Tag: stats4

Log2FC values slightly higher in some genes after DESeq2 shrinkage

Hi, I have a question about DESeq2 LFCshrinkage: Is it possible that some genes have a slightly higher LFC after shrinkage? It happened during my RNAseq DE analysis, I have very deeply sequenced samples with large base means. I tried visualizing using MAplot check, and it looks fine. I’m mainly…

Continue Reading Log2FC values slightly higher in some genes after DESeq2 shrinkage

Bioconductor – lumi

DOI: 10.18129/B9.bioc.lumi     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see lumi. BeadArray Specific Methods for Illumina Methylation and Expression Microarrays Bioconductor version: 3.12 The lumi package provides an integrated solution for the Illumina microarray data analysis. It includes functions of Illumina…

Continue Reading Bioconductor – lumi

extendedSequences length is not the required for DeepCpf1 (34bp)

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

Continue Reading extendedSequences length is not the required for DeepCpf1 (34bp)

Error in SummarizedExperiment

I have installed DESeq2 version 1.36.0 samples <- colnames(txi$counts) group <- as.factor(c(“control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”, “control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”,”diet”)) coldata <- data.frame(samples, group, stringsAsFactors = F) coldata <- coldata[,c(“samples”,”group”)] coldata$samples <- factor(coldata$samples) coldata$group <- factor(coldata$group) rownames(coldata) <- sub(“fb”, “”, rownames(coldata)) all(rownames(coldata$samples) %in% colnames(txi)) all(rownames(coldata) == colnames(txi)) TRUE library(DESeq2) ddsTxi <- DESeqDataSetFromTximport(txi, colData = coldata, design =…

Continue Reading Error in SummarizedExperiment

deseq2 problem

deseq2 problem 0 Hi I am trying to draw a PCA plot with DESeq2 but somehow I cannot use DESeq2 functions. It is a really simple code i wil be pasting below. > transform <- DESeq2::rlog(eliminated_data, blind = TRUE) Error in (function (classes, fdef, mtable) : unable to find an…

Continue Reading deseq2 problem

GDCprepare of RNAseq counts produces error

GDCprepare of RNAseq counts produces error 1 @76ac7b25 Last seen 12 minutes ago Canada Hello everyone! I have been using the TCGAbiolinks package for the last couple years to access RNAseq data for the TCGA-LAML project. Just very recently, I had noticed that I could no longer use GDCquery to…

Continue Reading GDCprepare of RNAseq counts produces error

GDCquery_Maf error

GDCquery_Maf error 0 @76e1237b Last seen 1 day ago Singapore Hi all, I really need some help. I am trying to run GDCquery_Maf which worked fine until yesterday. Now I get the following error: Error in GDCquery(paste0(“TCGA-“, tumor), data.category = “Simple Nucleotide Variation”, : Please set a valid workflow.type argument…

Continue Reading GDCquery_Maf error

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38 1 @b14a6f0d Last seen 16 hours ago United States Are subpopulation MAFs available for gnomADv.3.1.1 with any package, like they are in MafDb.gnomAD.r2.1.hs37d5? I’m trying to use Genomic Scores to obtain all variants in a genomic range with MAF in any subpopulation >= cutoff. I tried…

Continue Reading subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

Bioconductor Package Installation

When I try to install the gtf for hg38 BiocManager::install(“TxDb.Hsapiens.UCSC.hg38.knownGene”) I get the following error: ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.2 (2021-11-01) Installing package(s) ‘TxDb.Hsapiens.UCSC.hg38.knownGene’ Error in readRDS(dest) : error reading from connection Per stackoverflow.com/questions/67455984/getoptionrepos-replaces-bioconductor-standard-repositories-see-reposito I…

Continue Reading Bioconductor Package Installation

Pathway analysis of RNAseq data using goseq package

Hello, I have finished the RNA seq analysis and I am trying to perform some pathway analysis. I have used the gage package and I was looking online about another package called goseq that takes into account length bias. However, when I run the code I get an error. How…

Continue Reading Pathway analysis of RNAseq data using goseq package

DESeq2 and high prefiltering cutoff

DESeq2 and high prefiltering cutoff 1 @255004b1 Last seen 3 hours ago United States Hi, I am curious about prefiltering with DESeq2. I understand from this site and reading the DESeq2 vignette that prefiletering is really unnecessary as DESeq2 has a stringent filtering that it does. However, I’m seeing better…

Continue Reading DESeq2 and high prefiltering cutoff

identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

GenomicFeatures::makeTxDbFromUCSC failing with an error: identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE 1 @mikhail-dozmorov-23744 Last seen 1 day ago United States Hi,The GenomicFeatures::makeTxDbFromUCSC function fails with: library(GenomicFeatures) > hg19.refseq.db <- makeTxDbFromUCSC(genome=”hg19″, table=”refGene”) Download the refGene table … Error in .fetch_UCSC_txtable(genome(session), tablename, transcript_ids = transcript_ids) : identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE OK The…

Continue Reading identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

Bioconductor – MLInterfaces

    This package is for version 3.3 of Bioconductor; for the stable, up-to-date release version, see MLInterfaces. Uniform interfaces to R machine learning procedures for data in Bioconductor containers Bioconductor version: 3.3 This package provides uniform interfaces to machine learning code for data in R and Bioconductor containers. Author:…

Continue Reading Bioconductor – MLInterfaces

Design formula in DESeq2

Hello, I am using DESeq2 for analysis of RNAseq data. I would like to ask you about the design in the DESEq2 formula. I have tissue from animals treated with a chemical and my animal model is a colorectal cancer model. My variables are gender (male or female), treatment (treated…

Continue Reading Design formula in DESeq2

Bioconductor – Ringo

DOI: 10.18129/B9.bioc.Ringo     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see Ringo. R Investigation of ChIP-chip Oligoarrays Bioconductor version: 3.9 The package Ringo facilitates the primary analysis of ChIP-chip data. The main functionalities of the package are data read-in, quality assessment, data…

Continue Reading Bioconductor – Ringo

Converting between UCSC id and gene symbol with bioconductor annotation resources

You need to use the Homo.sapiens package to make that mapping. > library(Homo.sapiens) Loading required package: AnnotationDbi Loading required package: stats4 Loading required package: BiocGenerics Loading required package: parallel Attaching package: ‘BiocGenerics’ The following objects are masked from ‘package:parallel’: clusterApply, clusterApplyLB, clusterCall, clusterEvalQ, clusterExport, clusterMap, parApply, parCapply, parLapply, parLapplyLB, parRapply,…

Continue Reading Converting between UCSC id and gene symbol with bioconductor annotation resources

Outliers on DESEq2 Results

I have an RNAseq dataset, where one of the genes I intend to analyze has hundreds of counts ranging from 10 to 12, with a few counts > 9000. I process this data in Deseq2 and get that the gene is differentially expressed across several samples of interest. What can…

Continue Reading Outliers on DESEq2 Results

Bioconductor – PICS

DOI: 10.18129/B9.bioc.PICS     Probabilistic inference of ChIP-seq Bioconductor version: Release (3.5) Probabilistic inference of ChIP-Seq using an empirical Bayes mixture model approach. Author: Xuekui Zhang <xzhang at stat.ubc.ca>, Raphael Gottardo <rgottard at fhcrc.org> Maintainer: Renan Sauteraud <rsautera at fhcrc.org> Citation (from within R, enter citation(“PICS”)): Installation To install this…

Continue Reading Bioconductor – PICS

Bioconductor – DESeq2

DOI: 10.18129/B9.bioc.DESeq2     This package is for version 3.10 of Bioconductor; for the stable, up-to-date release version, see DESeq2. Differential gene expression analysis based on the negative binomial distribution Bioconductor version: 3.10 Estimate variance-mean dependence in count data from high-throughput sequencing assays and test for differential expression based on…

Continue Reading Bioconductor – DESeq2

Bioconductor – GGtools

DOI: 10.18129/B9.bioc.GGtools     This package is for version 3.12 of Bioconductor. This package has been removed from Bioconductor. For the last stable, up-to-date release version, see GGtools. software and data for analyses in genetics of gene expression Bioconductor version: 3.12 software and data for analyses in genetics of gene…

Continue Reading Bioconductor – GGtools

weird MAplot or volcano plot of DESeq2 diff result

Hi, every one. I find a werid MAplot or volcano plot of DESeq reuslt. I am wondering whether you can give me some advice. This diff result is from two cell type bulk RNA-seq. I use two specific marker to get these two cell type using Flow cytometer. I alreadly…

Continue Reading weird MAplot or volcano plot of DESeq2 diff result