Tag: TruSeq

  Protozoa comprise a major fraction of the microbial biomass in the rumen microbiome, of which the genera Entodinium has been consistently observed to be dominant across a diverse genetic and geographical range of ruminant hosts. Despite the apparent core role that species such as Entodinium caudatum exert, their greater…

Demographics Data from three studies were included: Dan-NICAD: 1,649 individuals with symptoms of obstructive coronary artery disease, predominantly chest pain, undergoing coronary computed tomography angiography. In total, 52% were females, the mean age was 57 years (+/- 9 SD), median coronary artery calcium score were 0 [0–82] and 24% of…

Preparation of total transcriptome libraries for sequencing on an Illumina dais Edit me Documentation TruSeq Running Absolute RNA Sample Prep Guide. This method makes a cDNA library of all RNA molecules presentational in your spot after rRNA depletion. Important: the succeed of this kit is dependent on of ability of…

Study design This study was designed as a retrospective observational study that compared historical data on healthcare costs, diagnostic yield and type of genetic tests between two cohorts of patients referred to the department of Clinical Genetics at the Karolinska University Hospital. One cohort (cohort CMA) represented standard care, with…

Trimmomatic(0.33) java error [Exception in thread “main” java.lang.ArrayIndexOutOfBoundsException: 1] 0 Hi everyone, I am trying to use trimmomatic on a few RNAseq files but I keep getting the error below. I have tried changing the path and checked for any white spaces but I keep getting the same error. java…

Introduction In very simple terms, current sequencing technology begins by breaking up long pieces of DNA into lots more short pieces of DNA. The resultant set of DNA is called a “library” and the short pieces are called “fragments”. Each of the fragments in the library are then sequenced individually…

Ethics statement All animal handling and experimental procedures were approved by the Qufu Normal University Biomedical Ethics Committee (approval number: 2022001). Sample and sequencing Baer’s pochard tissue for whole-genome sequencing was obtained from a dead individual that had strayed into a fishing net in Shandong (China). The muscle tissue that…

how to know what adapter sequences to trim for RNA-seq? 0 Hello, I’m very new to RNA-seq analysis and am currently stuck on the trimming step. The libraries I am trying to analyze were built using the NEXTFLEX Rapid Directional RNA-seq kit with their Unique Dual Index Barcodes (perkinelmer-appliedgenomics.com/wp-content/uploads/2022/02/NOVA-51292X-NEXTFLEX-RNA-Seq-2-0-UDI-Barcodes-V22-02-new.pdf). They…

Human subjects Research involving human subjects was approved by the Institutional Review Board of the University of California, Irvine (#2003-3131). All enrolled patients provided written, informed consent. Clinical investigations were performed based on the ethical principles of the Declaration of Helsinki26. Cybrid generation Patient blood was collected in tubes containing…

Dataset Description Whole genome sequencing of high-grade serous ovarian cancer (HGSC) tumours and matched normals from 15 patients with homologous recombination deficiencies. The dataset includes fastq files from 56 HGSC tumours (1 primary, 1 relapse, 54 end-stage) and 15 matched normals.Sequence libraries were generated from tumour and matched normal genomic…

TruSeq Illumina adapters are BLASTed with a high confidence to some genes/terms 1 The sequence you provide is the beginning of the Illumina adapter as in the document you link. I see no problem here. It is only 0.27% of reads, so why bother? As for this BLAST search, I…

Hello, I am trying to learn DNA sequencing analysis by using GIAB datasets [Link to Chinese trio – HG005_NA24631_son/], the readme file they had provided does not provide the adapter sequences used. I tried to use bbmerge.sh like in this biostars post ; bbmerge.sh in1=r1.fq in2=r2.fq outa=adapters.fa and it identified…

Strand-specific in HT-Seq 0 Hello everyone, I’m going through some published RNA-seq data and I’m about to start quantifying the abundance of transcripts with HT-Seq, however I don’t know what to put in strand-specific (-s <yes/no/reverse>) . In the article description it indicates that TruSeq Stranded Total RNA was used,…

Description Material provided: dataUnit definition: Whole Genome SequencingLibrary Preparation: Illumina DNA Prep or TruSeq Nano Sample Prep Kit400 million reads for 2×150 Paired End Length equivalent to ca 30X sequence depth for 1 sample of Aedes spp (estimated genome size: 1.38 Gb) or to ca 100X sequence depth for 1…

How to remove Illumina TruSeq Index adapters reverse (R2 reads ) 0 I used Ilumina TruSeq the Illumina TruSeq Index Adapters. I have paired-end data I was successfully able to remove the index adapter from R1 (Forward reads). TruSeq_Index_Adapter reverse compliment cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -A CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TruSeq_Index_Adapter cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG…

Interpreting read coverage over gene body plot 0 Hi, I’m working on some RNA-seq data for my thesis and I was hoping that someone could help me out. My sequencing library was prepared using Illumina TruSeq Stranded mRNA kit and sequenced with a NovaSeq sequencer. After read alignment I did…

Introduction Nuclear protein in testis (NUT) carcinoma (NC) is defined by the rearrangement of the chromosomal region 15q14 harboring the NUTM1 gene. As a clinically aggressive neoplasm with poor differentiation, NC was previously believed to occur primarily in children and young adolescents. However, with an increasing number of reports, middle-aged…

HTSeq-count TruSeq RNA Exome Lib Prep 0 Hello, I observed a high percentage of “no features” while running HTseq w/ the –stranded yes option enabled (>80%). The library prep kit I am using is Illumina TruSeq RNA Exome which generates stranded data. If I run HTseq-count w/ strand == “no”…

Trimming of adapters and indexes 0 I investigate a protein which binds small DNA (<30 nt) and have a library of these small DNA. I know that adapters and indexes are from this site (5′ adapter has T instead of U). [To reach the page I want to show click…

Dear all, Recently, I have been asked to do preprocessing of some fastq files produced by Illumina (I don’t know which machine produced data). This is information of a fastq file (forward); @A00957:111:H5MTHDSX2:3:1101:2718:1063 1:N:0:TCCGCGAA+AGGCTATA CTGACCTCAAGTGATCTACCCACCTCGGTCTCCCAAAGTGCTGGGATTACAGGCAGGAGCCACTGCCCCTGGCCCTAATCATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATGCCGGCGTCTGCTTGAAA when I asked adapter sequences from the company, they provided me them as D710-501 TCCGCGAATATAGCCT…