Categories
Tag: stats4
Deleting a column from data frame and then running DESeq2
Forgive me if this post is messy, I’m new to this! I’m analyzing RNA Seq data and found that one of my samples is an outlier (sample AV17). I’m trying to exclude it from my analysis, but whenever I do, using this code: dds = subset(countData, select = -c(AV17) ),…
Error in calculating inter-individual divergence / spread
Hi all I am currently facing an issue while working with the microbiome package in R and would greatly appreciate your insights. > b.lgg <- divergence(subset_samples(physeq, Description == “Stool_controls”), + apply(abundances(subset_samples(physeq, Description == “Stool_controls”)), 1, median)) > b.pla <- divergence(subset_samples(physeq, Description == “Stool_samples”), + apply(abundances(subset_samples(physeq, Description == “Stool_samples”)), 1, median))…
removeBatchEffect with non-linear model fit
removeBatchEffect with non-linear model fit 0 @2289c15f Last seen 6 hours ago Germany Hello, I am attempting to use limma’s removeBatchEffect for visualization purposes (heatmat & PCA) while fitting non-linear models (splines) to my expression data in DESeq2. Given that my design is balanced, would this approach work within the…
Interaction terms in DESeq2
Hi, I am hoping this isn’t a stupid question as I am really lost here. I have extensively read the manual and other forum posts but am struggling to find a solution. I am using DESeq2 to analyse my data set but running into problems with an interaction term in…
ScRNAseq analysis scran :: quickcluster Error
ScRNAseq analysis scran :: quickcluster Error 1 @d4a334e3 Last seen 15 hours ago Germany Hello! I am having an error while doing normalization for my scRNAseq data, I would appreciate the help of anyone who countered the same problem the error is during quickcluster command as follow: clust <- quickCluster(sce)…
Help! RStudio starts to a blank screen after update; clean install worked, but not after time machine backup. – RStudio IDE
Error Information: Description of issue – After updating to OS Sonoma, RStudio is a blank window. I only see the name of the toolbar. There are no options in the toolbar either, it says empty. R app works fine. Attempted steps taken to fix –Reinstalled appsReinstalled OS system sonoma (didn’t…
Rstudio crashes just before producing a brms model – General
Hello, I am trying to run a brms model with 20000 iterations. After many hours of simulations, and just before being done, Rstudio crashes without any warning. The model compiles successfully with 1000 iterations and, sometimes, with 10000 iterations but several attempts to run the model with 20000 iterations or…
Predicting missing values splines DESeq2
Hello, I am fitting splines in DESeq2 like so: dds <- DESeqDataSetFromMatrix(countData = counts, colData = coldata, design = ~ ns(age_scaled, df = 3)) Plotting later using the code Mike Love posted elsewhere: dat <- plotCounts(dds, gene, intgroup = c(“age”, “sex”, “genotype”), returnData = TRUE) %>% mutate(logmu = design_mat %*%…
DESeq2 design with unbalance data and a multifactor design
Dear all, I am doing a DGEA with DESeq2 and data imported with tximport. I have an unbalanced dataset as reported below. With the counts and the metadata that I have I would like to answer different questions. I would like to look at the differential expressed genes between the…
DESeq2 with unbalanced dataset and multifactor design
Dear all, I am doing a DGEA with DESeq2 and data imported with tximport. I have an unbalanced dataset as reported below. With the counts and the metadata that I have I would like to answer different questions. I would like to look at the differential expressed genes between the…
Bioconductor – DESeq2 (development version)
DOI: 10.18129/B9.bioc.DESeq2 This is the development version of DESeq2; for the stable release version, see DESeq2. Differential gene expression analysis based on the negative binomial distribution Bioconductor version: Development (3.19) Estimate variance-mean dependence in count data from high-throughput sequencing assays and test for differential expression based on a model…
Bioconductor – ReactomePA
This package is for version 2.12 of Bioconductor; for the stable, up-to-date release version, see ReactomePA. Reactome Pathway Analysis Bioconductor version: 2.12 This package provides functions for pathway analysis based on REACTOME pathway database. It will implement enrichment analysis, gene set enrichment analysis and functional modules detection. Author:…
different results with and without releveling when providing contrast
Hello, I am conducting a differential expression analysis of RNA-seq data where I have samples from three treatment doses (control, low, high) at three developmental timepoints (W6, W8, GS45). Note these are not paired samples (i.e. different individuals sampled at each timepoints). I am interested in differentially expressed genes caused…
Annotation hub and clusterProfiler errors
Annotation hub and clusterProfiler errors 1 @33343537 Last seen 4 hours ago Norway How can I get AnnotationHub() run? Also, clusterProfiler is not working because I am unable to install HPO.db > ah <- AnnotationHub() **Error in `collect()`: ! Failed to collect lazy table. Caused by error in `db_collect()` >…
rtracklayer error for browserSession UCSC
rtracklayer error for browserSession UCSC 1 @f64e2e65 Last seen 16 hours ago Germany An older error from rtracklayer has resurfaced. When calling a browserSession, it gives the error below. I assume this is due to a URL problem, possibly when trying to connect to UCSC from Europe. Could someone please…
Plotting time series data after running natural splines regression in DESeq2.
Hello, I am running differential expression analysis on age-related changes in transcription using natural splines with DESeq2 like so: dds <- DESeqDataSetFromMatrix(countData = counts, colData = coldata, design = ~ ns(age_scaled, df = 3)) keep <- rowSums(counts(dds) >= 10) >= 3 dds <- dds[keep,] dds <- DESeq(dds, test=”LRT”, reduced =…
R encountered fatal error when using processBismarkAln in methylKit
R encountered fatal error when using processBismarkAln in methylKit 2 Hi I am attempting to use methylkit to analyse my RRBS data but cannot seem to be able to import my files. I have .bam files generated from bismark. I read I can use function processBismarkAln to read these kind…
Bioconductor – DelayedArray
DOI: 10.18129/B9.bioc.DelayedArray This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see DelayedArray. A unified framework for working transparently with on-disk and in-memory array-like datasets Bioconductor version: 3.11 Wrapping an array-like object (typically an on-disk object) in a DelayedArray object allows one to…
DiffBind dba.count() crash/can’t finish problems
I am using Diffbind for an ATAC-Seq analysis. My peak caller is MACS2, and here is my sample sheet: I run Diffbind with the following codes, but it crashed every time on dba.count . it can finished Computing summits… Recentering peaks… Reads will be counted as Paired-end. But have this…
DeSeq2 data comparison and extracting outputs
Hi, I have an RNA-seq experiment where there are 2 conditions and 2 genotypes. I am trying to figure out how to output the 2 conditions with 2 genotypes from the dds object. I have read online resources, however, it is still not clear what is extracted. I followed and…
Software Compatibility Issue Between phyloseq and lme4 Packages
Hi, I’ve encountered a rather peculiar software issue involving the phyloseq package and the lme4 package when analyzing longitudinal microbiome data. Below, please find a reproducible example that triggers the error: First, when I run the mixed effects model code provided by lme4, it works perfectly: data(“sleepstudy”, package = “lme4”)…
TCGAbiolinks not working anymore
TCGAbiolinks not working anymore 0 The script in this tutorial does not work anymore bioconductor.org/packages/devel/bioc/vignettes/TCGAbiolinks/inst/doc/analysis.html I get to GDCprepare stage and get error: Starting to add information to samples => Add clinical information to samples => Adding TCGA molecular information from marker papers => Information will have prefix paper_ brca…
R studio freezes when monocle3 is installed – RStudio IDE
Hi, R studio server freezes and the .Rproj.user and .Rhistory files must be deleted to connect to an already running session. This behaviour is only resolved by uninstalling monocle3 and comes back when I re-install monocle3. I tried the development and beta branch of Monocle3. I had the same issue…
Creating Double The Columns Than There Are Samples: DEXseq
I am trying to use DEXseq and I was told that I could output normalized counts using the following method by my supervisor: library(“DEXSeq”) # Create the DEXSeqDataSet object dxd <- DEXSeqDataSetFromHTSeq( countsFiles, sampleData=sampleTable, design= ~ sample + exon + condition:exon, flattenedfile=flattenedFile ) #Normalize normFactors <- matrix(runif(nrow(dxd)*ncol(dxd),0.5,1.5), ncol=ncol(dxd),nrow=nrow(dxd), dimnames=list(1:nrow(dxd),1:ncol(dxd))) normFactors…
PCA percent variance DESeq2
PCA percent variance DESeq2 0 @6d1ed6fa Last seen 14 hours ago United States I saved ‘pcaData’ as a data frame for future use. I ran the following to get vector ‘percentVar’, however, it is empty. Do I need the data in a different format to extract percent variance? > pcaData…
ATAC seq Normalization and analysis pipeline problems
Hi all, I am following the ATACseq normalization and analysis pipeline outlined in this manuscript Reske et. al, 2020, and I am at the point of processing the MACS2 output in R. I used the following commands to specify my bamfiles, set the discard parameter to the blacklist for mm10,…
Problem with goseq – error
Hello, I’m trying to do GO analysis using goseq but I get this error: < In pcls(G) : initial point very close to some inequality constraints Loading required package: AnnotationDbi Loading required package: stats4 Loading required package: BiocGenerics Loading required package: paral>> as input I had this: To add more…
DESeq2, Timecourse using fitted splines
DESeq2, Timecourse using fitted splines 0 @2289c15f Last seen 7 hours ago Germany Hello, I am analyzing timecourse data of aging thymus samples. 29 samples, 11 different age groups. I am fitting splines for each gene and running LRT. Is there a more reliable way to tell how many degrees…
Model matrix for a complex study design using aldex.glm module from ALDEx2 R package
Hello, I have a question about the complex study design in the R ALDEx2 package (bioconductor.org/packages/devel/bioc/vignettes/ALDEx2/inst/doc/ALDEx2_vignette.html#46_Complex_study_designs_and_the_aldexglm_module). My goal is to compare more than two groups (e.g. two or more treatments vs control). In a simple case with two groups, we use a vector with two groups: data(selex) #subset only the…
Quarto render error with chinese docs and knitr opts_chunk set in YAML heading – #2 by goo – RStudio IDE
A minimal demo: — title: “demo” lang: zh knitr: opts_chunk: collapse: false format: gfm: default — 第一行 第二行 – 第三行 – 第四行 – 第五行 The output # demo 第一行二行 第三行 第四行 第五行 However, the expected output is # demo 第一行 第二行 – 第三行 – 第四行 – 第五行 There are more…
IsoformSwitchAnalyzeR Error in reading GTF file
IsoformSwitchAnalyzeR Error in reading GTF file 0 Hi, I am using IsoformSwitchAnalyzeR v1.21.0 in R 4.3.0 environment using RStudio (2023.06.0+421 “Mountain Hydrangea” Release). When I try to import GTF file (obtained from Ensembl Plants) I get the following error ; Step 1 of 7: Checking data… Step 2 of 7:…
VariantFiltering error
VariantFiltering error 0 @andrew-beggs-5579 Last seen 15 hours ago United Kingdom Hi Trying to run VariantFilter, manage to import fine, PED file is pretty standard: FAM001 SAMPLE_C SAMPLE_P1 SAMPLE_P2 1 2 FAM001 SAMPLE_P1 0 0 0 1 FAM001 SAMPLE_P2 0 0 0 1 > vfpar VariantFiltering parameter object VCF file(s):…
r – RStudio plot window won’t finish loading and/or won’t properly load my plot
I’m trying to create a plot showing the abundance of ASVs within control vs true samples. This isn’t an issue with the code since I’ve used it before and it was just working yesterday, but I’ll include it here: # Starting from a phyloseq object called “noMitoChloroMock_physeq” # Set control…
DESeq2 with nbinomGLM issues
DESeq2 with nbinomGLM issues 0 @andrebolerbarros-16788 Last seen 6 hours ago Portugal Hi everyone, I was performing some DEGs and got this message: Warning messages: 1: In nbinomGLM(x = x, Y = YNZ, size = size, weights = weightsNZ, … : the line search routine failed, possibly due to insufficient…
Git tab not showing in Rstudio – RStudio IDE
Hello,I am new to using Git and would like to version my code within Rstudio. I have followed the below instructions (found here): In RStudio…• Open the project that you would like have associated with a GitHub Repository• Select Tools from the menu bar, then click on Version control, and…
ExomeDepth error in getBamCounts when adding a fasta reference
ExomeDepth error in getBamCounts when adding a fasta reference 1 Whenever I try to add a reference fasta file for computing the GC content in the GetBamCounts function: my.countsV6 <- getBamCounts(bed.frame =AgilentV6, bam.files = BAMFiles, include.chr = TRUE, referenceFasta = “data/hg19.fa” ) I get an error like this: Reference fasta…
`MOFAobject@expectations` is empty list
`MOFAobject@expectations` is empty list 0 Hello I run the tutorial (raw.githack.com/bioFAM/MOFA2_tutorials/master/R_tutorials/CLL.html) library(MOFA2) library(MOFAdata) library(data.table) library(ggplot2) library(tidyverse) utils::data(“CLL_data”) MOFAobject <- create_mofa(CLL_data) MOFAobject data_opts <- get_default_data_options(MOFAobject) model_opts <- get_default_model_options(MOFAobject) model_opts$num_factors <- 15 train_opts <- get_default_training_options(MOFAobject) train_opts$convergence_mode <- “slow” train_opts$seed <- 42 MOFAobject <- prepare_mofa(MOFAobject, data_options = data_opts, model_options = model_opts, training_options =…
optimHess problem in apeglm/DESeq2
optimHess problem in apeglm/DESeq2 1 @atpoint-13662 Last seen 25 minutes ago Germany Hi Mike, based on www.biostars.org/p/9559740/#9559740 I made this MRE which errors in R 4.3 – Bioc 3.17 and latest DESeq2. I just checked that it runs fine in the Bioc 3.16 Docker container but errors in the 3.17…
Error building package: graph from Bioconductor – shinyapps.io
Dear all,I come to a point where I need help. I am trying to deploy a shiny app and obtain the error below: Preparing to deploy document…DONEUploading bundle for document: 8572645…DONEDeploying bundle: 7200847 for document: 8572645 …Waiting for task: 1299182367building: Building image: 8559204building: Installing system dependenciesbuilding: Fetching packageserror: Building package:…
DESeq2 1.40.0 binary install issue on macOS x86 (Bioconductor 3.17)
DESeq2 1.40.0 binary install issue on macOS x86 (Bioconductor 3.17) 0 @mjsteinbaugh Last seen 3 hours ago Cambridge, MA Hi Bioconductor team, I noticed an install issue with the current DESeq2 1.40.0 binary build on macOS x86. The package is failing to load unless gfortran is installed at /opt/gfortran, from…
Bioconductor – flowClust
This package is for version 2.11 of Bioconductor; for the stable, up-to-date release version, see flowClust. Clustering for Flow Cytometry Bioconductor version: 2.11 Robust model-based clustering using a t-mixture model with Box-Cox transformation. Note: users should have GSL installed. Windows users: ‘consult the README file available in the…
Cannot load DESeq2 in R
I have been using DESeq2 without problem for many months, until today. When I try to load the package in R I get the following problem: > library(DESeq2) Loading required package: SummarizedExperiment Error: package or namespace load failed for ‘SummarizedExperiment’ in dyn.load(file, DLLpath = DLLpath, …): unable to load shared…
Error in loading DESeq2
Error in loading DESeq2 0 Hi all I have been using DESeq2 no problem for a while including earlier today Now, whenever I load it I get the below error message. I tried re-downloading DESeq2 and restarting my computer and R, but no dice. Any thoughts? Error: package or namespace…
Gene duplicate
Gene duplicate 1 Hi there, I am pretty new to single cell RNA seq and I am trying to learn by doing analysis for a data that has been published already. I am using monocle3 and I realized that some Ensembl IDs that are the same and I was wondering…
Bioconductor – ggtree
This package is for version 3.3 of Bioconductor; for the stable, up-to-date release version, see ggtree. an R package for visualization and annotation of phylogenetic trees with their covariates and other associated data Bioconductor version: 3.3 ggtree extends the ggplot2 plotting system which implemented the grammar of graphics….
How to extract proteins from PCs in plot_pca in DEP package?
How to extract proteins from PCs in plot_pca in DEP package? 1 I am using DEP package to analyze proteomics data. I did PCA for my samples (see the following plot) and wish to extract proteins in PC1 for further analysis. However, the objects x and y generated by the…
TxDB.Hsapiens.UCSC.hg38.knownGene with locateVariants() identifying SNPs from various chromosome being part of the same gene
I am trying to annotate a list of SNPs using the hg38 genome (knownGene) and locateVariants(). The program is able to successfully run and provide “GeneIDs” for several of the loci. However, some GeneIDs are applied to SNPs in completely different regions and on completely different chromosomes. When I cross…
merge (all=T) error – rstudio
I have two installations of RStudio with each different updates of the packages. On the recent packages I get two errors that I don’t have with the previous packages. Can someone tell me what the problem is? Error 1: df_lofreq_3_DEL <- merge(df_lofreq_3_DEL, deletions_VAR_df_sub_freq, by.x=”VAR_MUT”, by.y=”lofreq_del”, all=T) Error in if (all.x)…
DESeq2: invalid class “GRangesList” object
Hi all, I am not sure if this is the right place to ask this question, but I’ve just updated my DESeq2 package from version 1.4.5 to version 1.6.3 and my scripts are no longer working. Specifically, I get the following error when generating a DESeqDataSet object with the function…
Bioconductor – Rgraphviz
DOI: 10.18129/B9.bioc.Rgraphviz This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see Rgraphviz. Provides plotting capabilities for R graph objects Bioconductor version: 3.13 Interfaces R with the AT and T graphviz library for plotting R graph objects from the graph package. Author: Kasper…
Potential problem with independent filtering in DESeq2
Potential problem with independent filtering in DESeq2 1 @8a6e6497 Last seen 16 hours ago United States Hello, I was routinely using DESeq2 for some small RNA-seq datasets, and suddenly I noticed that FDR corrections are too aggressive. After some investigation, I found out that independent filtering is wrongly determining the…
GO.db for Bioconductor 3.17
Hi, I’m hoping to get a package ready for the 3.17 Bioconductor release but I am unable to get a functional GO.db package for the devel version > BiocManager::install(version=’devel’) ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.17 (BiocManager 1.30.19), R Under development…
10x BAM to count matrix in Rsubread and Rsamtools- cellCounts vs. featureCounts
Hi, I am new to Single cell analysis but have some experience with NGS data output and manipulation. I have a set of .bam that I assume were the product of the cell ranger pipeline from the ENA (project ID PRJEB36998) unfortunately I have no access to any other output…
Strange Cook’s Values with DESeq2
Hi, I’m currently trying to assess fold change when comparing two different sample types using DESeq2 package and I’m getting weird Cook’s distance values which are causing major problems. The two different samples have different amounts of replicates (6 replicates vs 5 replicates) which might be the reason for these…
getTable ignores query ranges
HI everyone. I have a set of mouse SNPs (~974) from GRCm39 that I’m trying to get either GERP or UCSC Conservation scores on. To do this, I’m using rtracklayer to try to query the ranges of the SNP and return the multiz35way conservation score. However, when I do this,…
Error in UseMethod(“rescale”)
Error in UseMethod(“rescale”) 0 @2528ae94 Last seen 17 hours ago United States While using cnetplot to plot enrichGo results, I am getting the following error. It used to work before, but now I am constantly getting this error. I am using clusterprofiler package gse <- enrichGO(gene = deGenes, ont =…
Log2FC values slightly higher in some genes after DESeq2 shrinkage
Hi, I have a question about DESeq2 LFCshrinkage: Is it possible that some genes have a slightly higher LFC after shrinkage? It happened during my RNAseq DE analysis, I have very deeply sequenced samples with large base means. I tried visualizing using MAplot check, and it looks fine. I’m mainly…
Bioconductor – lumi
DOI: 10.18129/B9.bioc.lumi This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see lumi. BeadArray Specific Methods for Illumina Methylation and Expression Microarrays Bioconductor version: 3.12 The lumi package provides an integrated solution for the Illumina microarray data analysis. It includes functions of Illumina…
extendedSequences length is not the required for DeepCpf1 (34bp)
Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…
Error in SummarizedExperiment
I have installed DESeq2 version 1.36.0 samples <- colnames(txi$counts) group <- as.factor(c(“control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”, “control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”,”diet”)) coldata <- data.frame(samples, group, stringsAsFactors = F) coldata <- coldata[,c(“samples”,”group”)] coldata$samples <- factor(coldata$samples) coldata$group <- factor(coldata$group) rownames(coldata) <- sub(“fb”, “”, rownames(coldata)) all(rownames(coldata$samples) %in% colnames(txi)) all(rownames(coldata) == colnames(txi)) TRUE library(DESeq2) ddsTxi <- DESeqDataSetFromTximport(txi, colData = coldata, design =…
deseq2 problem
deseq2 problem 0 Hi I am trying to draw a PCA plot with DESeq2 but somehow I cannot use DESeq2 functions. It is a really simple code i wil be pasting below. > transform <- DESeq2::rlog(eliminated_data, blind = TRUE) Error in (function (classes, fdef, mtable) : unable to find an…
GDCprepare of RNAseq counts produces error
GDCprepare of RNAseq counts produces error 1 @76ac7b25 Last seen 12 minutes ago Canada Hello everyone! I have been using the TCGAbiolinks package for the last couple years to access RNAseq data for the TCGA-LAML project. Just very recently, I had noticed that I could no longer use GDCquery to…
GDCquery_Maf error
GDCquery_Maf error 0 @76e1237b Last seen 1 day ago Singapore Hi all, I really need some help. I am trying to run GDCquery_Maf which worked fine until yesterday. Now I get the following error: Error in GDCquery(paste0(“TCGA-“, tumor), data.category = “Simple Nucleotide Variation”, : Please set a valid workflow.type argument…
subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38
subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38 1 @b14a6f0d Last seen 16 hours ago United States Are subpopulation MAFs available for gnomADv.3.1.1 with any package, like they are in MafDb.gnomAD.r2.1.hs37d5? I’m trying to use Genomic Scores to obtain all variants in a genomic range with MAF in any subpopulation >= cutoff. I tried…
Bioconductor Package Installation
When I try to install the gtf for hg38 BiocManager::install(“TxDb.Hsapiens.UCSC.hg38.knownGene”) I get the following error: ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.2 (2021-11-01) Installing package(s) ‘TxDb.Hsapiens.UCSC.hg38.knownGene’ Error in readRDS(dest) : error reading from connection Per stackoverflow.com/questions/67455984/getoptionrepos-replaces-bioconductor-standard-repositories-see-reposito I…
Pathway analysis of RNAseq data using goseq package
Hello, I have finished the RNA seq analysis and I am trying to perform some pathway analysis. I have used the gage package and I was looking online about another package called goseq that takes into account length bias. However, when I run the code I get an error. How…
DESeq2 and high prefiltering cutoff
DESeq2 and high prefiltering cutoff 1 @255004b1 Last seen 3 hours ago United States Hi, I am curious about prefiltering with DESeq2. I understand from this site and reading the DESeq2 vignette that prefiletering is really unnecessary as DESeq2 has a stringent filtering that it does. However, I’m seeing better…
identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE
GenomicFeatures::makeTxDbFromUCSC failing with an error: identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE 1 @mikhail-dozmorov-23744 Last seen 1 day ago United States Hi,The GenomicFeatures::makeTxDbFromUCSC function fails with: library(GenomicFeatures) > hg19.refseq.db <- makeTxDbFromUCSC(genome=”hg19″, table=”refGene”) Download the refGene table … Error in .fetch_UCSC_txtable(genome(session), tablename, transcript_ids = transcript_ids) : identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE OK The…
Bioconductor – MLInterfaces
This package is for version 3.3 of Bioconductor; for the stable, up-to-date release version, see MLInterfaces. Uniform interfaces to R machine learning procedures for data in Bioconductor containers Bioconductor version: 3.3 This package provides uniform interfaces to machine learning code for data in R and Bioconductor containers. Author:…
Design formula in DESeq2
Hello, I am using DESeq2 for analysis of RNAseq data. I would like to ask you about the design in the DESEq2 formula. I have tissue from animals treated with a chemical and my animal model is a colorectal cancer model. My variables are gender (male or female), treatment (treated…
Bioconductor – Ringo
DOI: 10.18129/B9.bioc.Ringo This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see Ringo. R Investigation of ChIP-chip Oligoarrays Bioconductor version: 3.9 The package Ringo facilitates the primary analysis of ChIP-chip data. The main functionalities of the package are data read-in, quality assessment, data…
Converting between UCSC id and gene symbol with bioconductor annotation resources
You need to use the Homo.sapiens package to make that mapping. > library(Homo.sapiens) Loading required package: AnnotationDbi Loading required package: stats4 Loading required package: BiocGenerics Loading required package: parallel Attaching package: ‘BiocGenerics’ The following objects are masked from ‘package:parallel’: clusterApply, clusterApplyLB, clusterCall, clusterEvalQ, clusterExport, clusterMap, parApply, parCapply, parLapply, parLapplyLB, parRapply,…
Outliers on DESEq2 Results
I have an RNAseq dataset, where one of the genes I intend to analyze has hundreds of counts ranging from 10 to 12, with a few counts > 9000. I process this data in Deseq2 and get that the gene is differentially expressed across several samples of interest. What can…
Bioconductor – PICS
DOI: 10.18129/B9.bioc.PICS Probabilistic inference of ChIP-seq Bioconductor version: Release (3.5) Probabilistic inference of ChIP-Seq using an empirical Bayes mixture model approach. Author: Xuekui Zhang <xzhang at stat.ubc.ca>, Raphael Gottardo <rgottard at fhcrc.org> Maintainer: Renan Sauteraud <rsautera at fhcrc.org> Citation (from within R, enter citation(“PICS”)): Installation To install this…
Bioconductor – DESeq2
DOI: 10.18129/B9.bioc.DESeq2 This package is for version 3.10 of Bioconductor; for the stable, up-to-date release version, see DESeq2. Differential gene expression analysis based on the negative binomial distribution Bioconductor version: 3.10 Estimate variance-mean dependence in count data from high-throughput sequencing assays and test for differential expression based on…
Bioconductor – GGtools
DOI: 10.18129/B9.bioc.GGtools This package is for version 3.12 of Bioconductor. This package has been removed from Bioconductor. For the last stable, up-to-date release version, see GGtools. software and data for analyses in genetics of gene expression Bioconductor version: 3.12 software and data for analyses in genetics of gene…
weird MAplot or volcano plot of DESeq2 diff result
Hi, every one. I find a werid MAplot or volcano plot of DESeq reuslt. I am wondering whether you can give me some advice. This diff result is from two cell type bulk RNA-seq. I use two specific marker to get these two cell type using Flow cytometer. I alreadly…