Tag: SRA

job summary: As the largest staffing and recruitment agency in the world, we can commit to finding you the perfect role that gives you the opportunity to learn and grow in the life sciences arena. Utilizing a recruiter for your job search gives you access to a large network of…

Same GEO Accession, different SRR number, how to download this RNA-seq paired-end data? 0 I am trying to download some public RNA-seq data (paired-end) and I have encountered that there are some samples that have the same GEO Accession but different SRR number (and different sizes). Therefore, when I download…

On-Board Services is hiring for a Scientist Translational Bioinformatics position, in Lawrenceville, NJ! For immediate consideration please send your resume to resumes@onboardusa.comSubject Line: Position Title and State you are LocatedAbout Us On-Board Services, Incorporated is an on-site contract service provider for a local manufacturing entity providing full time positions to…

Yang, Q. L., Gao, T. X. & Miao, Z. Q. Differentiation between populations of Japanese grenadier anchovy (Coilia nasus) in Northwestern Pacific based on ISSR markers: Implications for biogeography. Biochem Syst and Ecol 39, 286–296 (2011). CAS  Google Scholar  Shen, H. S. et al. In-depth transcriptome analysis of Coilia ectenes,…

Embryo transcriptome 0 Hello, I am looking for a few human trophoblast transcriptome files to see if the RNA I am studying is expressed in embryos. So I searched in SRA database but the results gather several transcriptomes in one file and do not indicate how many transcriptomes there is…

Use Rstudio. This is the information from labdata3 shown in R. ID,major,job_offers,age,extra,leader,role,intern,research,prm_2yr,years,salary,rating1,IST,1,22,2,10,Treasurer,1,24,No,5,91799,Meets Expectations2,IST,7,26,3,15,Secretary,4,25,Yes,6,103922,Exceeds Expectations3,IST,8,21,1,6,Member at Large,1,6,No,4,86984,Meets Expectations4,IST,5,26,0,0,Member at Large,1,0,No,2,63095,Below Expectations5,IST,4,22,1,6,Secretary,2,42,Yes,3,73405,Meets Expectations6,IST,4,23,1,6,Secretary,2,12,No,3,74926,Below Expectations7,IST,4,30,1,6,Treasurer,3,35,Yes,4,82661,Meets Expectations8,IST,9,23,2,12,Treasurer,4,38,Yes,5,95945,Exceeds Expectations9,IST,15,21,5,25,Vice President,1,16,No,7,117350,Meets Expectations10,SRA,7,29,2,12,Member at Large,2,16,No,4,89808,Meets Expectations11,SRA,12,27,5,30,Vice President,2,19,Yes,7,115837,Meets Expectations12,SRA,8,23,1,6,Vice President,4,3,Yes,4,85864,Meets Expectations13,SRA,3,26,1,6,Member at Large,2,12,Yes,4,84844,Meets Expectations14,SRA,12,28,4,24,Vice President,4,45,Yes,7,111411,Meets Expectations15,SRA,1,21,5,30,Vice President,2,47,No,7,116061,Meets Expectations16,SRA,7,26,3,18,Treasurer,2,22,Yes,6,101367,Meets Expectations17,SRA,16,26,0,0,Member at Large,4,17,Yes,5,65493,Meets Expectations18,SRA,2,24,4,24,Secretary,3,34,Yes,6,104613,Exceeds Expectations19,Cyber,1,27,1,6,Member at Large,1,34,No,4,84821,Meets Expectations20,Cyber,3,29,1,6,Vice President,3,5,No,3,77076,Below Expectations21,Cyber,7,25,3,18,Secretary,1,26,No,6,103505,Meets…

Author links open overlay panelJin Ju Kim a 1, Hoon Je Seong a b 1, Timothy A. Johnson c, Chang-Jun Cha a, Woo Jun Sul a, Jong-Chan Chae d Show more doi.org/10.1016/j.jhazmat.2023.131761Get rights and content ABSTRACT Concerns about antibiotic resistance genes (ARGs) released from wastewaters of livestock or fish farming…

Carlson, J. L., Erickson, J. M., Lloyd, B. B. & Slavin, J. L. Health effects and sources of prebiotic dietary fiber. Curr. Dev. Nutr. 2, nzy005 (2018). Article  PubMed  PubMed Central  Google Scholar  Deehan, E. C. et al. Precision microbiome modulation with discrete dietary fiber structures directs short-chain fatty acid…

Cutler, E. B. The Sipuncula: Their Systematics, Biology, And Evolution (New York: Cornell University Press, doi.org/10.7591/9781501723643, 1994) Nielsen, C. Some aspects of spiralian development. Acta Zool. 91, 20–28, doi.org/10.1111/j.1463-6395.2009.00421.x (2010). Article  Google Scholar  Huang, D. Y., Chen, J. Y., Vannier, J. & Saiz Salinas, J. I. Early Cambrian sipunculan worms…

Working with UsChallenging. Meaningful. Life-changing. Those aren’t words that are usually associated with a job. But working at Bristol Myers Squibb is anything but usual. Here, uniquely interesting work happens every day, in every department. From optimizing a production line to the latest breakthroughs in cell therapy, this is work…

Generating variant read count matrix, total read count matrix and binary/ternary mutaion matrix for SNV from scDNAseq FASTQ files 0 Leung et al., 2017 paper mentioned in Fig 1 data processing for CRC patients was sequenced as single cell for both SNV (with MDA WGA) and CNA (with DOP-PCR) parallelly….

Reducing the size of raw sequencing data in fastq format by using a simplified quality score 0 I am looking for suggestions for a tool that will change the quality score of a fastq file into a binary pass/fail score, similar to what SRA-lite is doing. I deally I want…

Introduction Candida auris is a human fungal pathogen, first isolated in Japan in 2009.1 Since then, many C. auris isolates have been reported worldwide.2–4 This pathogen can contaminate the environment around the patients who were colonized by the fungus, and can survive for long periods in major outbreaks.5 Recent studies…

fastq-dump – connection failed 1 Hi, I need to install a specific RNA sequence data using sra toolkit. I installed the toolkit using this command: sudo apt install sra-toolkit Then confirmed installation by which fastq-dump and got this /usr/bin/fastq-dump But when downloaded SRR21627290 fastq-dump –stdout -X 2 SRR21627290 I got…

How can I update fastq-dump to 3.0.0? 2 Hello! I’m trying to install the latest version of fastq dump, but all I could achieve is to install the 2.8.0, even though I used the code that is written on the Sra tools website (anaconda.org/bioconda/sra-tools). I want to install at least…

How to analyze mars-seq single end-read scRNAseq data? 1 I am new to cellranger and mapping. I want to analyze a SRR2319344 scRNA-seq data which only has single-end read. But cellranger count requires paired end reads (R1 R2). May I ask how to analyze this SRA data? Thanks cellranger single-end…

When there are multiple runs within a single experiment (in RNA-seq analysis) 1 Hello, I’m a student who hasn’t done much analysis before. I would appreciate it if you could understand even if my question is somewhat basic. I wanted to perform quality control, adapter trimming, mapping, and quantification on…

Problem while downloading SRA using aspera links 1 while downloading fastq.gz files using aspera command in ubuntu, it’s showing an error message. Session Stop (Error: Server aborted session: No such file or directory) I checked using other aspera commands for fastq.gz files which i have dowloaded 2 weeks ago, same…

Identification of MDV presence using open access sequencing data Metagenomic next-generation sequencing (NGS) data for field mosquitoes in China were searched from the NCBI SRA database (www.ncbi.nlm.nih.gov/sra) and CNGB Sequence Archive database (db.cngb.org/cnsa/) using the keywords “mosquito OR Anopheles OR Aedes OR Culex”. Followed by removing the datasets with less…

Hi everyone! I am having some problems when I try to download SRA files. Yesterday I was trying to download a set of SRA files using SRA Toolkit 3.0.2 and it didn’t work. I thought that it was a problem with the version, so I just installed the new one…

Figure 1 shows the detailed workflow of the study. Fig. 1 General overview of the study. Briefly, MPXV was isolated from a skin lesion and then was used to infect CV-1 cells. After the designated infection times, total RNA was isolated and sequenced using direct cDNA sequencing protocol on ONT’s MinION platform….

Introduction Hyperuricemia is a disease caused by irregular purine metabolism, which is always accompanied by excessive production or abnormal excretion of uric acid (UA).1 Most notably, the overall incidence of hyperuricemia in China has been increasing over the past decade with the westernization of eating habits.2,3 However, there are blind…

Ribozyme search of the Sequence Read Archive Observing that ribozymes are sufficiently short to be captured on a short sequence read (less than 100 nt), we reasoned it will be possible to screen large volumes of sequencing data to identify libraries potentially containing ribozyme agents. To this end we adapted…

fasterq-dump outputs “Cannot use ‘–ngc’ as ngc file.” 0 Hey everyone, I am trying to download some fastqs from SRA. I did this a hundred times using the snakemake wrapper “v1.3.2/bio/sra-tools/fasterq-dump” or the command-line. However, I haven’t done it in few month and just wanted to do it again. This…

SRA download 0 I’m trying to download a lot of SRA files which are whole genome of animals. average sizes are tens of gigabytes so it takes almost a day to download one individual even if I use SRAtoolkit prefetch and than fasterq-dump. I know there are other ways like…

As previously announced, in collaboration with our partners at the International Nucleotide Sequence Database Collaboration (INSDC), we will begin to systematically gather ‘location of collection’ and ‘date and time of collection’ for sequence data submitted to GenBank and the Sequence Read Archive (SRA). Gathering information about where and when a…

1. Introduction Since the beginning of extraterrestrial exploration by NASA, planetary protection (PP) has been an important effort to prevent biological forward contamination of non-Earth environments. The Committee on Space Research (COSPAR) has formulated a Planetary Protection Policy with associated implementation requirements as an international standard to protect against interplanetary biological…

Error: connection failed and certificated verification failed in fastq-dump 0 I am currently using Ubuntu-18.04 on wsl2. I saved ext4.vhdx on my D: drive and linked the path to it (to solve the problem of data capacity). After that, I tried to use sra-toolkit for ‘fastq-dump –stdout -X 2 SRR390728’,…

Production-Ready Applied Deep Learning Learn how to construct and deploy complex models in PyTorch and TensorFlow deep learning frameworks Tomasz Palczewski Jaejun (Brandon) Lee Lenin Mookiah BIRMINGHAM—MUMBAI Production-Ready Applied Deep Learning Copyright © 2022 Packt Publishing All rights reserved. No part of this book may be reproduced, stored in a…

Slides from this training: qiagen.showpad.com/share/TgxuabZORvDS3uLGCJRGN You asked for it, and we’re here to deliver. We are hosting a comprehensive training on effectively using sample-level public data and metadata from sources like GEO, SRA, TCGA, GTEx, Blueprint, CCLE and others through QIAGEN Ingenuity Pathway Analysis (IPA) and the IPA Analysis Match…

Unfortunately there is not enforced standard of what metadata must make into the SRA, it is very frustrating actually and makes reproducing any analysis needlessly complicated. You can look at what EBI fields are there, and sometimes they produce more fields than SRA: pip install bio then look at the…

Hi! I occasionally encounter this problem when I run entrez direct, have you encountered it before and how did you solve it? Thanks! curl: (52) Empty reply from server ERROR: curl command failed ( Sun Apr 23 14:33:00 CST 2023 ) with: 52 -X POST eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi -d query_key=1&WebEnv=MCID_6444d111ab8c5a52f11e167f&retstart=200&retmax=100&db=sra&rettype=runinfo&retmode=text&tool=edirect&edirect=19.3&edirect_os=Linux&email=test%40localhost WARNING: FAILURE…

State-of-the-art phylogenomic pipelines require many steps, which can be both time consuming and error prone (Fig. 1a). With Read2Tree, we directly process raw sequencing reads and reconstruct sequence alignments for conventional tree inference methods (Fig. 1b and Supplementary Fig. 1). We start by aligning raw reads to nucleotide sequences derived…

Hello,I’d like to use a public dataset from SRA, this is one of the runs. I’ll put here some sample data, the first two reads in R1: @ERR2204072.1 HWI-ST1450:172:C6H19ANXX:7:2315:16228:9537/1 ATTACCATCAGAATTGTACTGTTCTGTATCCCACCAGCAATGTCTAGGAATGCCTGTTTCTCCACAAAGTGTTTAC + %%$%%())))&)’))))))))))())()())))))))))()&&&)#)))))))))’)))))))))))()&&%&))) @ERR2204072.2 HWI-ST1450:172:C6H19ANXX:7:1104:8419:82653/1 GTTTAAACGAGATTGCCAGCACCGGGTATCATTCACCATTTTTCTTTTTGTTAACTTGCCGTCAGCCTTTTCTTTG + %%&&&))))))))))))))))())))))))))))))()))))))))&)&))%))))))))(%)))))))))))))! A quick look would rule out phred64; but if those were actual phred33-encoded…

when to use trimmomatic 2 Hi Looking at this image, do I have to perform trimmomatic for this multiqc data or not. And if yes, what should be value for parameter like MINLEN.. trimmomatic multiqc sra • 43 views • link updated 1 hour ago by Meisam ▴ 60 •…

1. Introduction The ribosomal genes (rDNA) encoding 18S, 5.8S, 28S, and 5S ribosomal RNA (rRNA) are key elements of eukaryotic genomes, since their products are directly involved in the biogenesis and functioning of the ribosomes providing for protein synthesis. Multiple 45S rDNA clusters of the 18S, 5.8S, and 28S rRNA…

Ahsan, D. A., Naser, M. N., Bhaumik, U., Hazra, S. & Bhattacharya, S. B. Migration, Spawning Patterns and Conservation of Hilsa Shad (Tenualosa ilisha) in Bangladesh and India. Publ. by Acad. Found. India, New Delhi Int. Union Conserv. Nat. Nat. Resour. 95 (2014). De, D. et al. Nutritional profiling of…

fastq file 1 Hi everyone, I have a question. Apart from using the “fastq-dump –split-files” command to download files, is there another command that can split the forward and reverse files if I download my fastq file as one single file? actually, i have problem with sra-toolkit and i should…

How to find newly submitted accessions in NCBI 2 Dear all, I want to automate a process to identify newly submitted plant accessions in NCBI. I am scanning the NCBI FTP server, but I have not yet found any address to locate all SRA accessions. ftp.ncbi.nlm.nih.gov/ Does anybody have an…

esearch|elink|esummary|xtract randomly skip some accession 0 Hello Everyone, I have a total of ~130.000 SRA accession from which I need to retrieve the isolation source and the location. $head -n 10 SRAyk.txt DRR095581 SRR11035504 SRR9016627 SRR5826819 SRR11032323 SRR6801753 SRR10144785 SRR12961276 SRR5927939 ERR2563030 Here is the bash loop for i in…

How to retrieve fastq files from NCBI using SRA accessions? 2 Hello I need to retrieve several fastq files (paired end reads) from NCBI: First I retrieved all the SRA accessions IDs of the needed sequencing files so I have a SraAccList.txt file. The content of the file is the…

Creating a reference panel of equus caballus sequences 1 Hi all, I have a quick question regarding the starting of my masters project that I’m trying to understand, I am currently trying to create a reference panel of wgs for the species equus caballus (horse) as part of my research…

Question about a public scRNA dataset(single end)? 1 When I downloaded a public scRNA dataset(SRX8492075) from the article ‘Molecular architecture of the developing mouse brain’, why the layout is ‘single’? Anyway, I downloaded it.Then fasterq-dump, I only got one fastq file. enter link description here Could one fastq file run…

Can BWA align genome fasta to fasta? 0 I want to compare same species, different strain genomes by making each genome’s VCF file. And type strain was used for standard genome for reference(www.ncbi.nlm.nih.gov/assembly/GCF_014117465.1). In case of illumina short read sequences (raw data, fastq), I could align short reads based on…

Illumina simulated reads – tools or SRA projects 0 Hello, I am trying to work with metagenome Illumina simulated reads to test a pipeline. The normal way to do that is to use simulator tools like ART. Due to time, I am thinking of just downloading some SRA projects (sequences…

AbbVie’s Genomics Research Center Computational Genomics is looking for a highly motivated computational biologist (Senior Scientist I/II, Bioinformatics) to join a team of bioinformatics scientists investigating aging and age-related diseases. AbbVie’s GRC is a center of excellence for bioinformatics, functional genomics, and human genetics. The GRC works across all R&D…

Problem using efetch -format acc, not the right accessions returned 1 I am trying to download a large list of SRA accessions through a search. esearch -db sra -query “txid28901[Organism:exp] returns 560039 entries. However, when I pipe it to efetch, the SRAs returned are not part of the results. esearch…

How to know the sample total read in SRA 0 Hello there, I have a project that I should select sample that has from 25 to 50 million read how I know that? And to someone explain to me what spot and bases mean? When say the run SRR34558 has…

error in downloading of some accesions with fastq-dump 2 Hi all, When I’m running fastq-dump with some accessions everything works fine, for example: fastq-dump –split-files SRR10345445 Results are ok when I am running the program with other access codes I get an error, for example: fastq-dump –split-files SRR5631167 connection failed…

Problem with fatsq-dump 0 Hi, I am absolutely new in NGS data analysis and have just started working in centos. I installed sratoolkit with the commands : conda create –n sratoolkit_env –y conda activate sratoolkit_env conda install –c bioconda sra-tools –y Then as given in the Biostar Handbook (Bioinformatics Data…

SRA Taxonomy Analysis – difference between tables and web 0 Hi all, How to source taxonomy analysis accurately? The results in web browser are different than in tax_analysis table in cloud.Taking as an example ERR1725012: In web browser analysis is there But when querying with AWS Athena: SELECT * FROM…

RNA-SEQ 1 Hi everyone, I am having issues with my RNA-seq data. Specifically, I have data for a single sample that includes two different SRA numbers. Although my data is paired-end, I am uncertain whether each SRR number corresponds to the forward or reverse reads, or if they represent technical…

Processing fastqs generated by inDrop protocol 0 Hi all, I’m trying to re-analyse scRNA-seq data from a recently published manuscript. The methods state that the data was generated using the inDrops protocol, but doesn’t mention which version of the protocol was used, although it does cite the 2017 Nat Protocols…

SRA Data Download 1 How to get R1 and R2 files from SRA of a particular study? When I’m downloading a FASTA or FASTQ file of a pair-end sequencing it is still given to me only one sequence file. SRA • 214 views Login before adding your answer. Traffic: 1631…

Introduction An intra-abdominal abscess is a collection of pus or infected fluid located inside or near the liver, kidneys, pancreas, spleen, or other abdominal organs.1 Unlike skin abscesses with obvious signs of redness and swelling,2 intra-abdominal abscesses occur less frequently and are often difficult to identify, of which patients may…

SRA prefetch error 0 I am using sratoolkit.3.0.2.ubuntu64. I tried downloading RNA-seq data with the command prefetch ERR315616 or any other data (ERR). I got the error message . This process takes a lot of time and I didn’t face this problem but now i have. foad@Linux:~$ sratoolkit.3.0.2-ubuntu64/bin/prefetch -p srr030252…

Let me show you an example: trace.ncbi.nlm.nih.gov/Traces/index.html?view=run_browser&acc=SRR16093385&display=metadata This data contains two reads, R1 and R2. The read length of R1 and R2 are the same 150bp. However, this experiment is performed following 10x 3’library protocol. In the method section, it described as below: The scRNA-seq libraries were generated using the…

To make it easier for you to find and access Sequence Read Archive (SRA) data, we are re-organizing and improving our cloud storage systems.   Beginning April 2023, we will move the SARS-CoV-2 normalized data and source files from the COVID-19 data buckets on Amazon Web Services (AWS) and Google Cloud…

10X V3 library with only one fastq file 0 Hello, I tried to download the library ERX5671923 from SRA using fastq-dump with the –split-files option. It is a library from the Fly Cell Atlas (experiment ERP129698 in SRA). I retrieved only one file per run (e.g ERR6032593). As it is…

Internship Overview: As a Bioinformatics Intern in the Computational Research team at Sumitovant Biopharma, you will be part of a team using data-driven approaches to address biological questions to support the identification of novel drug targets and evaluation of early-stage pharmacological compounds. You will contribute to cutting-edge projects and the…

fastq-dump unable to separate fastq files from scRNA-seq SRA files 1 Hi all, I recently downloaded a scRNA-seq file (SRR12661516) using sratoolkit. Then I needed to get the fastq files as I plan to upload the resulting fastq files to 10X genomics cloud for a new analysis. I used fastq-dump…

scATAC annotation file for zebrafish 0 Hi all, I started to analyze scATAC Seq data. I obtained the data from SRA. I have a trouble regarding gene annotation. I used Danio_rerio.GRCz11.109.gtf file to create a GRange object using AcidGenomics package. Here is the r script I used for that: DanioAnno…

Job Posting for Principal Scientist, Translational Bioinformatics Late Stage Immunology, Cardiovascular, Fibrosis and Neurology at Bristol Myers Squibb Working with UsChallenging. Meaningful. Life-changing. Those aren’t words that are usually associated with a job. But working at Bristol Myers Squibb is anything but usual. Here, uniquely interesting work happens…

doi: 10.1016/j.dib.2023.108993. eCollection 2023 Apr. Affiliations Expand Affiliations 1 Household and Structural Urban Entomology Laboratory, Vector Control Research Unit, School of Biological Sciences, Universiti Sains Malaysia (USM), Minden, Pulau Pinang 11800, Malaysia. 2 Centre for Insect Systematics (CIS), Faculty of Science and Technology, Universiti Kebangsaan Malaysia (UKM), Bangi, Selangor 43600,…

2. MicroRNA Biogenesis and Targeting MiRNAs are small non-coding single-stranded RNAs encoded within non-coding sequences of the genome; however, a minority of miRNAs are known to also be encoded within exons [3]. Interestingly, miRNAs located within intronic regions of protein-coding genes can be transcribed from the same promoter as a…

Data Carpentry’s aim is to teach researchers basic concepts, skills, and tools for working with data so they can get more done in less time and with less pain. This workshop uses Data Carpentry’s approach to teach data management and analysis for metagenomics research, including: best practices for the organization…

The Colorado potato beetle (CPB) is one of the most serious insect pests due to its high ecological plasticity and ability to rapidly develop resistance to insecticides. The use of biological insecticides based on viruses is a promising approach to control insect pests, but the information on viruses which infect…

fastq file for GSE151671 1 Hello everyone, I am attempting to download the fastq file for GSE151671 from SRA explore. However, this dataset seems a little unusual. For the Native kidney sample, there is only one sample, but there are two fastq files. It is not clear from the filename…

Source: chromhmm X-Debbugs-Cc: vladimi…@canonical.com Version: 1.24+dfsg-1 Severity: normal $sudo apt install chromhmm Reading package lists… Done Building dependency tree… Done Reading state information… Done Some packages could not be installed. This may mean that you have requested an impossible situation or if you are using the unstable distribution that some required packages have not yet been…

Forum:Require Help on Next Gen Sequencing of Spiders SRAs to find and indentify parasites. 0 Hi, I am currently doing a journal article of the identification of parasites in various spider species using histopathology and next gen sequencing. I have hit a brick wall with the data collecting side of…

Site sampling Main field recognition and sampling of the Red Stone outcrop took place on August, 2019, although subsequent site sampling also took place in February, May, August and October of 2021. After surveying the surroundings, the most continuous exposure was selected to take advantage of the best section traverse…

Tool:FungiExpresZ: an intuitive package for fungal gene expression data analysis, visualization and discovery 0 In our effort to help bench scientists to analyse fungal (and non-fungal) gene expression data with few clicks, presenting FungiExpresZ – cparsania.shinyapps.io/FungiExpresZ/ Key features: 1). intuitive and user-friendly bioinformatics tool for data analysis and a database…

Man (Tamang) February 15, 2023, 2:07am 1 Hi there,I have been downloading the NCBI SRA fastq project files and most of them have fastq sequences per sample basis. However, in some of the project file submitted to the SRA (Gopalakrishnan et al 2018 Science,www.science.org/doi/10.1126/science.aan4236#supplementary-materials ), I find that there is…

djghjc 1 hi, does anyone know how to find the sample_id for srr? bioinf • 130 views Using EntrezDirect: $ esearch -db sra -query SRX19366692 | elink -target biosample | esummary | xtract -pattern DocumentSummary -element Identifiers BioSample: SAMN33293805; SRA: SRS16763294; EDLB-CDC: PNUSAE127503 Login before adding your answer. Read more…

Introduction Human psittacosis infection, also known as ornithosis or Parrot Disease, is a relatively rare zoonosis caused by Chlamydia psittaci. Zoonotic transmission of C. psittaci has been documented through contact with infected excreta and secretions, as well as through inhalation.1 A recent study showed that C. psittaci has the potential…

A 79-year-old man was admitted to the cardiology department of our hospital, complaining of a 7-day history of fever, with a temperature up to 39.5 ℃. He denied cough, phlegm, nasal obstruction, pharyngalgia, chest pain, dizziness, or headache. Five days before admission, he was diagnosed with pulmonary infection by chest X-ray…

NEW YORK – The Institut Pasteur in Paris has won €2 million ($2.1 million) in EU funding to create a “search engine for DNA sequencing data,” indexing next-generation sequencing data available in the Sequence Read Archive in order to make it searchable and more accessible. The five-year IndexThePlanet project, led…

Sample collection We obtained the short read sequences for 33 brown bear genomes, four polar bears (Ursus maritimus) and two American black bears (Ursus americanus), publicly available from NCBI’s SRA repository (Table S1 and Fig. 1a)12,13,15,16,40,51,65. Next, we selected from our private collections a total of 95 additional samples for sequencing, among…

Using bigWigCompare to correct for input signal 0 I’m trying to visualize differences in H3K9ac binding between treatment and control groups for a certain project through visualizing the profile plots, but the provided files are only BED files with significant peak coordinates, raw SRA runs and a couple of BigWig…

Problem using SRAtoolkit 1 Hello Biostars community I wanted to use split-3 function of sratoolkit to split my pair-ended RNA-seq files to two fastq files. However, after inserting the code, I get the following error. What is the problem? ./fastq-dump –split-3 2023-01-29T12:54:14 fastq-dump.3.0.2 err: param empty while validating argument list…

Job Posting for Scientist II, Bioinformatics at PTC Therapeutics, Inc. Job Description Summary: The Scientist II, Bioinformatics is responsible for planning and performing scientific experiments that contribute to PTC’s research and drug discovery activities. The Scientist II is also responsible for communicating experimental results to his/her supervisor and…

Tellus Solutions is in partnership with a committed biopharmaceutical company in North Chicago focused on providing innovative therapies. Your technical expertise as a Bioinformatics analyst in the area of using R to do basic data analysis (processing, plotting), RNA-Seq alignment experience will contribute to our client’s innovative therapies which will…

zero byte files in sratoolkit.3.0.1-ubuntu64 0 I have downloaded sratoolkit for ubuntu. After getting the tar file and unzip it, I added the bin path to the Path variables as well. When I run which fastq-dump, it correctly identifies the path. However, when I run vdb-config -i or vdb-config –interactive…

sra-toolkit not working 2 I downloaded sra-toolkit from sra website for 64bit Windows. After extracting I tested it from bin folder: sra-toolkit\bin> fastq-dump –stdout -X 2 SRR390728 but it throws error: 2015-12-15T09:54:40 fastq-dump.2.5.5 err: item not found while constructing within virtual database module – the path ‘SRR390728’ cannot be opened…

Job description Tellus Solutions is in partnership with a committed biopharmaceutical company in North Chicago focused on providing innovative therapies. Your technical expertise as a Bioinformatics analyst in the area of using R to do basic data analysis (processing, plotting), RNA-Seq alignment experience will contribute to our client’s innovative therapies…

How do I get separate ADT / CITE-seq fastq’s from single SRA / BAM files? (originally generated from cellranger) 0 Hello all. I am trying to pre-process some single cell RNA and ADT (Totalseq-C) data from an GEO SRA, but having some issues getting separate fastq’s for the “CITE-seq” (ADT)…

Vacancy title: Principal Biostistician/Bioinformatics [ Type: FULL TIME , Industry: Research , Category: Research ] Jobs at: Kenya Medical Research – KEMRI Deadline of this Job: 06 October 2022   Duty Station: Within Kenya , Kisumu , East Africa SummaryDate Posted: Tuesday, September 20, 2022 , Base Salary: Not Disclosed…

This tiny tutorial cover setting up Aspera Connect (binary is called ascp) which might be used to download sequencing data, e.g. with download links provided by sra-explorer.info, see also sra-explorer : find SRA and FastQ download URLs in a couple of clicks Setting up Aspera Connect is simple and was…

Vir Biotechnology is a commercial-stage immunology company focused on combining immunologic insights with cutting-edge technologies to treat and prevent serious infectious diseases. Vir has assembled four technology platforms that are designed to stimulate and enhance the immune system by exploiting critical observations of natural immune processes. Its current development pipeline…

recently i receive rowdata from NGS center..and i start analysis using QIIME2 i want ‘cutadapt’, so i ask primer sequence to NGS center..but center reply to me “it is secret” if it is neccessery, i request to NGS center…. thank u for reading Hi @svbreqwaiu01, You do not need to…

I have a data set of 2×150 reads of 54 pairs of 16S v4 metagenomic sequences from NCBI sra of gastritis patients. When I previously ran the sequences through mothur, the screen.seqs after silva alignment removed sufficient number of sequences. mothur > screen.seqs(fasta=current, count=current, start=2, end=13426)Using Ulcer_Donors\stability.trim.contigs.count_table as input file…

Bioinformatics 101 | How to download RNA-Seq data from NCBI GEO | Bioinformatics for beginners Bioinformatics 101 | How to download RNA-Seq data from NCBI GEO | Bioinformatics for beginners Images related to the topicBioinformatics 101 | How to download RNA-Seq data from NCBI GEO | Bioinformatics for beginners Bioinformatics…

parallel downloads from SRA with SRA toolkit or other ways to speed up downloads 0 Is there a way to parallelize downloads from NCBI using SRAToolkit on a HPC cluster? I tried using GNU parallel but I can not actually tell if the downloads are doing anything: cat < /home/ptellier/scratch/phillip/data/escc_data/SRA_accessions.txt…

Filter Mus musculus TSV Brian P. Hermann GSE109033 10x Genonics Drop-seq single-cell RNA-seq of isolated Adult ID4-EGFP mouse spermatogonia, spermatocytes, spermatids & steady-state spermatogenic cells Expression profiling by high throughput sequencing Mus musculus 8 MTX TSV SRA Run Selector Brian P. Hermann Nov 06, 2018 GSE109037 10x Genomics Drop-seq single-cell…

Stölting KN, Wilson AB. Male pregnancy in seahorses and pipefish: beyond the mammalian model. Bioessays. 2007;29:884–96. PubMed  Google Scholar  Whittington CM, Friesen CR. The evolution and physiology of male pregnancy in syngnathid fishes. Biol Rev Camb Philos Soc. 2020;95:1252–72. PubMed  Google Scholar  Rosenqvist G, Berglund A. Sexual signals and mating…

Abstract The Sequence Read Archive (SRA)(https://www.ncbi.nlm.nih.gov/sra) houses all publicly available biological DNA sequence data to enhance reproducibility, reduce redundancy, and to allow for new discoveries by comparing data. The SRA stores raw sequencing data and alignment information from high-throughput sequencing platforms and is growing at the alarming rate of 10…

Name Last modified Size Parent Directory – sra-sdk_2.3.5-2+dfsg-1.debian.tar.xz 2014-07-30 15:22 8.8K sra-sdk_2.3.5-2+dfsg-1.dsc 2014-07-30 15:22 2.1K sra-sdk_2.3.5-2+dfsg.orig.tar.xz 2014-07-30 15:22 2.1M sra-sdk_2.8.1-2+dfsg-2.debian.tar.xz 2017-04-02 00:22 13K sra-sdk_2.8.1-2+dfsg-2.dsc 2017-04-02 00:22 2.1K sra-sdk_2.8.1-2+dfsg.orig.tar.xz 2017-01-24 10:35 2.8M sra-sdk_2.9.3+dfsg-1.debian.tar.xz 2018-10-23 23:07 3.7M sra-sdk_2.9.3+dfsg-1.dsc 2018-10-23 23:07 2.1K sra-sdk_2.9.3+dfsg.orig.tar.xz 2018-10-23 23:07 3.7M sra-sdk_2.10.9+dfsg-2.debian.tar.xz 2021-02-05 03:50 3.7M sra-sdk_2.10.9+dfsg-2.dsc 2021-02-05 03:50…

Designing the mammalian methylation array The CMAPS algorithm is designed to select a set of Illumina Infinium array probes such that for a target set of species many probes are expected to work in each species (see “Methods” section). Array probes are sequences of length 50 bp flanking a target CpG…

Medical Science & Computing, (MSC), a Dovel company, is seeking skilled Senior Bioinformatics Software Developers to join our team supporting our client, NCBI at the National Institutes of Health, (NIH) in Bethesda, MD. The National Center for Biotechnology Information (NCBI) is part of the National Library of Medicine (NLM) at…

Problem : ( Scroll to solution ) In order to extract some fastq data from NCBI’s sequence read archive I’ve downloaded and installed the sra toolkit for Windows. In order to test if it is setup correctly, I opened cmd, navigated to the directory and typed in the command fasterq-dump…