Tag: TruSeq

How to remove Illumina TruSeq Index adapters reverse (R2 reads ) 0 I used Ilumina TruSeq the Illumina TruSeq Index Adapters. I have paired-end data I was successfully able to remove the index adapter from R1 (Forward reads). TruSeq_Index_Adapter reverse compliment cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -A CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TruSeq_Index_Adapter cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG…

Interpreting read coverage over gene body plot 0 Hi, I’m working on some RNA-seq data for my thesis and I was hoping that someone could help me out. My sequencing library was prepared using Illumina TruSeq Stranded mRNA kit and sequenced with a NovaSeq sequencer. After read alignment I did…

Introduction Nuclear protein in testis (NUT) carcinoma (NC) is defined by the rearrangement of the chromosomal region 15q14 harboring the NUTM1 gene. As a clinically aggressive neoplasm with poor differentiation, NC was previously believed to occur primarily in children and young adolescents. However, with an increasing number of reports, middle-aged…

HTSeq-count TruSeq RNA Exome Lib Prep 0 Hello, I observed a high percentage of “no features” while running HTseq w/ the –stranded yes option enabled (>80%). The library prep kit I am using is Illumina TruSeq RNA Exome which generates stranded data. If I run HTseq-count w/ strand == “no”…

Trimming of adapters and indexes 0 I investigate a protein which binds small DNA (<30 nt) and have a library of these small DNA. I know that adapters and indexes are from this site (5′ adapter has T instead of U). [To reach the page I want to show click…

Dear all, Recently, I have been asked to do preprocessing of some fastq files produced by Illumina (I don’t know which machine produced data). This is information of a fastq file (forward); @A00957:111:H5MTHDSX2:3:1101:2718:1063 1:N:0:TCCGCGAA+AGGCTATA CTGACCTCAAGTGATCTACCCACCTCGGTCTCCCAAAGTGCTGGGATTACAGGCAGGAGCCACTGCCCCTGGCCCTAATCATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATGCCGGCGTCTGCTTGAAA when I asked adapter sequences from the company, they provided me them as D710-501 TCCGCGAATATAGCCT…