Categories
Tag: TruSeq
invalid deflate data (invalid code lengths set)
I am trying to trim paired end reads using Trim-Galore. I have made sure that the files match based on the total reads processed in the output txt file from trim-galore. One of the files trimmed correctly but when I try some of the others the total written and quality…
Java class error message when using BBDuk
Java class error message when using BBDuk 0 I am trying to run BBDuk to quality trim and filter my illumina whole genome sequences. I have used other trimming scripts before and have not had a problem. Although this is my first time preprocessing sequencing data from Quantseq samples. I…
Whole Exome Sequencing Market Insights and Forecast to 2031 | Illumina, Thermo Fisher, Roche
PRESS RELEASE Published December 7, 2023 Introduction: “Whole Exome Sequencing Market” New Research Insight Report 2023 | Spread Across 108 Pages Report which provides an in-depth analysis Based on Regions, Applications (Correlation Research of Normal Human, Mendelian Disease and Rare Syndrome Gene Discovery, The Research of Complex Diseases, Mouse Exome…
Alfalfa vein mottling virus, a novel potyvirid infecting Medicago sativa L. | Virology Journal
Plant material Five alfalfa plants (stems and leaves) were sampled from each of the four different fields, 10–15 acres in size, located in Yuma Country, Arizona, USA. Geographic coordinates of the alfalfa fields and the adjacent crops are shown in Table 1. Table 1 Geographic locations of alfalfa fields Total…
Myeloid/Lymphoid Neoplasms with ETV6::PDGFRB Fusion Gene
Introduction The ETV6::PDGFRB fusion gene is commonly associated with myeloid neoplasms with monocytosis (such as CMML), and with eosinophilia.1 The PDGFRB gene, located on 5q33, encodes PDGFRβ, a type III tyrosine kinase comprising an extracellular domain consisting of five immunoglobulin (Ig)-like domains, a single-transmembrane helix domain, a juxtamembrance domain, and…
RNA-Seq with DNA contamination, any way to salvage the data?
RNA-Seq with DNA contamination, any way to salvage the data? 1 Hello, My group has performed RNA-Seq using Illumina Truseq RNA Exome kit, we performed alignments with HISAT2 and we noticed that a good portion of our samples had DNA contamination. So far, I have seen a lot of discussion…
Are truseq adapter sequences picked up by FASTQC?
Are truseq adapter sequences picked up by FASTQC? 1 Hello, I am testing a new software that is supposed to automatically detect adapters and remove them. I am using the adapters shown here: support-docs.illumina.com/SHARE/AdapterSequences/Content/SHARE/AdapterSeq/TruSeq/UDIndexes.htm I run the demultiplexing+ adapter trimming and the software does not see to recognize this adapter….
Investigating the miniaturization of DNA library prep for Illumina sequencing
Recent advancements in next-generation sequencing have led to substantial increases in throughput, coupled with reduced expenses. Due to these improvements, the process of library preparation has become even more of a financial and time constraint to high throughput sequencing core facilities. Nonetheless, with the help of automation in the form…
Cost-effective DNA methylation profiling by FML-seq
The FML-seq method The protocol for FML-seq comprises only three steps (Fig 1A). First, genomic DNA (gDNA) is digested by a methylation-dependent restriction endonuclease that cuts at a certain distance from the 5-methylcytosine or 5-hydroxymethylcytosine in its motif and leaves a short overhang (10). Second, a master mix is added…
TruSeq strand-specificity in rsem-calculate-expression
TruSeq strand-specificity in rsem-calculate-expression 3 Hello, I’m trying to figure out the settings for analysing strand-specific RNA-Seq data from Illumina TruSeq chemistry with rsem-calculate-expression Specifically, regarding the –forward-prob parameter, the manual has this to say: ….Set to 1 for a strand-specific protocol where all (upstream) reads are derived from the…
DNA-bridging by an archaeal histone variant via a unique tetramerisation interface
Chromatin isolation and MNase digestion M. jannaschii DSM 2661 cells were grown in 100 l fermenters in minimal medium containing 0.3 mM K2HPO4, 0.4 mM KH2PO4, 3.6 mM KCl, 0.4 M NaCl, 10 mM NaHCO3, 2.5 mM CaCl2, 38 mM MgCl2, 22 mM NH4Cl, 31 µM Fe(NH4)2(SO4)2, 1 mM C6H9NO6, 1.2 µM MgSO4, 0.4 mM CuSO4, 0.3 µM MnSO4, 36 nM FeSO4, 36 nM CoSO4, 3.5 nM…
Exome Sequencing Market Size, Business Opportunity and Future Demand by 2030
PRESS RELEASE Published September 4, 2023 United States – A new study from Infinity Business Insights provides a complete analysis of the Exome Sequencing Market, as well as insights into the market’s major drivers. Different elements such as possibilities, size, development, technologies, demand, and development of high major players have…
PolyA and PolyG sequences in FastQC/MultiQC report
Hello, We sent our samples off for RNA exome sequencing. We normally do mRNA sequencing but our RNA was degraded so RNA exome sequencing was recommended. We used the TruSeq RNA Exome kit. I am encountering issues I haven’t experienced before when trimming reads. Below is the adapter content from…
Which strand that the reads from.
Single-end strand specific Rna-Seq: Which strand that the reads from. 0 Hi everyone, I have searched online for a long time, but there is still no authoritative answer to this question (for single-end sequencing). So, I pointed it out here for clarification for the fresh people using single-end sequencing. I…
bcl2fastq conversion with specifying exact match of indices
bcl2fastq conversion with specifying exact match of indices 0 Hello everyone, I recently ran a NextSeq 2000 using 6-nucleotide Illumina TruSeq unique indices. My goal is to demultiplex using bcl2fastq and extract only the reads that match my indices. However, there’s a complication: the run included samples from another person…
Genotyped functional screening of soluble Fab clones enables in-depth analysis of mutation effects
Bacterial strains, vectors and cloning E. coli XL-1 Blue (recA1 endA1 gryA96 thi-1 hsdR17 supE44 relA1 lac [F’ proAB lacI q Z\(\Delta \)M15 Tn10 (Tet r)]), originally purchased from Stratagene (USA), was used for all phage display selections and Fab expression in screening. pEB32x6 phagemid vector (later “display vector”) was…
Whole Exome Sequencing Market Share, Size and Forecast to 2030 | Illumina, Thermo Fisher, Roche
Introduction: “Whole Exome Sequencing Market” New Research Insight Report 2023 | Spread Across 108 Pages Report which provides an in-depth analysis Based on Regions, Applications (Correlation Research of Normal Human, Mendelian Disease and Rare Syndrome Gene Discovery, The Research of Complex Diseases, Mouse Exome Sequencing), and Types (Agilent HaloPlex, Agilent…
BBDuk Guide – DOE Joint Genome Institute
“Duk” stands to Decontamination Using Kmers. BBDuk was made to combine many common data-quality-related trimming, filtering, and masking actions into an single high-performance tool. It are capable of quality-trimming or filtering, adapter-trimming, contaminant-filtering via kmer matching, sequence masking, GC-filtering, length filtering, entropy-filtering, format conversion, histogram generation, subsampling, quality-score recalibration, kmer…
Removing overrepresented sequences in paired end RNA-seq
Removing overrepresented sequences in paired end RNA-seq 0 After trimming and QC’ing RNAseq for adapters with trim_galore, should I remove overrepresented sequences that FastQC identifies as possible adapter/primer source? If so, is there a way to do so automatically? For what it’s worth, both of the identified sequences start with…
How to figure out adapter sequences in RNA seq?
How to figure out adapter sequences in RNA seq? 1 Hello, I am trying to understand where do the adapter sequences that need to be trimmed from the data come from? Do they come from the kits that are used to prepare the library? For example, if I switch from…
A dataset of micro biodiversity in benthic sediment at a global scale
Sample collection Deep-sea sediment samples were collected from the Atlantic Ocean, the Pacific Ocean and the Indian Ocean using sealable sampling boxes (Oktopus, Germany) during the 22nd, 26th, 30th, 34th, 38th, 39th, 40th and 45th cruises of Oceanic Vessel No. 1. The longitude, latitude, depth and other essential information of…
Chinese population with hailey-hailey disease
Introduction Hailey–Hailey disease (HHD; Online Mendelian Inheritance in Man no. 169600), also known as familial benign chronic pemphigus, is a rare autosomal dominant inherited blistering dermatosis. It is characterized by recurrent blisters, erythema, and vesicles predominantly located in the neck, axilla, groin, and breast folds.1 Histopathologically, HHD is characterized by…
Not annotated metagenome-assembled genomes recovered from rumen samples from cows
Protozoa comprise a major fraction of the microbial biomass in the rumen microbiome, of which the genera Entodinium has been consistently observed to be dominant across a diverse genetic and geographical range of ruminant hosts. Despite the apparent core role that species such as Entodinium caudatum exert, their greater…
DanMAC5: a browser of aggregated sequence variants from 8,671 whole genome sequenced Danish individuals | BMC Genomic Data
Demographics Data from three studies were included: Dan-NICAD: 1,649 individuals with symptoms of obstructive coronary artery disease, predominantly chest pain, undergoing coronary computed tomography angiography. In total, 52% were females, the mean age was 57 years (+/- 9 SD), median coronary artery calcium score were 0 [0–82] and 24% of…
Illumina TruSeq Stranded total Sample Preparation Protocol | CHMI services – TruSeq Stranded Total RNA
Preparation of total transcriptome libraries for sequencing on an Illumina dais Edit me Documentation TruSeq Running Absolute RNA Sample Prep Guide. This method makes a cDNA library of all RNA molecules presentational in your spot after rRNA depletion. Important: the succeed of this kit is dependent on of ability of…
The cost-effectiveness of whole genome sequencing in neurodevelopmental disorders
Study design This study was designed as a retrospective observational study that compared historical data on healthcare costs, diagnostic yield and type of genetic tests between two cohorts of patients referred to the department of Clinical Genetics at the Karolinska University Hospital. One cohort (cohort CMA) represented standard care, with…
Trimmomatic(0.33) java error [Exception in thread “main” java.lang.ArrayIndexOutOfBoundsException: 1]
Trimmomatic(0.33) java error [Exception in thread “main” java.lang.ArrayIndexOutOfBoundsException: 1] 0 Hi everyone, I am trying to use trimmomatic on a few RNAseq files but I keep getting the error below. I have tried changing the path and checked for any white spaces but I keep getting the same error. java…
Tools to merge overlapping paired-end reads
Introduction In very simple terms, current sequencing technology begins by breaking up long pieces of DNA into lots more short pieces of DNA. The resultant set of DNA is called a “library” and the short pieces are called “fragments”. Each of the fragments in the library are then sequenced individually…
Chromosome-level genome assembly of the critically endangered Baer’s pochard (Aythya baeri)
Ethics statement All animal handling and experimental procedures were approved by the Qufu Normal University Biomedical Ethics Committee (approval number: 2022001). Sample and sequencing Baer’s pochard tissue for whole-genome sequencing was obtained from a dead individual that had strayed into a fishing net in Shandong (China). The muscle tissue that…
how to know what adapter sequences to trim for RNA-seq?
how to know what adapter sequences to trim for RNA-seq? 0 Hello, I’m very new to RNA-seq analysis and am currently stuck on the trimming step. The libraries I am trying to analyze were built using the NEXTFLEX Rapid Directional RNA-seq kit with their Unique Dual Index Barcodes (perkinelmer-appliedgenomics.com/wp-content/uploads/2022/02/NOVA-51292X-NEXTFLEX-RNA-Seq-2-0-UDI-Barcodes-V22-02-new.pdf). They…
Hypoxia-induced transcriptional differences in African and Asian versus European diabetic cybrids
Human subjects Research involving human subjects was approved by the Institutional Review Board of the University of California, Irvine (#2003-3131). All enrolled patients provided written, informed consent. Clinical investigations were performed based on the ethical principles of the Declaration of Helsinki26. Cybrid generation Patient blood was collected in tubes containing…
Whole genome sequencing of high-grade serous ovarian cancer (HGSC) tumours and matched normals from 15 patients with homologous recombination deficiencies. The dataset includes fastq files from 56 HGSC tumours (1 primary, 1 relapse, 54 end-stage) and 15 matched normals. Sequence libraries were generated from tumour and matched normal genomic DNA using the KAPA HyperPrep PCR-free library preparation kit (Roche), or the Illumina TruSeq DNA Nano kit according to manufacturer’s instructions. Sequencing was carried out by the Kinghorn Centre for Clinical Genomics Sequencing Laboratory (Sydney, Australia) on the HiSeq X Ten System (Illumina) or by the Australian Genome Research Facility (Melbourne, Australia) on an Illumina NovaSeq to a minimum base coverage of 30-fold for normal DNA and 60-fold for tumour DNA samples.
Dataset Description Whole genome sequencing of high-grade serous ovarian cancer (HGSC) tumours and matched normals from 15 patients with homologous recombination deficiencies. The dataset includes fastq files from 56 HGSC tumours (1 primary, 1 relapse, 54 end-stage) and 15 matched normals.Sequence libraries were generated from tumour and matched normal genomic…
TruSeq Illumina adapters are BLASTed with a high confidence to some genes/terms
TruSeq Illumina adapters are BLASTed with a high confidence to some genes/terms 1 The sequence you provide is the beginning of the Illumina adapter as in the document you link. I see no problem here. It is only 0.27% of reads, so why bother? As for this BLAST search, I…
Adaptor sequences in GIAB samples
Hello, I am trying to learn DNA sequencing analysis by using GIAB datasets [Link to Chinese trio – HG005_NA24631_son/], the readme file they had provided does not provide the adapter sequences used. I tried to use bbmerge.sh like in this biostars post ; bbmerge.sh in1=r1.fq in2=r2.fq outa=adapters.fa and it identified…
Strand-specific in HT-Seq
Strand-specific in HT-Seq 0 Hello everyone, I’m going through some published RNA-seq data and I’m about to start quantifying the abundance of transcripts with HT-Seq, however I don’t know what to put in strand-specific (-s <yes/no/reverse>) . In the article description it indicates that TruSeq Stranded Total RNA was used,…
Whole Genome DNA Illumina sequencing – Infravec2
Description Material provided: dataUnit definition: Whole Genome SequencingLibrary Preparation: Illumina DNA Prep or TruSeq Nano Sample Prep Kit400 million reads for 2×150 Paired End Length equivalent to ca 30X sequence depth for 1 sample of Aedes spp (estimated genome size: 1.38 Gb) or to ca 100X sequence depth for 1…
How to remove Illumina TruSeq Index adapters reverse (R2 reads )
How to remove Illumina TruSeq Index adapters reverse (R2 reads ) 0 I used Ilumina TruSeq the Illumina TruSeq Index Adapters. I have paired-end data I was successfully able to remove the index adapter from R1 (Forward reads). TruSeq_Index_Adapter reverse compliment cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -A CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TruSeq_Index_Adapter cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG…
Interpreting read coverage over gene body plot
Interpreting read coverage over gene body plot 0 Hi, I’m working on some RNA-seq data for my thesis and I was hoping that someone could help me out. My sequencing library was prepared using Illumina TruSeq Stranded mRNA kit and sequenced with a NovaSeq sequencer. After read alignment I did…
Nuclear protein in testis carcinoma
Introduction Nuclear protein in testis (NUT) carcinoma (NC) is defined by the rearrangement of the chromosomal region 15q14 harboring the NUTM1 gene. As a clinically aggressive neoplasm with poor differentiation, NC was previously believed to occur primarily in children and young adolescents. However, with an increasing number of reports, middle-aged…
HTSeq-count TruSeq RNA Exome Lib Prep
HTSeq-count TruSeq RNA Exome Lib Prep 0 Hello, I observed a high percentage of “no features” while running HTseq w/ the –stranded yes option enabled (>80%). The library prep kit I am using is Illumina TruSeq RNA Exome which generates stranded data. If I run HTseq-count w/ strand == “no”…
Trimming of adapters and indexes
Trimming of adapters and indexes 0 I investigate a protein which binds small DNA (<30 nt) and have a library of these small DNA. I know that adapters and indexes are from this site (5′ adapter has T instead of U). [To reach the page I want to show click…
illumina adapter specifying and removing using fastp
Dear all, Recently, I have been asked to do preprocessing of some fastq files produced by Illumina (I don’t know which machine produced data). This is information of a fastq file (forward); @A00957:111:H5MTHDSX2:3:1101:2718:1063 1:N:0:TCCGCGAA+AGGCTATA CTGACCTCAAGTGATCTACCCACCTCGGTCTCCCAAAGTGCTGGGATTACAGGCAGGAGCCACTGCCCCTGGCCCTAATCATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATGCCGGCGTCTGCTTGAAA when I asked adapter sequences from the company, they provided me them as D710-501 TCCGCGAATATAGCCT…