. Orthogonal validation – the synergistic use of different methods – makes genetic perturbation studies more robust. Utilizing complementary methods, including RNAi and CRISPR-knockout, -interference and…

Continue Reading Orthogonal Validation: A Means To Strengthen Gene Editing and Gene Modulation Research

Gene Knockdown Market Size, Share 2023 To 2030

PRESS RELEASE Published September 18, 2023 The “Gene Knockdown” market research report provides a comprehensive analysis of the global market for Gene Knockdown Market. It offers insights into market trends, growth drivers, challenges, and key players. The report covers product types, applications, and regional segments, detailing market size, share, and…

Continue Reading Gene Knockdown Market Size, Share 2023 To 2030

Addgene: shRNA-Ratio-PosCon

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications. For your Materials & Methods section: shRNA-Ratio-PosCon was a gift from Erik Dent (Addgene plasmid # 183553…

Continue Reading Addgene: shRNA-Ratio-PosCon

Rat Mapt shRNA-Silencing Adenovirus, microtubule-associated protein tau, NM_017212, BC126095, [Cat #shADV-295154]

About Storage Conditions All our viral products should be kept at -80°C. At this temperature, the virus will remain stable for 6-12 months (and in some cases, up to 2 years). Once thawed, the product can be stored at 4°C for 2-3 weeks without significant loss of biological activity.We recommend…

Continue Reading Rat Mapt shRNA-Silencing Adenovirus, microtubule-associated protein tau, NM_017212, BC126095, [Cat #shADV-295154]

Global Gene Knockdown Market 2023-2030: COVID-19, Russia-Ukraine War, SWOT and Porter’s Analysis

Gene Knockdown Market 2023-2030 Latest Research Report provides [108 Pages Report] with a detailed analysis of qualitative and quantitative research such as interviews, focus groups, observations, content analysis, numerical data, and applying statistical methods for analysis. This research aims to quantify relationships, patterns, and trends within the data. Moreover, this…

Continue Reading Global Gene Knockdown Market 2023-2030: COVID-19, Russia-Ukraine War, SWOT and Porter’s Analysis

CCDC50, an essential driver involved in tumorigenesis, is a potential severity marker of diffuse large B cell lymphoma

Data collection and bioinformatic analysis GSE10846, GSE19246, GSE32918, GSE50721, GSE64820, and GSE94669, were downloaded from the Gene Expression Omnibus database (www.ncbi.nlm.nih.gov/geo/). DLBCL datasets from the GEPIA (Gene Expression Profiling Interactive Analysis) (gepia.cancer-pku.cn) and the TCGA (The Cancer Genome Atlas) (xenabrowser.net/datapages/) were also used in this study. A total of 284…

Continue Reading CCDC50, an essential driver involved in tumorigenesis, is a potential severity marker of diffuse large B cell lymphoma

Development of short hairpin RNA expression vectors targeting the internal ribosomal entry site of the classical swine fever virus genomic RNA | BMC Biotechnology

Design of siRNA targeting CSFV-IRES domain III region The CSFV-IRES-expressing cells were established using the pCAG vector and swine SK-L and human HEK293 (pCI5) cells (Additional file 1: Fig. S1) as previously described [15]. The CSFV-IRES activity was measured as the ratio of firefly luciferase (F-luc) to renilla luciferase (RL)…

Continue Reading Development of short hairpin RNA expression vectors targeting the internal ribosomal entry site of the classical swine fever virus genomic RNA | BMC Biotechnology

MCMBP shRNA Plasmid Mouse) – Gentaur.com

Catalog number MBS8280724 Price Please ask Size 0,15 mg Other size please contact us to order other different size Test Mouse or mice from the Mus musculus species are used for production of mouse monoclonal antibodies or mabs and as research model for humans in your lab. Mouse are mature after 40…

Continue Reading MCMBP shRNA Plasmid Mouse) – Gentaur.com

Chapter – shRNA-Nanoparticle Conjugate as a Therapeutic Option

The recent trend of gene therapy includes the RNAi therapeutic approach. RNAi therapy comprises the delivery of siRNA, shRNA and miRNA molecules to the cells for gene silencing. Among these types, shRNA is a more stable knockdown method. However, bare shRNA molecules are large and they can not penetrate the…

Continue Reading Chapter – shRNA-Nanoparticle Conjugate as a Therapeutic Option

Exosomal circEZH2_005, an intestinal injury biomarker, alleviates intestinal ischemia/reperfusion injury by mediating Gprc5a signaling

Human plasma collection Fifty patients who were assigned for CPB surgery between May 2021 and February 2022 at the Department of Cardiac Surgery, Southern Medical University Nanfang Hospital (Guangzhou, China) were recruited given their increased risk of intestinal I/R injury. In patients undergoing cardiac surgery, CPB is potentially responsible for…

Continue Reading Exosomal circEZH2_005, an intestinal injury biomarker, alleviates intestinal ischemia/reperfusion injury by mediating Gprc5a signaling

Celyad Oncology Reports First Half 2023 Financial Results and Recent Business Highlights

Celyad Oncology SA Georges Rawadi was appointed Chief Executive Officer as from April 27, 2023 Celyad Oncology has received approximately EUR 9.8m in private placement commitments from historical shareholders Encouraging progress in multiplex shRNA platform development, which allows now targeting of up to four genes simultaneously, were presented at international…

Continue Reading Celyad Oncology Reports First Half 2023 Financial Results and Recent Business Highlights

Director, Bioinformatics – Richmond | Mendeley Careers

Title: Director, Bioinformatics Manager: VP, Bioinformatics Department: ResearchLocation: Richmond / Remote Sangamo Therapeutics is a genomic medicine company building value with cutting-edge work across four distinct but complementary technology platforms – gene therapy, cell therapy, in vivo genome editing, and in vivo genome regulation. Using its deep scientific expertise and…

Continue Reading Director, Bioinformatics – Richmond | Mendeley Careers

CPS1 shRNA Plasmid Human) – Gentaur.com

Catalog number MBS8251016 Price Please ask Size 0,15 mg Other size please contact us to order other different size Properties Human proteins, cDNA and human recombinants are used in human reactive ELISA kits and to produce anti-human mono and polyclonal antibodies. Modern humans (Homo sapiens, primarily ssp. Homo sapiens sapiens). Depending on the epitopes…

Continue Reading CPS1 shRNA Plasmid Human) – Gentaur.com

ECM29 shRNA Plasmid Human) – Gentaur.com

Catalog number MBS8258289 Price Please ask Size 0,15 mg Other size please contact us to order other different size Properties Human proteins, cDNA and human recombinants are used in human reactive ELISA kits and to produce anti-human mono and polyclonal antibodies. Modern humans (Homo sapiens, primarily ssp. Homo sapiens sapiens). Depending on the epitopes…

Continue Reading ECM29 shRNA Plasmid Human) – Gentaur.com

Silencing of FCRLB by shRNA ameliorates MuSK-induced EAMG in mice,Journal of Neuroimmunology

Introduction Muscle specific kinase (MuSK) antibody positive myasthenia gravis (MG) often presents with a severe disease course and resistance to treatment. Treatment-refractory patients may respond to B cell depleting treatment methods. Our aim was to investigate whether inhibition of Fc receptor–like B (FCRLB) could effectively suppress autoimmunity without diminishing B…

Continue Reading Silencing of FCRLB by shRNA ameliorates MuSK-induced EAMG in mice,Journal of Neuroimmunology

Purinergic neurotransmission receptor P2X4 silencing alleviates intracerebral hemorrhage-induced neuroinflammation by blocking the NLRP1/Caspase-1 pathway

Mouse ICH model The 8-week-old male CD1 mice (Charles River, Wilmington, USA) weighing 30–32 g were used for the establishment of the ICH model. In the brain tissue surrounding the hematoma in the right basal ganglia region, collagenase was injected into the right basal ganglia to induce ICH. Then, all mice…

Continue Reading Purinergic neurotransmission receptor P2X4 silencing alleviates intracerebral hemorrhage-induced neuroinflammation by blocking the NLRP1/Caspase-1 pathway

Creative Biolabs Will Present Exosome Solutions at the Upcoming Exosome-Based Summit

PRESS RELEASE Published August 30, 2023 The ever-evolving landscape of exosome therapy has garnered widespread attention from the medical community worldwide. In this dynamic arena, Creative Biolabs is poised to unveil its state-of-the-art exosome-related services at the highly anticipated 5th Exosome Based Therapeutic Development Summit. New York, USA – August…

Continue Reading Creative Biolabs Will Present Exosome Solutions at the Upcoming Exosome-Based Summit

Celyad Oncology receives approximately EUR 9.8m in private placement commitments from historical shareholders

Celyad Oncology SA MONT-SAINT-GUIBERT, Belgium, Aug. 24, 2023 (GLOBE NEWSWIRE) — regulated information / inside information – Celyad Oncology SA (“Celyad” or the “Company”) today announced that it has obtained commitments from an affiliate of Fortress Investment Group (such affiliate, “Fortress”), Tolefi SA (“Tolefi”), and other historical shareholders to subscribe…

Continue Reading Celyad Oncology receives approximately EUR 9.8m in private placement commitments from historical shareholders

CircRNA-CIRH1A Promotes the Development of Osteosarcoma by Regulating PI3K/AKT and JAK2/STAT3 Signaling Pathways

Tissue Collection The study was approved by the Medical Ethics Committee at the Fuyang Traditional Chinese Medicine Orthopedics Hospital (2019-F027). OS tumor tissues and adjacent normal tissues were collected from 40 patients diagnosed with OS at the Fuyang Traditional Chinese Medicine Orthopedics Hospital from June 2018 to Dec 2019. Patient…

Continue Reading CircRNA-CIRH1A Promotes the Development of Osteosarcoma by Regulating PI3K/AKT and JAK2/STAT3 Signaling Pathways

C3orf14 shRNA Plasmid Human) – Gentaur.com

Catalog number MBS8261494 Price Please ask Size 0,15 mg Other size please contact us to order other different size Properties Human proteins, cDNA and human recombinants are used in human reactive ELISA kits and to produce anti-human mono and polyclonal antibodies. Modern humans (Homo sapiens, primarily ssp. Homo sapiens sapiens). Depending on the epitopes…

Continue Reading C3orf14 shRNA Plasmid Human) – Gentaur.com

A Novel Method Transforms Human Skin Cells Into Pluripotent Stem Cells

Description Researchers from the Indian Institute of Technology (IIT) Guwahati and the Christian Medical College in Vellore have successfully devised a technology for transforming ordinary human skin cells into pluripotent stem cells known as Induced Pluripotent Stem Cells (iPSCs). Unlike traditional procedures that involve collecting stem cells from embryos or…

Continue Reading A Novel Method Transforms Human Skin Cells Into Pluripotent Stem Cells

Breakthrough Method Converts Human Skin Cells into Pluripotent Stem Cells

August 18, 2023 Researchers from the Indian Institute of Technology (IIT) Guwahati and Christian Medical College, Vellore, have successfully developed a technique to transform regular human skin cells into pluripotent stem cells, known as Induced Pluripotent Stem Cells (iPSCs). Unlike conventional methods that involve extracting stem cells from embryos or…

Continue Reading Breakthrough Method Converts Human Skin Cells into Pluripotent Stem Cells

Human Neural Stem Cells Show Therapeutic Potential for Spinal Cord Injury Treatment

Researchers from the University of Hong Kong (HKUMed) LKS Faculty of Medicine and City University of Hong Kong (CityU) have successfully generated human neural stem cells (hNSCs) with strong therapeutic potential for the treatment of spinal cord injury (SCI). By reducing the expression of the SOX9 gene, the team found…

Continue Reading Human Neural Stem Cells Show Therapeutic Potential for Spinal Cord Injury Treatment

Tcf7 – 714 siRNA/shRNA/RNAi Lentivector (Mouse) (Target d) – i042401d

Catalog Number: ABM-463850940795 Product Overview Article Name: Tcf7 – 714 siRNA/shRNA/RNAi Lentivector (Mouse) (Target d) – i042401d Biozol Catalog Number: ABM-463850940795 Supplier Catalog Number: 463850940795 Alternative Catalog Number: ABM-463850940795 Manufacturer: Applied Biological Materials Category: Molekularbiologie Species Reactivity: Mouse Product Properties Source: Puromycin Sequence: TACGTCCAAGGTCGGGCAGGAAGA Target: TGAACTGGCCCGCAAGGAAAGGCAGCTGC Read more here: Source…

Continue Reading Tcf7 – 714 siRNA/shRNA/RNAi Lentivector (Mouse) (Target d) – i042401d

Researchers At IIT Guwahati Produces Pluripotent Stem Cells From Skin Cells

Researchers At IIT Guwahati Produces Pluripotent Stem Cells From Skin Cells | IANS Guwahati: Researchers from the Indian Institute of Technology (IIT) Guwahati in collaboration with scientists from Christian Medical College, Vellore, have reported a method to convert regular human skin cells into pluripotent stem cells. Explaining the basics of…

Continue Reading Researchers At IIT Guwahati Produces Pluripotent Stem Cells From Skin Cells

Skin Cells Transformed Into Pluripotent Stem Cells For Regenerative Therapy

IIT Guwahati Leads in Producing Pluripotent Stem Cells from Skin Cells GUWAHATI, August 16, 2023: In a monumental stride for regenerative medicine, a collaborative research effort led by the Indian Institute of Technology Guwahati (IITG) has successfully transformed regular human skin cells into pluripotent stem cells. Spearheaded by Dr. Rajkumar…

Continue Reading Skin Cells Transformed Into Pluripotent Stem Cells For Regenerative Therapy

Multi institutional team led by IIT Guwahati produces pluripotent stem cells from skin cells

Researchers from the Indian Institute of Technology Guwahati (IITG) in collaboration with scientists from Christian Medical College, Vellore, have reported a method to convert regular human skin cells into pluripotent stem cells. “The human body is made of many kinds of cells – nerve cells, heart cells, liver cells, pancreatic…

Continue Reading Multi institutional team led by IIT Guwahati produces pluripotent stem cells from skin cells

Photo-dependent cytosolic delivery of shRNA into a single blastomere in a mouse embryo

Li, L., Zheng, P. & Dean, J. Maternal control of early mouse development. Development 137, 859–870 (2010). Article  CAS  PubMed  PubMed Central  Google Scholar  Nowotschin, S. & Hadjantonakis, A.-K. Cellular dynamics in the early mouse embryo: From axis formation to gastrulation. Curr. Opin. Genet. Dev. 20, 420–427 (2010). Article  CAS …

Continue Reading Photo-dependent cytosolic delivery of shRNA into a single blastomere in a mouse embryo

Gene Knockdown Market Financial Performance, Strategic Developments, and Key Trends 2023-2030 With Santa Cruz Biotechnology (US), OriGene (US), Sigma-Aldrich (US)

PRESS RELEASE Published August 9, 2023 A biological method called gene knockdown is used to lower the expression of a certain gene in an organism’s cells. This is often accomplished by introducing short RNA molecules that are complementary to the messenger RNA (mRNA) of the target gene, such as small…

Continue Reading Gene Knockdown Market Financial Performance, Strategic Developments, and Key Trends 2023-2030 With Santa Cruz Biotechnology (US), OriGene (US), Sigma-Aldrich (US)

Rhox6 regulates the expression of distinct target genes to mediate mouse PGCLC formation and ESC self-renewal | Cell & Bioscience

Overexpression of Rhox6 promotes PGCLC formation To discover potential candidate genes that may be important for the specification of mouse PGCs, we analyzed the transcriptional data of E9.5 PGCs and epiblasts and found that the homeobox family members Rhox6 and Rhox9, as well as the PGC markers Prdm14, Blimp1, Stella…

Continue Reading Rhox6 regulates the expression of distinct target genes to mediate mouse PGCLC formation and ESC self-renewal | Cell & Bioscience

Human U6 promoter drives stronger shRNA activity than its schistosome orthologue in Schistosoma mansoni and human fibrosarcoma cells

Human U6 promoter drives stronger shRNA activity than its schistosome orthologue in Schistosoma mansoni and human fibrosarcoma cells – Fingerprint — Aberystwyth Research Portal Sort by Weight Alphabetically Medicine and Dentistry Schistosoma 100% Promoter Region 50% Short Hairpin RNA 33% Fibrosarcoma Cell 25% Gene Promoter 25% Schistosoma Mansoni 16% Luciferase…

Continue Reading Human U6 promoter drives stronger shRNA activity than its schistosome orthologue in Schistosoma mansoni and human fibrosarcoma cells

SCX shRNA Plasmid Human) – Gentaur.com

Catalog number MBS8268491 Price Please ask Size 0,15 mg Other size please contact us to order other different size Properties Human proteins, cDNA and human recombinants are used in human reactive ELISA kits and to produce anti-human mono and polyclonal antibodies. Modern humans (Homo sapiens, primarily ssp. Homo sapiens sapiens). Depending on the epitopes…

Continue Reading SCX shRNA Plasmid Human) – Gentaur.com

PCDH3 shRNA Plasmid Rat) – Gentaur.com

Catalog number MBS8284868 Price Please ask Size 0,15 mg Other size please contact us to order other different size Kit Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell…

Continue Reading PCDH3 shRNA Plasmid Rat) – Gentaur.com

Inhibition of HIV-1 infection by a unique short hairpin RNA to chemokine receptor 5 delivered into macrophages through hematopoietic progenitor cell transduction.

Return to Grants Authors: Min Liang, Masakazu Kamata, Kevin N Chen, Nonia Pariente, Dong Sung An, Irvin S Y Chen Public Summary: We recently expressed a potent and noncytotoxic short hairpin (sh)RNA directed against chemokine (c-c motif) receptor 5 (CCR5) using lentiviral mediated transduction of CD34+ hematopoietic progenitor cells (HPCs)…

Continue Reading Inhibition of HIV-1 infection by a unique short hairpin RNA to chemokine receptor 5 delivered into macrophages through hematopoietic progenitor cell transduction.

ATP6V1A shRNA Plasmid Human) – Gentaur.com

Catalog number MBS8250417 Price Please ask Size 0,15 mg Other size please contact us to order other different size Properties Human proteins, cDNA and human recombinants are used in human reactive ELISA kits and to produce anti-human mono and polyclonal antibodies. Modern humans (Homo sapiens, primarily ssp. Homo sapiens sapiens). Depending on the epitopes…

Continue Reading ATP6V1A shRNA Plasmid Human) – Gentaur.com

Solved please help me with these 3 questions!! please answer

please help me with these 3 questions!! please answer them separately +++++++++++ (Question 1)Figure 1 shows an experiment in which CD41a-expressing megakaryocyte progenitor cells were generated from human ES cells.In the graph of Figure 1C, we found that the proliferative ability of megakaryocyte progenitor cells induced by introducing a gene…

Continue Reading Solved please help me with these 3 questions!! please answer

Oligonucleotide API Market Expected to Witness Significant Growth, Reaching US$ 5.36 Billion by 2030

The demand for oligonucleotide APIs is anticipated to increase from 2022 to 2030 at a high CAGR of 10.2% due to the growing need for new drug classes. As a result, it is anticipated that by the end of 2030, the global oligonucleotide API market will have grown from a…

Continue Reading Oligonucleotide API Market Expected to Witness Significant Growth, Reaching US$ 5.36 Billion by 2030