Tag: TruSeq

How to remove Illumina TruSeq Index adapters reverse (R2 reads )

How to remove Illumina TruSeq Index adapters reverse (R2 reads ) 0 I used Ilumina TruSeq the Illumina TruSeq Index Adapters. I have paired-end data I was successfully able to remove the index adapter from R1 (Forward reads). TruSeq_Index_Adapter reverse compliment cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -A CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TruSeq_Index_Adapter cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG…

Continue Reading How to remove Illumina TruSeq Index adapters reverse (R2 reads )

Interpreting read coverage over gene body plot

Interpreting read coverage over gene body plot 0 Hi, I’m working on some RNA-seq data for my thesis and I was hoping that someone could help me out. My sequencing library was prepared using Illumina TruSeq Stranded mRNA kit and sequenced with a NovaSeq sequencer. After read alignment I did…

Continue Reading Interpreting read coverage over gene body plot

Nuclear protein in testis carcinoma

Introduction Nuclear protein in testis (NUT) carcinoma (NC) is defined by the rearrangement of the chromosomal region 15q14 harboring the NUTM1 gene. As a clinically aggressive neoplasm with poor differentiation, NC was previously believed to occur primarily in children and young adolescents. However, with an increasing number of reports, middle-aged…

Continue Reading Nuclear protein in testis carcinoma

HTSeq-count TruSeq RNA Exome Lib Prep

HTSeq-count TruSeq RNA Exome Lib Prep 0 Hello, I observed a high percentage of “no features” while running HTseq w/ the –stranded yes option enabled (>80%). The library prep kit I am using is Illumina TruSeq RNA Exome which generates stranded data. If I run HTseq-count w/ strand == “no”…

Continue Reading HTSeq-count TruSeq RNA Exome Lib Prep

Trimming of adapters and indexes

Trimming of adapters and indexes 0 I investigate a protein which binds small DNA (<30 nt) and have a library of these small DNA. I know that adapters and indexes are from this site (5′ adapter has T instead of U). [To reach the page I want to show click…

Continue Reading Trimming of adapters and indexes

illumina adapter specifying and removing using fastp

Dear all, Recently, I have been asked to do preprocessing of some fastq files produced by Illumina (I don’t know which machine produced data). This is information of a fastq file (forward); @A00957:111:H5MTHDSX2:3:1101:2718:1063 1:N:0:TCCGCGAA+AGGCTATA CTGACCTCAAGTGATCTACCCACCTCGGTCTCCCAAAGTGCTGGGATTACAGGCAGGAGCCACTGCCCCTGGCCCTAATCATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATGCCGGCGTCTGCTTGAAA when I asked adapter sequences from the company, they provided me them as D710-501 TCCGCGAATATAGCCT…

Continue Reading illumina adapter specifying and removing using fastp