Categories
Tag: SRA
Sperm-specific histone H1 in highly condensed sperm nucleus of Sargassum horneri
Cho, C. et al. Haploinsufficiency of protamine-1 or-2 causes infertility in mice. Nat. Genet. 28, 82–86 (2001). Article CAS PubMed Google Scholar Oliva, R. Protamines and male infertility. Hum. Reprod. Update 12, 417–435 (2006). Article CAS PubMed Google Scholar Balhorn, R. The protamine family of sperm nuclear proteins. Genome Biol….
The Biostar Herald for Tuesday, December 19, 2023
The Biostar Herald publishes user submitted links of bioinformatics relevance. It aims to provide a summary of interesting and relevant information you may have missed. You too can submit links here. This edition of the Herald was brought to you by contribution from Mensur Dlakic, Istvan Albert, and was edited…
Finding the paper published from the SRA run riles
Finding the paper published from the SRA run riles 0 Hey folks, i have used this code to download a my query esearch -db sra -query ‘(“BACTERIA_NAME”[Organism] OR BACTERIA_NAME[All Fields]) AND “BACTERIA_NAME”[orgn] AND (“strategy wgs”[Properties] AND “library layout paired”[Properties] AND “filetype fastq”[Properties])’ | efetch -format runinfo -mode text > first_file.tsv…
Chromosome-level genome assembly of the Stoliczka’s Asian trident bat (Aselliscus stoliczkanus)
Dobson, G. E. On a new genus and species of Rhinolophidae, with description of a new species of Vesperus, and notes on some other species of insectivorous bats from Persia. J. Asiat. Soc. Bengal. 40, 455–461 (1871). Google Scholar Bates, P., Bumrungsri, S., Francis, C., Csorba, G. & Furey, N….
Update to GenBank Qualifier – NCBI Insights
‘Country’ will transition to ‘Geographic Location’ effective June 2024 As announced earlier this year, we will begin to systematically gather ‘location of collection’ and ‘date and time of collection’ for sequence data submitted to GenBank and the Sequence Read Archive (SRA). As part of this effort and to make location data more accurate and informative,…
Chromosome-level genome assembly of the Asian spongy moths Lymantria dispar asiatica
Boukouvala, M. C. et al. Lymantria dispar (L.) (Lepidoptera: Erebidae): Current Status of Biology, Ecology, and Management in Europe with Notes from North America. Insects 13 (2022). Keena M. A., Richards, J. Y. Comparison of Survival and Development of Gypsy Moth Lymantria dispar L. (Lepidoptera: Erebidae) Populations from Different Geographic…
SRA Staffing – SRA Group hiring QA Analyst with Bioinformatics in Mississauga, Ontario, Canada
Title: QA Analyst with Bioinformatics Work location: Mississauga, Canada (Hybrid) Duration: 1 Year Plus Contract Job Description: B.S. or M.S. in Computer Science, Data Sciences, Bioinformatics, Biomedical engineering or equivalent field • Min 5 years of experience in software development or software test engineering or data engineering • Proficiency in…
What is the troubleshoot for this error: conversion of .SRA to FASTA file on command prompt?
I am getting this error message after using the following code: C:\sratoolkit.3.0.7-win64\sratoolkit.3.0.7-win64\bin>fastq-dump –fasta SRR1658345 Error: 2023-12-11T06:08:04 fastq-dump.3.0.7 err: timeout exhausted while waiting condition within process system module – failed SRR1658345 ============================================================= An error occurred during processing. A report was generated into the file ‘C:\Users\Hp/ncbi_error_report.txt’. If the problem persists, you may…
SRA toolkit (NCBI) – sra to fasta
SRA toolkit (NCBI) – sra to fasta 1 Dear all, At the moment I’m trying to download sequences from the Sequence Read Archive (SRA) from NCBI and put them into fasta format. For this I downloaded the SRA-toolkit of NCBI and used the following code: set PATH=%PATH%;C:\Users\Admin\Desktop\sratoolkit.2.9.0-win64\sratoolkit.2.9.0-win64\bin prefetch –max-size 100000000…
Using Metagenome Samples for HNSCC analysis
Using Metagenome Samples for HNSCC analysis 0 So I’m trying to analyze the floor-of-mouth HNSCC(Head and Neck Squamous Cell Carcinoma) and controls. I’m going to be using SRA files. The issue I’ve encountered is that I could only find 2 controls. The 2 controls were tumor-adjacent normals. For floor-of-mouth, there…
3 Simple Ways to Download FASTQ files | by Vijini Mallawaarachchi | The Computational Biology Magazine | Dec, 2023
A detailed overview of 3 ways to download FASTQ files of SRA runs from NCBI As bioinformaticians, the National Center for Biotechnology Information (NCBI) is one of the most important resources we use to get data. NCBI plays a crucial role in our research community due to its extensive databases…
Haplotype-resolved genome of heterozygous African cassava cultivar TMEB117 (Manihot esculenta)
Wang, P. et al. The genome evolution and domestication of tropical fruit mango. Genome Biol 21 (2020). Tang, C. et al. The rubber tree genome reveals new insights into rubber production and species adaptation. Nat Plants 2 (2016). Bredeson, J. V. et al. Sequencing wild and cultivated cassava and related…
SQL request from NCBI metadata and stat_analysis tables
I’m trying to do a SQL request on the BigQuery Google service to search for family names present in my sample DRR000836, and more precisly, on the cyanobacteria phylum part but I’m not sure how to do it… Here are the 2 SQL requests that I would like to merge…
4 Fastq files for a single run generated by 10X
4 Fastq files for a single run generated by 10X 0 Hello, I have a question about the 10X generated Fastq files. As I know 10X platforms can generate up to 4 Fastq files as R1, R2, I1 and I2. I need to use Fastq files and align them with…
Metagenome Dataset of Maize Rhizosphere for Saline Soil from Mau Region of Uttar Pradesh by Alok Kumar Singh, Alok Kumar Srivastava, Mala Trivedi :: SSRN
Abstract In India, after rice and wheat, maize (Zea mays L.) is most significant food crop. Like others, maize is also influenced by the rhizospheric region’s microbial communities, which are incredibly diverse and unquestionably play a key role in the nutrient cycle and growth productivity. Maize rhizospheric soil samples were…
Can you help me to download list of miRNA from a SRA under a bioproject ?
Can you help me to download list of miRNA from a SRA under a bioproject ? 0 Hello, After reading this paper: I would like to get all miRNA they found and it seems there is a bioproject with data containing list of miRNA : Data Availability … And miRNA…
bam or VCF files from GSE75010
bam or VCF files from GSE75010 1 Hi all I’m planning to run a variant calling analysis using Microarray data GSE75010 that contains GSE75010_RAW.tar and GSE75010_complete_dataset.csv.gz. I used to download the .fastq files using SRA Run numbers through Ubuntu/Linux to get .bam and VCF files. However, this is not the…
Best practices for unstranded sequences in featureCounts
Hi everyone, I’m using featureCounts to analyze some RNA-Seq data, but I have several doubts in the use with unstranded library. First, when I analyze some SRA sequences or when I don’t know the library type, I use Salmon to know it with the next command: salmon quant -p 32…
Tools for Efficient Retrieval from GEO and SRA Databases | by Denis Odinokov, MBBS, MSc, PMP | Nov, 2023
Image by Gerd Altmann from Pixabay For downloading data and standardized metadata from GEO (Gene Expression Omnibus) and SRA (Sequence Read Archive), several bioinformatics and command-line tools and scripts are available, primarily hosted on GitHub. ARA: An automated pipeline developed for better sampling of NCBI SRA database records, allowing full…
Distributed genotyping and clustering of Neisseria strains reveal continual emergence of epidemic meningococcus over a century
Distributed cgMLST scheme and the species tree based on a global dataset of 70,000 Neisseria genomes To set up the new dcgMLST scheme, we established a global collection of genomic sequences for 69,994 Neisseria strains (Supplementary Data 1), consisting of 4411 assembled genomes from GenBank, 65,434 genomes assembled based on short…
A DNA barcode library for woody plants in tropical and subtropical China
Hebert, P. D. N., Cywinska, A., Ball, S. L. & deWaard, J. R. Biological identifications through DNA barcodes. Proc Biol Sci 270, 313–321 (2003). Article CAS PubMed PubMed Central Google Scholar Huang, X., Ci, X., Conran, J. G. & Li, J. Application of DNA barcodes in Asian tropical trees –…
Discovery from public data (GEO, SRA and more) using Ingenuity Pathway Analysis
Per user feedback, we are hosting a comprehensive training on how to effectively use sample level public data and metadata from sources like GEO, SRA, TCGA, GTEx, Blueprint, CCLE and other sources through Ingenuity Pathway Analysis (IPA) and IPA Analysis Match Explorer feature. The trainer will walk through usecases in…
STAR alignment speed
STAR alignment speed 1 Hello, I am trying to align RNA sequencing data from the NCBI SRA database to the Apis mellifera genome with STAR. The alignment worked fine. However, the mapping step of the alignment seems to be a bit slow. Furthermore, increasing the number of available threads does…
Three questions about datasets
Three questions about datasets 2 Hello, I have three questions about Rna-seq and datasets: Is it fine to combine datasets? Suppose I am doing a project comparing control tongue epithelial tissue vs. tumor tongue epithelial tissue through DESEQ2 analysis. I have 5 control sra files from one experiment and 5…
Senior Scientist, Bioinformatics II job with AbbVie
AbbVie’s Genomics Research Center Computational Genomics is looking for a highly motivated computational biologist (Senior Scientist II, Bioinformatics) to join a team of bioinformatics scientists investigating aging and age-related diseases. AbbVie’s GRC is a center of excellence for bioinformatics, functional genomics, and human genetics. The GRC works across all R&D…
Efficient Bulk Data Retrieval from NCBI BioProject
Efficient Bulk Data Retrieval from NCBI BioProject 0 Hello, A month ago, I utilized the SRA Toolkit Pipeline to download Fastq files from a BioProject accession. Following the recommended steps, I generated a list of SRR Names, used prefetch, and then employed fasterq-dump (using parallel-fastq-dump) to obtain the data locally,…
Saponin treatment for eukaryotic DNA depletion alters the microbial DNA profiles by reducing the abundance of Gram-negative bacteria in metagenomics analyses
INTRODUCTION Microbiome research, especially the detection of microorganisms by molecular techniques, has become a fundamental tool for investigating host-associated bacteria, such as those harbored by veterinary or human clinical samples[1,2]. Next-generation sequencing (NGS) approaches now enable the identification of slow-growing, non-cultivable, or non-viable bacteria contained in clinical specimens without relying…
Handling multiple fastq files per sample, per lane, per read out of the Cellranger bam to fastq workflow
Handling multiple fastq files per sample, per lane, per read out of the Cellranger bam to fastq workflow 0 For a set of downloaded bam files from PRJNA625920 in SRA, I used 10x Genomics’ “bam to fastq” tool but got 25 fastq files per sample per lane per read like…
Case of Spine Infection with Brucella melitensis
Introduction Brucellosis is a common zoonotic infection in most of the developing regions of the world, severely affecting livestock productivity and human health. It caused by a small, nonmotile gram-negative coccobacillus of the genus Brucella. Among reported human brucellosis cases, the pathogenic strain B. melitensis is the most frequently encountered.1,2…
Failed to download SRA vdbcache
Failed to download SRA vdbcache 0 Hi, I have been trying to download data using the SRAtool kit. Most of the time, prefetch works well without having any issues. However, for a dataset I am trying to download recently, some of the accessions failed on downloading the vdbcache file, whereas…
Advisor/Sr. Advisor – Bioinformatics – Relocation Assistance job with Lilly
At Lilly, we unite caring with discovery to make life better for people around the world. We are a global healthcare leader headquartered in Indianapolis, Indiana. Our employees around the world work to discover and bring life-changing medicines to those who need them, improve the understanding and management of disease,…
Lilly Advisor/Sr. Advisor – Bioinformatics in New York, NY | 883515845
At Lilly, we unite caring with discovery to make life better for people around the world. We are a global healthcare leader headquartered in Indianapolis, Indiana. Our employees around the world work to discover and bring life-changing medicines to those who need them, improve the understanding and management of disease,…
trying to use the API for edirect tool (NCBI)
trying to use the API for edirect tool (NCBI) 1 Hi, I’m new to bioinformatics, so I apologize if my question seems a little bit basic. I wanted to use the tool Edirect to retrieve information about a list of samples that I have generated. I work on a cluster,…
improving genome sequence read depth and confidence by combining sequences from different SRA
improving genome sequence read depth and confidence by combining sequences from different SRA 0 Hi all, I have a genome sequenced with not so good coverage. so i am thinking of utilizing other available genomes to develop a complete draft genome. I am also thinking of incorporation of transcriptomics reads…
Job Opening – Bioinformatics Intern- Summer 2024 – Rockville, MD
In partnership with a major Life Science organization we are seeking candidates for a summer Biological Data Analysis Internship based out of Rockville, MD. This is a 10 week Summer internship for 2024. Expected start date is June 3rd through August 9th, 2024. This is a 40 hour/week; 100% remote…
Detect contaminating organism
Detect contaminating organism 0 Hello everyone! I am new to bioinformatics and have never faced such a problem, but now I am working with a dataset GSE172189 that appears to be contaminated by bacteria (only ~60% of reads are aligned with Salmon, and taxonomy analysis on SRA says there are…
Metagenomic Data of Bacterial 16S rRNA in the Cemetery Soil Samples in Surakarta City, Indonesia by Triastuti Rahayu, Erma Musbita Tyastuti, Ambarwati Ambarwati, Lina Agustina, Noor Alis Setiyadi, Nazia Jamil, Yasir Sidiq :: SSRN
10 Pages Posted: 1 Nov 2023 See all articles by Triastuti Rahayu Universitas Muhammadiyah Surakarta Universitas Muhammadiyah Surakarta Universitas Muhammadiyah Surakarta Universitas Muhammadiyah Surakarta Universitas Muhammadiyah Surakarta University of the Punjab (PU) Universitas Muhammadiyah Surakarta Abstract Cemetery soils most likely contain…
Unable to resolve host address
Unable to resolve host address 1 I am trying to download a fastq file using its ftp link on ebi.ac.uk and using the command wget ftp.sra.ebi.ac.uk/vol1/fastq/ERR224/002/ERR2240092/ERR2240092_2.fastq.gz on Ubuntu but I am getting the error “wget:unable to resolve host address ‘ftp.sra.ebi.ac.uk’.” Please advice on how to resolve this problem ubuntu ftp…
Solved You should write and render a “Methods” Rmarkdown
You should write and render a “Methods” Rmarkdown file that describes what each script does. Retrieve the reference genome (human, release 27) from the Gencode FTP server (getGenome.sh) Retrieve the NGS reads used in the comparison paper. These are available in the SRA under accession SRR6808334 (getReads.sh) Quality trim the…
Microbiomes associated with Coffea arabica and Coffea canephora in four different floristic domains of Brazil
General information In total, more than 60 million reads were obtained: 30,700,327 for 16S rDNA/bacteria and 29,920,072 for ITS/fungi. These sequences were distributed across more than 1000 bacterial and fungal genera (Fig. 2). The coverage index10 was above 0.95 for all samples, showing that the sequencing effort was enough to capture…
What is the best way to compute genetic distances between FASTQ files?
What is the best way to compute genetic distances between FASTQ files? 2 I have downloaded a couple hundred genome reads from the SRA and want to compute the genetic distances between each pair of reads. So far, the only way that I’ve been able to do so is to…
BioSpace hiring Senior Scientist, Bioinformatics II in North Chicago, Illinois, United States
AbbVie’s Genomics Research Center Computational Genomics is looking for a highly motivated computational biologist (Senior Scientist II, Bioinformatics) to join a team of bioinformatics scientists investigating aging and age-related diseases. AbbVie’s GRC is a center of excellence for bioinformatics, functional genomics, and human genetics. The GRC works across all R&D…
Senior Scientist, Bioinformatics II
AbbVie’s Genomics Research Center Computational Genomics is looking for a highly motivated computational biologist (Senior Scientist II, Bioinformatics) to join a team of bioinformatics scientists investigating aging and age-related diseases. AbbVie’s GRC is a center of excellence for bioinformatics, functional genomics, and human genetics. The GRC works across all R&D…
Trouble finding datasets
Trouble finding datasets 1 Hello, I am trying to find datasets for a project on HNSCC. I have been using GEO as my main website to find datasets but have not found anything. I am trying to find a dataset about HNSCC, tumor and control, RNA, for the tonsil body…
BioSpace hiring Advisor/Sr. Advisor – Bioinformatics in Cambridge, MA
At Lilly, we unite caring with discovery to make life better for people around the world. We are a global healthcare leader headquartered in Indianapolis, Indiana. Our 35,000 employees around the world work to discover and bring life-changing medicines to those who need them, improve the understanding and management of…
Solved Download fastac.ac.sh, fastac.loop.sh and
Transcribed image text: Download fastac.ac.sh, fastac.loop.sh and runinfo.csv, Answer the questions below: 1. Run the bash script fas tqc. qc. sh. How many NEW files are generated under directory reports/ after your script runs successfully? 2. Edit the file fastqc. loop. sh so the script successfully loops through the SRR…
SilicoScientia hiring Professional Freelance Scientific Writer: Bioinformatics in India
SilicoScientia Pvt Ltd is looking for a freelance scientific writer with extensive experience in Bioinformatics – Genomics as the core area of scientific research. Responsibilities § Should be able to write scientific manuscript independently for publishing the same in peer review journal. § Should have sound knowledge for providing query based Bioinformatics…
Access to fastq files on SRA Run browser
Access to fastq files on SRA Run browser 0 Hi, as I was looking for sources to access fastq files directly instead of converting them from .sra and avoid the use of the SRA toolkit, I came across these links on the run browser which have aws s3 bucks links…
SRR download using fasterq-dump
SRR download using fasterq-dump 1 Hello, I have downloaded the sra-toolkit from Anaconda (anaconda.org/bioconda/sra-tools) and downloaded an .sra file using the command: prefetch SRR20073591. The .sra file is located here: /faststorage/project/Biof/testdir/SRR20073591/SRR20073591.sra. When I navigate to the directory and use this command: fasterq-dump SRR20073591.sra, I get an output file called SRR20073591.fastq….
G. lucidum triterpenes restores intestinal flora balance in non-hepatitis B virus-related hepatocellular carcinoma: evidence of 16S rRNA sequencing and network pharmacology analysis
. 2023 Sep 18:14:1197418. doi: 10.3389/fphar.2023.1197418. eCollection 2023. Affiliations Expand Affiliation 1 Chongqing Three Gorges Medical College, Chongqing Key Laboratory of Development and Utilization of Genuine Medicinal Materials in Three Gorges Reservoir Area, Chongqing, China. Free PMC article Item in Clipboard Wei Xiong et al. Front Pharmacol. 2023. Free PMC article…
Solved We are now going to call variants with two different
We are now going to call variants with two different approaches from the files we have been working with all course. Please use the following files, parameters, and listed versions of the software for this assignment. We will use the reference Ebola genome: /data/compres/refs/AF086833.2.fasta And this set of paired-end sequences:…
Bulk RNAseq Standard Data Processing Pipelines
Pipelines and parameters used to process data on the BioBox platform Pipeline for processing public data to sample gene counts SRA-Toolkit is used to fetch the raw files using fasterq-dump -e 3 The files are passed to Kallisto for quantification using kallisto quant -t 3 If the sample is…
RNAseq based variant dataset in a black poplar association panel | BMC Research Notes
Dickmann DI, Kuzovkina J. Poplars and willows of the world, with emphasis on silviculturally important species. In: Isebrands JG, Richardson J, editors. Poplars and willows: trees for society and the environment. Wallingford: CABI; 2014. Google Scholar Imbert E, Lefèvre F. Dispersal and gene flow of Populus nigra (Salicaceae) along a…
IJMS | Free Full-Text | Prioritizing Endangered Species in Genome Sequencing: Conservation Genomics in Action with the First Platinum-Standard Reference-Quality Genome of the Critically Endangered European Mink Mustela lutreola L., 1761
1. Introduction The alarming decline of biodiversity worldwide necessitates urgent conservation measures, particularly for wild, endangered, and understudied species. According to the International Union for Conservation of Nature’s (IUCN) Red List of Threatened Species, of the 5973 mammal species assessed, 1340 were classified as threatened with extinction, including 233 critically…
ncbi error report log for validate fastq issue
ncbi error report log for validate fastq issue 0 Im trying to fetch a list of GSM id which could be seen that it is present in the project folder which I checked through sra explorer tool but when I try to download through a script it fails even after…
Fetch Fastq files directly for SRA data
Fetch Fastq files directly for SRA data 1 I’m trying to fetch fastq files for SRA data hosted by NCBI from AWS data exchange for a project, but the only way I can find is to use the SRA toolkit to convert the SRA normalized files in the sra-pub-run-odp S3…
Metagenomic data from surface seawater of the east coast of South Korea
Sunagawa, S. et al. Structure and function of the global ocean microbiome. Science 348, 1261359, doi.org/10.1126/science.1261359 (2015). Article CAS PubMed Google Scholar Acinas, S. G. et al. Deep ocean metagenomes provide insight into the metabolic architecture of bathypelagic microbial communities. Commun. Biol. 4, 604, doi.org/10.1038/s42003-021-02112-2 (2021). Article CAS PubMed PubMed…
How to find out what adapters to remove after FastQC of RNAseq data?
How to find out what adapters to remove after FastQC of RNAseq data? 1 Dear community, For a new RNAseq project, I downloaded (foreign but reliable) SRA data of the wildtype control sampe. My FastQC analysis of the data reveals a significant “Illumina Universal Adapter” content, which I´d like to…
Effects of a postbiotic SLFC non scalp microbiome
Introduction Sensitive scalp is a skin syndrome caused by the hyper-reactivity to environmental stimuli, which might cause inflammatory symptoms and abnormal sensory reactions of the scalp including pruritus, prickling, tightness, pain, and burning, but without visible signs of inflammation.1 Various circumstances, such as the atmospheric environment, heat, pollution, hair care…
Transcriptomic, 16S ribosomal ribonucleic acid and network pharmacology analyses shed light on the anticoccidial mechanism of green tea polyphenols against Eimeria tenella infection in Wuliangshan black-boned chickens | Parasites & Vectors
Li J, Zhao Z, Xiang D, Zhang B, Ning T, Duan T, et al. Expression of APOB, ADFP and FATP1 and their correlation with fat deposition in Yunnan’s top six famous chicken breeds. Br Poult Sci. 2018;59:494–505. Article CAS PubMed Google Scholar Dou T, Yan S, Liu L, Wang K,…
Carnegie Mellon University hiring Bioinformatics Support Specialist – Mellon College of Science – Pittsburgh Supercomputing Center in Pittsburgh, PA
The Pittsburgh Supercomputing Center (PSC), a joint research center of Carnegie Mellon University and the University of Pittsburgh, was established in 1986, and for over 30 years has provided university, government and industrial researchers with access to several of the most powerful systems for sophisticated computational research, communications and data…
What is the amount of sequencing data produced annually?
I’m trying to figure out the current annual volume of sequencing data produced either in bytes or basepairs as there doesn’t seem to be up to date information about it. Even now in 2023 most references point back to the 2015 paper titled “Big Data: Astronomical or Genomical?” which projected…
How to retrieve sample informations from given ID from Sequence Read Archives?
How to retrieve sample informations from given ID from Sequence Read Archives? 1 I have a list of SRA id (around 1000) from NCBI SRA database. “SRX1067067” ,”SRX022566“, “SRX11222414”, “SRX11222415”, “SRX11222416”, “SRX11222417”, “SRX11222418”, “SRX11222419”, “SRX176057”, “SRX176058” I want to extract the information of all sample ids as follows: api ncbi…
Cost for the deposition of sequencing data in GEO and SRA
Cost for the deposition of sequencing data in GEO and SRA 1 Hi, I am writing the budget justification for NIH grant application. I need to request the budget for data management and sharing. I plan to deposit my sequencing data in GEO and SRA. I am going to request…
How many FASTQ files does one SRA Run correspond to?
How many FASTQ files does one SRA Run correspond to? 1 Hi, I was wondering if anyone can confirm this: one Sequence Read Archive Run ID always corresponds to one single-end FASTQ file or one pair of paired-end FASTQ files. All four SRA Run IDs SRR16918933, SRR16918934, SRR16918935, SRR16918936 have…
Finding the raw data used to build reference genomes
Finding the raw data used to build reference genomes 1 Is the a way to find the raw data (fastq or other) that was used to generate a reference genome? and is there a quick way to do this for a large number of genomes? reference-genome • 53 views •…
Ancient Clostridium DNA and variants of tetanus neurotoxins associated with human archaeological remains
Identification and assembly of C. tetani-related genomes from aDNA samples To explore the evolution and diversity of C. tetani, we performed a large-scale search of the entire NCBI Sequence Read Archive (SRA; 10,432,849 datasets from 291,458 studies totaling ~18 petabytes; June 8, 2021) for datasets potentially containing C. tetani DNA…
Lactobacillus crispatus+gasseri+jensenii + Gardnerella vaginalis + Atopobium vaginae rRNA [Presence] in Vaginal fluid by NAA with probe detection – 94420-7
LOINC Code LOINC code 94420-7 name Lactobacillus crispatus+gasseri+jensenii + Gardnerella vaginalis + Atopobium vaginae rRNA [Presence] in Vaginal fluid by NAA with probe detection description Qualitative result for bacterial vaginosis (BV) based on the detection and quantitation of ribosomal RNA from bacteria associated with bacterial vaginosis (BV), including Lactobacillus…
SRA and Bioproject IDs
SRA and Bioproject IDs 1 Dears, I have a group of Bioproject IDs and need to retrieve their corresponding SRA IDs. I tried to retrieve the whole data from SRA using kywrds <- entrez_search(db = “sra”, retmax = 20000, term = “Homo sapiens[ORGN] AND Homo sapiens[orgn:__txid9606]”) However, the result of…
command to extract SRA fastq data summary
command to extract SRA fastq data summary 0 Hi, I was trying to calculate the total read length of all the sample present in bioproject in command utility as: code 1: esearch -db bioproject -query “PRJNA438426” | efetch -format docsum | xtract -pattern DocumentSummary -element RunTotalBases which is giving me…
Genome-wide analysis of circRNA regulation during spleen development of Chinese indigenous breed Meishan pigs | BMC Genomics
Overview of the sequencing information To explore the presence of circRNAs during spleen development, we assessed circRNAs expression in the spleen tissues of Meishan pigs at various developmental stage. We prepared and sequenced ribo-depleted total RNA-seq libraries, as shown in the flow chart (Fig. 1). Table S2 presents our rudimentary sequencing…
How to convert to .SRA files to .FQ (FASTQ)
How to convert to .SRA files to .FQ (FASTQ) 0 Hello everyone, I’m trying to convert SRR10513216 files to fastq form. fastq-dump SRR10513216.sra fastq-dump –split-files -A SRR10513216.sra But I am getting an error which says the following fastq-dump.2.8.0 err: item not found while constructing within virtual database module – the…
Uploading terrabytes of data to NCBI SRA
Forum:Discussion: Uploading terrabytes of data to NCBI SRA 2 Large genomic datasets are becoming increasingly common, and often we need to find a place to archive and share data once our project is done. Probably the most widely used archive is NCBI’s Short Read Archive (SRA). However, if you ever…
Advisor/Sr. Advisor – Bioinformatics job in Cambridge at Lilly Company
At Lilly, we unite caring with discovery to make life better for people around the world. We are a global healthcare leader headquartered in Indianapolis, Indiana. Our 35,000 employees around the world work to discover and bring life-changing medicines to those who need them, improve the understanding and management of…
Extract the true single-cell RNA sequencing reads for running SAHMI
Hello everyone! I’m currently using the SAHMI pipeline to annotate microbiome information from the single-cell data. However, I encountered two potential problems when applying SAHMI to 10X scRNA data: The first one is that SAHMI (SAHMI)inputs both paired reads to annotate microbiome by using kraken2, which calculates k-mer of assigned…
What is the best way to combine machine learning algorithms for feature selection such as Variable importance in Random Forest with differential expression analysis?
NB – this answer has been updated January 28th, 2020 Update: It is important to point out that the assumptions of RandomForest® differ from those of, e.g., a regression model. So, RandomForest® and other classification algorithms certainly must be considered. Just use my general pointers here as just that, i.e.,…
SRA obtained metagenomic reads appears to corrupt
Hello, I am trying to run SingleM on data obtained using sratoolkit (2.10.7) I used prefetch SRR2103020 to download and fastq-dump –outdir ./fastq –split-e ./SRR2103020/SRR2103020.sra to split. when I check the file : head SRR2103020_1.fastq @SRR2103020.1 D7RS0RN1:177:C12Y0ACXX:3:1101:1404:2079 length=93 AATGTGGACAGCGCCGTCTTCAAACAGGCGCTGTCCAGCTAGCAGCTCAACGCTCCGCGCCGCCGTCTTCGCCGTCTTCAGGCAGGGGGAGAA +SRR2103020.1 D7RS0RN1:177:C12Y0ACXX:3:1101:1404:2079 length=93 @BCFFFDDHHHHHJJJGIJIBHHIJJCH?HBG<GIG@HEGIGFIFG@>CGHHHFFFDD@BB::BD@B??CDBDD@BD@DA@CCDDBD###### @SRR2103020.2 D7RS0RN1:177:C12Y0ACXX:3:1101:1440:2113 length=93 GGTATAAGTTCTATGTGTAATGAACCACAGAGTTATCAAAAAACTCAAGATCTGTCTCTTATACACATCTGACGCTGCCGACGAGCGATCTAG +SRR2103020.2 D7RS0RN1:177:C12Y0ACXX:3:1101:1440:2113 length=93…
Transcriptional variation in Babesia gibsoni (Wuhan isolate) between in vivo and in vitro cultures in blood stage | Parasites & Vectors
Morphological observation of continuous in vitro cultured B. gibsoni (Wuhan isolate) Babesia gibsoni was successfully cultured in vitro in 20% serum. After splitting, parasitemia reached 10% ± 1.5% on day 3 (Fig. 1A). Fig. 1 Changes in parasitemia and morphology of in vitro cultured B. gibsoni (Wuhan isolate). A Changes in parasitemia of…
Large-scale analysis of flavivirus sequences, with no unknowns, in Aedes aegypti whole-genome DNA sequence data | Parasites and vectors
Spadar A, Phelan JE, Benavente ED, Campos M, Gomez LF, Mohareb F, et al. Flavivirus integration Aedes aegypti Limited and highly conserved across samples from different geographic regions, unlike integration Aedes albopictus. vectors of parasites. 2021; 14 (1): 332. Palatini U, Contreras CA, Gasmi L, Bonizzoni M. Endogenous viral elements…
Large-scale reference-free analysis of flavivirus sequences in Aedes aegypti whole-genome DNA sequencing data
Spadar A, Phelan JE, Benavente ED, Campos M, Gomez LF, Mohareb F, et al. Flavivirus integrations in Aedes aegypti are limited and highly conserved across samples from different geographic regions in contrast to integrations in Aedes albopictus. Parasite vectors. 2021;14(1):332. Palatini U, Contreras CA, Gasmi L, Bonizzoni M. Endogenous viral…
Large-scale reference-free analysis of flavivirus sequences in Aedes aegypti whole genome DNA sequencing data | Parasites & Vectors
Spadar A, Phelan JE, Benavente ED, Campos M, Gomez LF, Mohareb F, et al. Flavivirus integrations in Aedes aegypti are limited and highly conserved across samples from different geographic regions unlike integrations in Aedes albopictus. Parasit Vectors. 2021;14(1):332. Palatini U, Contreras CA, Gasmi L, Bonizzoni M. Endogenous viral elements in…
Comment: cannot execute binary file: Exec format error
This is the script I used to download and install the SRA Toolkit: **1. Downloading the SRA Toolkit for MacOs (Done on linux terminal) wget “ftp-trace.ncbi.nlm.nih.gov/sra/sdk/3.0.6/sratoolkit.3.0.6-mac64.tar.gz” tar -vxzf sratoolkit.3.0.6-mac64.tar.gz **2. installation of SRA Toolkit:** curl –output sratoolkit.tar.gz ftp-trace.ncbi.nlm.nih.gov/sra/sdk/current/sratoolkit.current-mac64.tar.gz tar -vxzf sratoolkit.tar.gz export PATH=$PATH:$PWD/sratoolkit.3.0.6-mac64/bin which fastq-dump **3. Downloading data: fastq-dump –stdout…
Research Specialist IV – Bioinformatics at Sidra Medical and Research Center – Qatar
JOB SUMMARY The Research Specialist IV – Bioinformatics performs routine and complex scientific work, evaluating, selecting and applying procedures and techniques to assignments with clear, specific objectives. Assignments require investigation of a number of variables and complex features. Working with limited supervision, the role is required to exercise judgment in…
Research Specialist IV – Bioinformatics – Career Growth Potential at Sidra Medical And Research Center in Qatar, Qatar
We are in search of an expert Research Specialist IV – Bioinformatics to join our innovative team at Sidra Medical and Research Center in Qatar, Qatar.Growing your career as a Full Time Research Specialist IV – Bioinformatics is a terrific opportunity to develop essential skills.If you are strong in creativity,…
Research Scientist – Bioinformatics – Axelon Services Corporation
Job Description: Scientist (contractor), Translational Bioinformatics Late Stage Immunology, Cardiovascular, Fibrosis and Neurology We are seeking a highly motivated bioinformatician to join our Translational Bioinformatics late stage Immunology, Cardiovascular, Fibrosis and Neurology (ICFN) team, within Informatics and Predictive Sciences group. The successful candidate will help advance *** s industry leading…
AMG-1/SLRP-1 is required for spermatogenesis
image: Graphical view of AMG-1 binding 12S rRNA to regulate mitochondrial gene translation (top), and amg-1 mutation results in reduced mitochondrial translation machinery (bottom). view more Credit: ©Science China Press This study is led by Prof. Long Miao (Key Laboratory of Cell Proliferation and Regulation Biology of Ministry of Education, College…
Senior Bioinformatics Engineer in Manila Philippines – Career Connect
This is a remote position. We’re looking for someone with years of experience in machine learning and data science for a Hawaii-based health care company. Lead the development of new bioinformatics algorithms, pipelines, and infrastructure in a cloud-based environment in support of the Company’s discovery platform Apply rigorous standards and…
How can i approach to this problem, pls help. Reference genome assembly.
How can i approach to this problem, pls help. Reference genome assembly. 0 Hello everyone, i need help to do this work. I need a workflow to to do this work. Just someone tell me what i have to do. in my views i have to do map all the…
Modifying the vdb-config to increase timeout in a docker image
This the docker image I want to modify. My objective is to include this in the container in other words increase timeout # set timeout to 10 seconds $ vdb-config -s /http/timeout/read=10000 So Steps what I have done is – docker pull biomystery/sra-tools-pigz:2.10.9 – docker run -it -d –name kcm_sra_tool…
How to create custom docker image to download bam files from SRA
How to create custom docker image to download bam files from SRA 1 I am trying to create a docker image from docker file and entrypoint. However, it only generates <none>:<none>. This is my docker file and entrypoint.sh. Would someone please let me know what’s missing here? FROM openjdk:8-jre LABEL…
Acquisition, co-option, and duplication of the rtx toxin system and the emergence of virulence in Kingella
A common ancestor of pathogenic Kingella species acquired the RTX toxin Consistent with existing literature, when the five Kingella species were assessed for β-hemolysis on BHI plates supplemented with 10% sheep blood, only K. kingae and K. negevensis were hemolytic (Fig. 1A), suggesting that the two pathogenic Kingella species produce the…
Debian binary debdiff for sra-sdk
Version in base suite: 3.0.3+dfsg-5 Version in overlay suite: 3.0.3+dfsg-6~deb12u1 Base version: sra-sdk_3.0.3+dfsg-5 Target version: sra-sdk_3.0.3+dfsg-6~deb12u1 Base files: libncbi-ngs-dev_3.0.3+dfsg-5_amd64.deb libncbi-ngs3-dbgsym_3.0.3+dfsg-5_amd64.deb libncbi-ngs3_3.0.3+dfsg-5_amd64.deb libngs-c++-dev_3.0.3+dfsg-5_amd64.deb libngs-c++3-dbgsym_3.0.3+dfsg-5_amd64.deb libngs-c++3_3.0.3+dfsg-5_amd64.deb libngs-java_3.0.3+dfsg-5_amd64.deb libngs-jni_3.0.3+dfsg-5_amd64.deb sra-toolkit-dbgsym_3.0.3+dfsg-5_amd64.deb sra-toolkit_3.0.3+dfsg-5_amd64.deb Target files: libncbi-ngs-dev_3.0.3+dfsg-6~deb12u1_amd64.deb libncbi-ngs3-dbgsym_3.0.3+dfsg-6~deb12u1_amd64.deb libncbi-ngs3_3.0.3+dfsg-6~deb12u1_amd64.deb libngs-c++-dev_3.0.3+dfsg-6~deb12u1_amd64.deb libngs-c++3-dbgsym_3.0.3+dfsg-6~deb12u1_amd64.deb libngs-c++3_3.0.3+dfsg-6~deb12u1_amd64.deb libngs-java_3.0.3+dfsg-6~deb12u1_amd64.deb libngs-jni_3.0.3+dfsg-6~deb12u1_amd64.deb sra-toolkit-dbgsym_3.0.3+dfsg-6~deb12u1_amd64.deb sra-toolkit_3.0.3+dfsg-6~deb12u1_amd64.deb lrwxrwxrwx root/root /usr/lib/$(DEB_HOST_MULTIARCH)/jni/libncbi-ngs.so -> ../../x86_64-linux-gnu/libncbi-ngs.so.3.0.3 lrwxrwxrwx root/root /usr/lib/x86_64-linux-gnu/jni/libncbi-ngs.so -> ../libncbi-ngs.so.3.0.3…
Downloading the fastq files did not well going; read in the fastq files are all the same
Downloading the fastq files did not well going; read in the fastq files are all the same 1 Hello everyone, I want to download fastq files of SRR7749705 (2×75bp). I used fasterq-dump and got 2 fastq files, SRR7749705_1.fastq and SRR7749705_2.fastq, as expected. However, all the reads in SRR7749705_1.fastq were the…
Bug#1040953: bookworm-pu: package sra-sdk/3.0.3+dfsg-6~deb12u1
Package: release.debian.org Severity: normal Tags: bookworm User: release.debian….@packages.debian.org Usertags: pu X-Debbugs-Cc: sra-…@packages.debian.org Control: affects -1 + src:sra-sdk [ Reason ] Per #1039621, the new libngs-jni package accidentally wound up with bad content (unexpanded variables in the key symlink’s source *and* target) that rendered it useless. [ Impact ] This package’s…
Principal Bioinformatics Engineer Job Opening in Waltham, MA at BIO-TECHNE
Job Details Level: Experienced Job Location: Waltham MA – Waltham, MA Position Type: Full Time Education Level: Graduate Degree Salary Range: Undisclosed Travel Percentage: Up to 10% Job Shift: Day Job Category: Research Description Principal Bioinformatics Engineer The Opportunity Exosome Diagnostics, a Bio-Techne brand (NASDAQ: TECH), is a global…
Scientist Translational Bioinformatics Job Opening in Lawrenceville, NJ at On Board Companies
On-Board Services is hiring for a Scientist Translational Bioinformatics position, in Lawrenceville, NJ! For immediate consideration please send your resume to Subject Line: Position Title and State you are Located About Us: On-Board Services, Incorporated is an on-site contract service provider for a local manufacturing entity providing full time positions…
find SRA and FastQ download URLs in a couple of clicks
Tool:sra-explorer : find SRA and FastQ download URLs in a couple of clicks 0 Hi all, As a fun little side project I’ve made a web tool to find runs on the NCBI Sequence Read Archive (SRA) and fetch the download URLs for these. You can do all of this…
An NCBI Guide to Finding and Analyzing Metagenomic Data
An NCBI Guide to Finding and Analyzing Metagenomic Data This workshop was offered virtually on Oct 25, 2022. Workshop Duration: 2 hours Content Difficulty: Intermediate Target Audience: This workshop is designed for biologists interested in metagenomics and finding and accesing sequence reads on NCBI. A basic understanding of command-line programming…
issue regarding download SRA file in bulk
issue regarding download SRA file in bulk 0 I want to download a bulk amount of SRA files with sra-toolkit with a bash scripting code but it is not working can it be fixed? #!/bin/sh input=”/home/omic/Downloads/peanut16s/input.txt” while IFS= read -r line do echo “fasterq-dump –split-3 $line -O FASTQ_files/” done content…
Development of microsatellite markers for the invasive mosquito Aedes koreicus | Parasites & Vectors
Invasive Aedes mosquitoes represent a global concern for public health due to their role as vectors of several pathogens and their ability to colonise new territories [1, 2]. Their dispersal in non-native regions is mainly associated with climate change, and the increasing movement of people and goods (e.g. used tires,…