metY SAM V (53-MER) from Candidatus Pelagibacter ubique HTCC1062 (PDB 6FZ0, chain A)

Javascript is currently disabled or is not supported by this browser. Please enable JavaScript for full functionality. Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists. Automated summary: This ncRNA sequence is 53 nucleotides long and is found in Candidatus…

Continue Reading metY SAM V (53-MER) from Candidatus Pelagibacter ubique HTCC1062 (PDB 6FZ0, chain A)

Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-34a

Javascript is currently disabled or is not supported by this browser. Please enable JavaScript for full functionality. Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-34a URS000030BD69_61853 Automated summary: This miRNA sequence is 22…

Continue Reading Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-34a

Genome-wide identification of disease-causing copy number variations in 450 individuals with anorectal malformations

CNV analysis After the application of quality filter step I (gender mismatch), two patients were excluded. Through step II (call rate <98%), 40 patients were discarded and after step III (exceeded double of standard deviation), 12 more patients were excluded. In the remaining 396 individuals with ARM, a total of…

Continue Reading Genome-wide identification of disease-causing copy number variations in 450 individuals with anorectal malformations

Merging csv files with specific headers

Hello all, I have a directory with csv files (tab delimited). Each file have different sections (4 headers): miRDeep2 score novel miRNAs reported by miRDeep2 novel miRNAs, estimated false positives novel miRNAs, estimated true positives known miRNAs in species known miRNAs in data known miRNAs detected by miRDeep2 estimated signal-to-noise…

Continue Reading Merging csv files with specific headers

Genomic signatures associated with maintenance of genome stability and venom turnover in two parasitoid wasps

Genomic features of two Anastatus wasps, A. japonicus and A. fulloi We employed PacBio high-fidelity (HiFi) long-read sequencing and Illumina short-read sequencing technologies to generate high-quality contigs for two Anastatus wasps, A. japonicus and A. fulloi (Supplementary Tables 1 and 2). These contigs were further scaffolded using Hi-C libraries to…

Continue Reading Genomic signatures associated with maintenance of genome stability and venom turnover in two parasitoid wasps

Comprehensive Analysis of NPSR1-AS1 as a Novel Diagnostic and Prognostic Biomarker Involved in Immune Infiltrates in Lung Adenocarcinoma

The incidence of lung adenocarcinoma (LUAD), the most common subtype of lung cancer, continues to make lung cancer the largest cause of cancer-related deaths worldwide. Long noncoding RNAs (lncRNAs) have been shown to have a significant role in both the onset and progression of lung cancer. In this study, we…

Continue Reading Comprehensive Analysis of NPSR1-AS1 as a Novel Diagnostic and Prognostic Biomarker Involved in Immune Infiltrates in Lung Adenocarcinoma

Solved Please these Questions using R Studio #Q13. Plesse

Please these Questions using R Studio #Q13. Plesse write the code to install and load the mouse genome (BSgenome.Mmusculus.UCSC.mm10). If installing, this will probably take some time. #Q14. What is code to determine the length of the following chromosomes of the mouse genome (Mmusculus)? #chr3 and chr19 #Q15. What is…

Continue Reading Solved Please these Questions using R Studio #Q13. Plesse

UCSC Genome Browser | Encyclopedia MDPI

1. History Initially built and still managed by Jim Kent, then a graduate student, and David Haussler, professor of Computer Science (now Biomolecular Engineering) at the University of California, Santa Cruz in 2000, the UCSC Genome Browser began as a resource for the distribution of the initial fruits of the…

Continue Reading UCSC Genome Browser | Encyclopedia MDPI

Bedtools Bam To Bed With Code Examples

Bedtools Bam To Bed With Code Examples With this article, we’ll look at some examples of how to address the Bedtools Bam To Bed problem . bedtools bamtobed [OPTIONS] -i <BAM> As we have seen, a large number of examples were utilised in order to solve the Bedtools Bam To…

Continue Reading Bedtools Bam To Bed With Code Examples

Identification of unique DNA methylation sites in Kabuki syndrome using whole genome bisulfite sequencing and targeted hybridization capture followed by enzymatic methylation sequencing

Niikawa N, Matsuura N, Fukushima Y, Ohsawa T, Kajii T. Kabuki make-up syndrome: a syndrome of mentalretardation, unusual facies, large and protruding ears, and postnatal growth deficiency. J Pediatrics. 1981;99:565–9. CAS  Article  Google Scholar  Kuroki Y, Suzuki Y, Chyo H, Hata A, Matsui I. A new malformation syndrome of long…

Continue Reading Identification of unique DNA methylation sites in Kabuki syndrome using whole genome bisulfite sequencing and targeted hybridization capture followed by enzymatic methylation sequencing

Population-level variation in enhancer expression identifies disease mechanisms in the human brain

Schizophrenia Working Group of the Psychiatric Genomics Consortium. Biological insights from 108 schizophrenia-associated genetic loci. Nature 511, 421–427 (2014). PubMed Central  Article  CAS  Google Scholar  Visscher, P. M. et al. 10 years of GWAS discovery: biology, function, and translation. Am. J. Hum. Genet. 101, 5–22 (2017). CAS  PubMed  PubMed Central …

Continue Reading Population-level variation in enhancer expression identifies disease mechanisms in the human brain

Bioconductor – SNPlocs.Hsapiens.dbSNP155.GRCh37 (development version)

DOI: 10.18129/B9.bioc.SNPlocs.Hsapiens.dbSNP155.GRCh37     This is the development version of SNPlocs.Hsapiens.dbSNP155.GRCh37; to use it, please install the devel version of Bioconductor. Human SNP locations and alleles extracted from dbSNP Build 155 and placed on the GRCh37/hg19 assembly Bioconductor version: Development (3.16) The 929,496,192 SNPs in this package were extracted from…

Continue Reading Bioconductor – SNPlocs.Hsapiens.dbSNP155.GRCh37 (development version)

Job – Principal Biostistician/Bioinformatics job at Kenya Medical Research

Vacancy title: Principal Biostistician/Bioinformatics [ Type: FULL TIME , Industry: Research , Category: Research ] Jobs at: Kenya Medical Research – KEMRI Deadline of this Job: 06 October 2022   Duty Station: Within Kenya , Kisumu , East Africa SummaryDate Posted: Tuesday, September 20, 2022 , Base Salary: Not Disclosed…

Continue Reading Job – Principal Biostistician/Bioinformatics job at Kenya Medical Research

Human hg38 chr7:73,678,750-73,740,129 UCSC Genome Browser v435

Use drop-down controls below and press refresh to alter tracks displayed.Tracks with lots of items will automatically be displayed in more compact modes.    Custom Tracks H3K27ac Meta NeuN SCZhidedensesquishpackfull H3K27ac NeuN SCZ del_CRDhidedensesquishpackfull H3K27ac NeuN SCZ del_CRD_del_peakshidedensesquishpackfull H3K27ac Tissuehidedensesquishpackfull H3K27ac Tissue BDhidedensesquishpackfull H3K27ac Tissue BD del_CRDhidedensesquishpackfull H3K27ac Tissue BD…

Continue Reading Human hg38 chr7:73,678,750-73,740,129 UCSC Genome Browser v435

Differential enrichment of H3K9me3 in intrahepatic cholangiocarcinoma | BMC Medical Genomics

Sia D, Tovar V, Moeini A, Llovet JM. Intrahepatic cholangiocarcinoma: pathogenesis and rationale for molecular therapies. Oncogene. 2013;32(41):4861–70. CAS  Article  Google Scholar  Sungwan P, Lert-Itthiporn W, Silsirivanit A, Klinhom-On N, Okada S, Wongkham S, Seubwai W. Bioinformatics analysis identified CDC20 as a potential drug target for cholangiocarcinoma. PeerJ. 2021;9:e11067. Article …

Continue Reading Differential enrichment of H3K9me3 in intrahepatic cholangiocarcinoma | BMC Medical Genomics

Non-linear machine learning models incorporating SNPs and PRS improve polygenic prediction in diverse human populations

Study population The study sample included 34,072 unrelated (3rd degree or less) TOPMed participants from eight U.S. based cohort studies: Jackson Heart Study (JHS; n = 2504), Framingham Heart Study (FHS; n = 3520), Hispanic Community Health Study/Study of Latinos (HCHS/SOL; n = 6,408), Atherosclerosis Risk in Communities study (ARIC; n = 6197), Cardiovascular Health Study (CHS; n = 2835),…

Continue Reading Non-linear machine learning models incorporating SNPs and PRS improve polygenic prediction in diverse human populations

Loading reference genome from BSgenome

Loading reference genome from BSgenome 1 I am trying to run an analysis via the MutationalPatterns package. The first step is to install the BSgenome package, and then load a reference genome from BSgenome: library(“BSgenome”) ref_genome <- “BSgenome.Mmusculus.UCSC.mm39” library(ref_genome, character.only = TRUE) When I run my script, it gets hung…

Continue Reading Loading reference genome from BSgenome

Bioconductor – BSgenome.Btaurus.UCSC.bosTau9.masked (development version)

DOI: 10.18129/B9.bioc.BSgenome.Btaurus.UCSC.bosTau9.masked     This is the development version of BSgenome.Btaurus.UCSC.bosTau9.masked; for the stable release version, see BSgenome.Btaurus.UCSC.bosTau9.masked. Full masked genome sequences for Bos taurus (UCSC version bosTau9) Bioconductor version: Development (3.16) Full genome sequences for Bos taurus (Cow) as provided by UCSC (genome bosTau9) and stored in Biostrings objects….

Continue Reading Bioconductor – BSgenome.Btaurus.UCSC.bosTau9.masked (development version)

How to modify VCF file?

Hi community, I have a question: the SNP position in vcf file is from GRCh37/hg19, I need to change the position to GRCh38. So, I used UCSC liftover to replace the hg19 pos by GRCh38 pos and deleted some SNPs, then sorted the pos and saved to a new vcf…

Continue Reading How to modify VCF file?

extendedSequences length is not the required for DeepCpf1 (34bp)

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

Continue Reading extendedSequences length is not the required for DeepCpf1 (34bp)

SMARCE1 deficiency generates a targetable mSWI/SNF dependency in clear cell meningioma

Clapier, C. R., Iwasa, J., Cairns, B. R. & Peterson, C. L. Mechanisms of action and regulation of ATP-dependent chromatin-remodelling complexes. Nat. Rev. Mol. Cell Biol. 18, 407–422 (2017). CAS  PubMed  PubMed Central  Article  Google Scholar  Mashtalir, N. et al. Modular organization and assembly of SWI/SNF family chromatin remodeling complexes….

Continue Reading SMARCE1 deficiency generates a targetable mSWI/SNF dependency in clear cell meningioma

Somatic point mutations are enriched in non-coding RNAs with possible regulatory function in breast cancer

Torre, L. A., Siegel, R. L., Ward, E. M. & Jemal, A. Global cancer incidence and mortality rates and trends—an update. Cancer Epidemiol. Prev. Biomark. 25, 16–27 (2016). Article  Google Scholar  Gerasimova, E. et al. Wavelet-based multifractal analysis of dynamic infrared thermograms to assist in early breast cancer diagnosis. Front….

Continue Reading Somatic point mutations are enriched in non-coding RNAs with possible regulatory function in breast cancer

Bioconductor – BSgenome.Cjacchus.UCSC.calJac4

DOI: 10.18129/B9.bioc.BSgenome.Cjacchus.UCSC.calJac4     Full genome sequences for Callithrix jacchus (UCSC version calJac4) Bioconductor version: Release (3.15) Full genome sequences for Callithrix jacchus (Marmoset) as provided by UCSC (calJac4, May 2020) and wrapped in a BSgenome object. Author: The Bioconductor Dev Team Maintainer: Bioconductor Package Maintainer <maintainer at bioconductor.org> Citation…

Continue Reading Bioconductor – BSgenome.Cjacchus.UCSC.calJac4

downloading human rRNA.fasta

downloading human rRNA.fasta 1 I am trying to download human rRNA.fasta file. do you know where I can find this file? in one of the older post in this forum, someone said this file can be found on the UCSC but I did not manage. rRNA • 154 views •…

Continue Reading downloading human rRNA.fasta

Recent developments in miRNA based recombinant protein expression in CHO

Aguiar TQ, Santos SB, Martins IM, Domingues L, Oliveira C (2019) Production and bioengineering of recombinant pharmaceuticals. Proteins: sustainable source, processing and applications. Elsevier, Amsterdam, pp 259–293 Chapter  Google Scholar  Amadi IM, Agrawal V, Christianson T, Bardliving C, Shamlou P, LeBowitz JH (2020) Inhibition of endogenous miR-23a/miR-377 in CHO cells…

Continue Reading Recent developments in miRNA based recombinant protein expression in CHO

Error in SummarizedExperiment

I have installed DESeq2 version 1.36.0 samples <- colnames(txi$counts) group <- as.factor(c(“control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”, “control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”,”diet”)) coldata <- data.frame(samples, group, stringsAsFactors = F) coldata <- coldata[,c(“samples”,”group”)] coldata$samples <- factor(coldata$samples) coldata$group <- factor(coldata$group) rownames(coldata) <- sub(“fb”, “”, rownames(coldata)) all(rownames(coldata$samples) %in% colnames(txi)) all(rownames(coldata) == colnames(txi)) TRUE library(DESeq2) ddsTxi <- DESeqDataSetFromTximport(txi, colData = coldata, design =…

Continue Reading Error in SummarizedExperiment

Annotated file with gene ID (instead of gene symbol)

Annotated file with gene ID (instead of gene symbol) 0 @9cb59de3 Last seen 14 hours ago United States Hello, I am using “featureCounts” in Rsubread package for analyzing bulk RNA-seq of drosophila. Since there is no inbuilt annotations of drosophila, I am using a gtf file in the homepage of…

Continue Reading Annotated file with gene ID (instead of gene symbol)

Transcription Start Site

Transcription Start Site 2 What are the best databases to check out the transcription start sites of specific genes in human genome? TSS • 130 views wget -q -O – “http://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/wgEncodeGencodeBasicV19.txt.gz” | gunzip -c | awk ‘(int($7)< int($8)) {if($4==”+”) {printf(“%s\t%d\t%d\t%s\t%s\n”,$3,$7,int($7)+1,$2,$4);}else {printf(“%s\t%d\t%d\t%s\t%s\n”,$3,int($8)-3,$8,$2,$4);}}’ chr1 69090 69091 ENST00000335137.3 + chr1 139306 139309 ENST00000423372.3…

Continue Reading Transcription Start Site

Bioinformatics Scientist III – D3b at Children`s Hospital of Philadelphia

Job details Job type full-time Full job description Location: loc_roberts-roberts ctr pediatric research req id: 134035 shift: days employment status: regular – full time job summary the bioinformatics unit (bixu) within the center for data driven discovery (d3b) at the children’s hospital of philadelphia (chop) is seeking a level iii…

Continue Reading Bioinformatics Scientist III – D3b at Children`s Hospital of Philadelphia

Pangenome-based genome inference allows efficient and accurate genotyping across a wide spectrum of variant classes

Sequencing data We used publicly available sequencing data from the GIAB consortium45, 1000 Genomes Project high-coverage data46 and Human Genome Structural Variation Consortium (HGSVC)4. All datasets include only samples consented for public dissemination of the full genomes. Statistics and reproducibility For generating the assemblies, we used all 14 samples for…

Continue Reading Pangenome-based genome inference allows efficient and accurate genotyping across a wide spectrum of variant classes

UCSC and Amazon Web Services work to accelerate genomics research

The UC Santa Cruz Genomics Institute is collaborating with Amazon Web Services (AWS) to allow researchers to quickly and efficiently execute bioinformatics pipelines on AWS’s global cloud infrastructure. AWS and UCSC are committed to accelerating genomics research by integrating the Dockstore project, a leading repository for scientific and biomedical workflows…

Continue Reading UCSC and Amazon Web Services work to accelerate genomics research

‘No genomes installed!’ error from getREF

I was trying to use the getPlotSetArray() function, but I got the error ‘No genomes installed!’ from the getREF function. I digged into the problem and it turns out that in the latest version of the BSgenome package the output of the function BSgenome::installed.genomes(splitNameParts=TRUE) changed from: pkgname organism provider provider_version…

Continue Reading ‘No genomes installed!’ error from getREF

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38 1 @b14a6f0d Last seen 16 hours ago United States Are subpopulation MAFs available for gnomADv.3.1.1 with any package, like they are in MafDb.gnomAD.r2.1.hs37d5? I’m trying to use Genomic Scores to obtain all variants in a genomic range with MAF in any subpopulation >= cutoff. I tried…

Continue Reading subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

Difference between knownGene and wgEncodeGencodeCompV39

Hi: I am a bit confuse with the the relationship/difference between knownGene and wgEncodeGencodeCompV39 on UCSC Table Browser. Anyone know the precise difference between them? They both can be downloaded from the goldenPath page. knownGene: The schema is here, which is NOT match the file (knownGene.txt.gz) I downloaded. According to…

Continue Reading Difference between knownGene and wgEncodeGencodeCompV39

South-to-north migration preceded the advent of intensive farming in the Maya region

Moreno-Mayar, J. V. et al. Early human dispersals within the Americas. Science 362, eaav2621 (2018). ADS  PubMed  Google Scholar  Posth, C. et al. Reconstructing the deep population history of Central and South America. Cell 175, 1185–1197.e22 (2018). CAS  PubMed  PubMed Central  Google Scholar  Raghavan, M. et al. Genomic evidence for…

Continue Reading South-to-north migration preceded the advent of intensive farming in the Maya region

Bioconductor – BSgenome.Ppaniscus.UCSC.panPan1

DOI: 10.18129/B9.bioc.BSgenome.Ppaniscus.UCSC.panPan1     Full genome sequences for Pan paniscus (UCSC version panPan1) Bioconductor version: Release (3.14) Full genome sequences for Pan paniscus (Bonobo) as provided by UCSC (panPan1, May 2012) and stored in Biostrings objects. Author: The Bioconductor Dev Team Maintainer: Bioconductor Package Maintainer <maintainer at bioconductor.org> Citation (from…

Continue Reading Bioconductor – BSgenome.Ppaniscus.UCSC.panPan1

Low transcript quantification with Salmon using GRCm39 annotations

Hi everyone, first time working with mouse samples and unfortunately, there are fewer resources available for the latest mouse Ensembl genome than I was expecting. What I’ve done: I performed rRNA depletion on total RNA extracted from mouse tissue and created Illumina libraries using a cDNA synthesis kit with random…

Continue Reading Low transcript quantification with Salmon using GRCm39 annotations

TargetScanHuman 7.1

TargetScanHuman 7.1 * broadly conserved = conserved across most vertebrates, usually to zebrafish  conserved = conserved across most mammals, but usually not beyond placental mammals TargetScan predicts biological targets of miRNAs by searching for the presence of conserved 8mer, 7mer, and 6mer sites that match the seed region of each…

Continue Reading TargetScanHuman 7.1

Efficient way of mapping UniProt IDs to representative UniRef90 IDs?

You can do this directly on UniProt: www.uniprot.org/uploadlists/ Just paste or upload your list of UniProt IDs, and select “UniProtKB AC/ID” in the “From” field and “UniParc” in the “To” field I’ve also written a script, pasted below, that can do this with some useful options: $ uniprot_map.pl -h uniprot_map.pl…

Continue Reading Efficient way of mapping UniProt IDs to representative UniRef90 IDs?

Bioconductor – TAPseq

DOI: 10.18129/B9.bioc.TAPseq     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see TAPseq. Targeted scRNA-seq primer design for TAP-seq Bioconductor version: 3.12 Design primers for targeted single-cell RNA-seq used by TAP-seq. Create sequence templates for target gene panels and design gene-specific primers using…

Continue Reading Bioconductor – TAPseq

Bioconductor – branchpointer

DOI: 10.18129/B9.bioc.branchpointer     Prediction of intronic splicing branchpoints Bioconductor version: Release (3.14) Predicts branchpoint probability for sites in intronic branchpoint windows. Queries can be supplied as intronic regions; or to evaluate the effects of mutations, SNPs. Author: Beth Signal Maintainer: Beth Signal <b.signal at garvan.org.au> Citation (from within R,…

Continue Reading Bioconductor – branchpointer

[Cbseweb] Arabidopsis genome in UCSC genome browser

A question for the browser group. ———- Forwarded message ———-From: *Colaneri, Alejandro Cesar*Date: Saturday, June 16, 2012Subject: [Cbseweb] Arabidopsis genome in UCSC genome browserTo: “***@cbse.ucsc.edu” <***@soe.ucsc.edu> I was trying to use the TABLE function for the Arabidopsis genome browser epigenomics.mcdb.ucla.edu/contacts.html Do I need special permit to access to this function?…

Continue Reading [Cbseweb] Arabidopsis genome in UCSC genome browser

Bioconductor – txcutr (development version)

DOI: 10.18129/B9.bioc.txcutr     This is the development version of txcutr; for the stable release version, see txcutr. Transcriptome CUTteR Bioconductor version: Development (3.15) Various mRNA sequencing library preparation methods generate sequencing reads specifically from the transcript ends. Analyses that focus on quantification of isoform usage from such data can…

Continue Reading Bioconductor – txcutr (development version)

Bioconductor – r3Cseq

    This package is for version 3.3 of Bioconductor; for the stable, up-to-date release version, see r3Cseq. Analysis of Chromosome Conformation Capture and Next-generation Sequencing (3C-seq) Bioconductor version: 3.3 This package is an implementation of data analysis for the long-range interactions from 3C-seq assay. Author: Supat Thongjuea, MRC Molecular…

Continue Reading Bioconductor – r3Cseq

The Difference Between Genome Reference(scRNAseq) And Transcriptome Reference(bulk RNAseq)

I want to know the difference between Genome Reference in scRNAseq and transcriptome reference in bulk RNAseq. But I didn’t get any better answer in any other place. I know we could download genome reference from UCSC, NCBI, ENSEMBL and GENECODE for bulk RNAseq. And here are the links below:…

Continue Reading The Difference Between Genome Reference(scRNAseq) And Transcriptome Reference(bulk RNAseq)

Bioconductor – BSgenome.Scerevisiae.UCSC.sacCer3

DOI: 10.18129/B9.bioc.BSgenome.Scerevisiae.UCSC.sacCer3     This package is for version 3.10 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Scerevisiae.UCSC.sacCer3. Saccharomyces cerevisiae (Yeast) full genome (UCSC version sacCer3) Bioconductor version: 3.10 Saccharomyces cerevisiae (Yeast) full genome as provided by UCSC (sacCer3, April 2011) and stored in Biostrings objects. Author: The…

Continue Reading Bioconductor – BSgenome.Scerevisiae.UCSC.sacCer3

Extract longest transcript or longest CDS transcript from GTF annotation file or gencode transcripts fasta file.

There are four types of methods to extract longest transcript or longest CDS regeion with longest transcript from transcripts fasta file or GTF file. 1.Extract longest transcript from gencode transcripts fasta file. 2.Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database. 3.Extract longest CDS regeion with longest…

Continue Reading Extract longest transcript or longest CDS transcript from GTF annotation file or gencode transcripts fasta file.

can not upload GTF file to UCSC genomebrowser

We are unable to reproduce the error you are seeing and we also recentlyexperienced temporary issues with our site. Please let us know if youare still having this problem. Post by Gang WeiDear manager of UCSC Genome Browser,Glad to write to you. I’m now using UCSC genome browser to check…

Continue Reading can not upload GTF file to UCSC genomebrowser

Bioconductor on Microsoft Azure – Microsoft Tech Community

Co-authored by: Nitesh Turaga – Scientist at Dana Farber/Harvard, Bioconductor Core Team Erdal Cosgun – Sr. Data Scientist at Microsoft Biomedical Platforms and Genomics team Vincent Carey – Professor at Harvard Medical School, Bioconductor Core Team   Introduction   The Bioconductor project promotes the statistical analysis and comprehension of current and emerging…

Continue Reading Bioconductor on Microsoft Azure – Microsoft Tech Community

How to convert transcript-relative coordinates to genomic coordinates?

How to convert transcript-relative coordinates to genomic coordinates? 0 I have queried using Entrez Utilities (efetch: www.ncbi.nlm.nih.gov/books/NBK25499/) and obtained annotations for transcripts like the following: >Feature ref|NM_152486.3| 1 2557 gene gene SAMD11 gene_syn MRS gene_desc sterile alpha motif domain containing 11 db_xref GeneID:148398 db_xref HGNC:HGNC:28706 db_xref MIM:616765 How/what database should…

Continue Reading How to convert transcript-relative coordinates to genomic coordinates?

Convert DNAStringSet to a list of elements in R? (Error in seq[[1]][[“seq”]] : subscript out of bounds in R)

I have a bed file which contains DNA sequences information as follow: ** track name=”194″ description=”194 methylation (sites)” color=0,60,120 useScore=1 chr1 15864 15866 FALSE 894 + chr1 534241 534243 FALSE 921 – chr1 710096 710098 FALSE 729 + chr1 714176 714178 FALSE 12 – chr1 720864 720866 FALSE 988 -…

Continue Reading Convert DNAStringSet to a list of elements in R? (Error in seq[[1]][[“seq”]] : subscript out of bounds in R)

Annotation of alternative cattle genome assembly

University of Maryland have assembled the cattle genome and in severalways we find this to be better than the Baylor assembly. Several groups including ours are using this version ofthe assembly. ftp.cbcb.umd.edu/pub/data/assembly/Bos_taurus/Bos_taurus_UMD_3.0/ NCBI has agreed to provide annotations for this version of the assemblyalso. I request you to host this…

Continue Reading Annotation of alternative cattle genome assembly

Bioconductor – RiboCrypt

DOI: 10.18129/B9.bioc.RiboCrypt     Interactive visualization in genomics Bioconductor version: Release (3.14) R Package for interactive visualization and browsing NGS data. It contains a browser for both transcript and genomic coordinate view. In addition a QC and general metaplots are included, among others differential translation plots and gene expression plots….

Continue Reading Bioconductor – RiboCrypt

Bioconductor – derfinder (development version)

DOI: 10.18129/B9.bioc.derfinder     This is the development version of derfinder; for the stable release version, see derfinder. Annotation-agnostic differential expression analysis of RNA-seq data at base-pair resolution via the DER Finder approach Bioconductor version: Development (3.15) This package provides functions for annotation-agnostic differential expression analysis of RNA-seq data. Two…

Continue Reading Bioconductor – derfinder (development version)

Bioconductor – ChIPQC

    This package is for version 3.1 of Bioconductor; for the stable, up-to-date release version, see ChIPQC. Quality metrics for ChIPseq data Bioconductor version: 3.1 Quality metrics for ChIPseq data Author: Tom Carroll, Wei Liu, Ines de Santiago, Rory Stark Maintainer: Tom Carroll <tc.infomatics at gmail.com>, Rory Stark <rory.stark…

Continue Reading Bioconductor – ChIPQC

hg38 Import custom reference upload error

Our version of TS is 5.12.2 When trying to upload new custom reference fasta (downloaded from ncbi ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.gz, gunzipped and renamed to hg38.fasta) through “Import custom reference” in interface an error occures: “uploaded file size is incorrect” (to be honest the error was not shown in logs, because of TypeError…

Continue Reading hg38 Import custom reference upload error

“Paired-end reads were detected in single-end read library”

“Paired-end reads were detected in single-end read library” 0 @9cb59de3 Last seen 12 hours ago United States Hello, I am using “featureCounts” in Rsubread package for analyzing bulk RNA-seq of drosophila. Since there is no inbuilt annotations of drosophila, I am trying to use a gtf file in the homepage…

Continue Reading “Paired-end reads were detected in single-end read library”

identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

GenomicFeatures::makeTxDbFromUCSC failing with an error: identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE 1 @mikhail-dozmorov-23744 Last seen 1 day ago United States Hi,The GenomicFeatures::makeTxDbFromUCSC function fails with: library(GenomicFeatures) > hg19.refseq.db <- makeTxDbFromUCSC(genome=”hg19″, table=”refGene”) Download the refGene table … Error in .fetch_UCSC_txtable(genome(session), tablename, transcript_ids = transcript_ids) : identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE OK The…

Continue Reading identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

Clinical Bioinformatics Analyst (m/w/d) – Foundation Medicine GmbH – Biology & Life Sciences

Clinical Bioinformatics Analyst (m/w/d) PENZBERG, GERMANY Foundation Medicine is leading a transformation in cancer care, where each patient’s treatment is informed by a deep understanding of the molecular changes that contribute to their disease. As a molecular information company, we are focused on fundamentally changing the way in which patients…

Continue Reading Clinical Bioinformatics Analyst (m/w/d) – Foundation Medicine GmbH – Biology & Life Sciences

Bioconductor – monaLisa

DOI: 10.18129/B9.bioc.monaLisa     Binned Motif Enrichment Analysis and Visualization Bioconductor version: Release (3.14) Useful functions to work with sequence motifs in the analysis of genomics data. These include methods to annotate genomic regions or sequences with predicted motif hits and to identify motifs that drive observed changes in accessibility…

Continue Reading Bioconductor – monaLisa

From where to get a comprehensive list of genes with gene start, gene end and chromosome for build 37?

From where to get a comprehensive list of genes with gene start, gene end and chromosome for build 37? 0 Hi all, I am trying to annotate list of genes with gene start, gene end (build37) and chromosome. I mapped most of the genes from a list downloaded from Biomart/UCSC,…

Continue Reading From where to get a comprehensive list of genes with gene start, gene end and chromosome for build 37?

Bioconductor – ProteoDisco

DOI: 10.18129/B9.bioc.ProteoDisco     Generation of customized protein variant databases from genomic variants, splice-junctions and manual sequences Bioconductor version: Release (3.14) ProteoDisco is an R package to facilitate proteogenomics studies. It houses functions to create customized (mutant) protein databases based on user-submitted genomic variants, splice-junctions, fusion genes and manual transcript…

Continue Reading Bioconductor – ProteoDisco

10q26 FGFR2 Break Apart FISH Probe Kit

1 0q26 FGFR2 Break Apart FISH Probe Kit For Research Use Only Not for Use in Diagnostic Procedures 0q26 FGFR2 Break Apart FISH Probe Kit 09N /R2 Key to Symbols Used 09N /R2 Reference Number Lot Number Global Trade Item Number Centromere D0S294 0q26. Region FGFR2 5 ATE SHGC-529 Telomere…

Continue Reading 10q26 FGFR2 Break Apart FISH Probe Kit

Bioconductor – BSgenome.Mmulatta.UCSC.rheMac10

DOI: 10.18129/B9.bioc.BSgenome.Mmulatta.UCSC.rheMac10     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Mmulatta.UCSC.rheMac10. Full genome sequences for Macaca mulatta (UCSC version rheMac10) Bioconductor version: 3.11 Full genome sequences for Macaca mulatta (Rhesus) as provided by UCSC (rheMac10, Feb. 2019) and stored in Biostrings…

Continue Reading Bioconductor – BSgenome.Mmulatta.UCSC.rheMac10

How to convert bedgraph file with bins into GRanges object?

You could convert your bedGraph bins from hg18 to hg19 using liftover, so you can overlap them with your peaks. You would read them into a GRanges object, then hand this to the liftover function to translate from hg18 to hg19, then unlist the results to get back a regular…

Continue Reading How to convert bedgraph file with bins into GRanges object?

40231867-SWI-Prolog-as-a-Semantic-Web-Tool-for-semantic-querying-in-Bioclipse-Integration-and-perfor – SWI-Prolog as a Semantic Web Tool for semantic

Unformatted text preview: SWI-Prolog as a Semantic Web Tool for semantic querying in Bioclipse: Integration and performance benchmarking Samuel Lampa June 2, 2010 Abstract The huge amounts of data produced in new high-throughput techniques in the life sciences, and the need for integration of heterogeneous data from disparate sources in…

Continue Reading 40231867-SWI-Prolog-as-a-Semantic-Web-Tool-for-semantic-querying-in-Bioclipse-Integration-and-perfor – SWI-Prolog as a Semantic Web Tool for semantic

Sr Scientist – IVD Development – Houston

NuProbe USA Inc . is looking for a Staff/Senior Scientist to lead the IVD project development program at NuProbe to support both research and in vitro diagnostic (IVD) assays for use in medical research, clinical trials, regulatory submissions, and clinical diagnostic use.  NuProbe USA is a rapidly growing company and…

Continue Reading Sr Scientist – IVD Development – Houston

transcripts are not true in TxDb.Hsapiens.UCSC.hg38.knownGene

transcripts are not true in TxDb.Hsapiens.UCSC.hg38.knownGene 1 @11b02720 Last seen 2 hours ago United States Hello, I used TxDb.Hsapiens.UCSC.hg38.knownGene/GenomicFeatures to retrieve gene promoters and other genomic features. here is code: library(‘TxDb.Hsapiens.UCSC.hg38.knownGene’) txdb <- TxDb.Hsapiens.UCSC.hg38.knownGene PR <- promoters(txdb, upstream=2000, downstream=0) but when I take a look at the PR results: it…

Continue Reading transcripts are not true in TxDb.Hsapiens.UCSC.hg38.knownGene

Summer Intern -Bioinformatics – Roche – Pleasanton

·  Job facts Summer Intern – (Bioinformatics) The Summer @ Roche Intern Program has been developed to provide students with a fun yet rewarding summer through hands-on experience and numerous opportunities to network with other interns as well as employees in the organization. Additionally, we help our students meet their…

Continue Reading Summer Intern -Bioinformatics – Roche – Pleasanton

Generating Multiple Species Alignment Of Novel Transcripts For Phylocsf

Short version: How would you go about generating multiple species alignments of novel transcripts from bos taurus (assembly UMD3.1) with human/mouse/dog for use with PhyloCSF? Context and what I’ve tried so far: Through a sequencing experiment, our lab has identified a large set of new transcripts in Bos taurus. We…

Continue Reading Generating Multiple Species Alignment Of Novel Transcripts For Phylocsf

Is there a database of bioinformatics tools & databases?

All – Some years ago I was speaking to Sean Davis Re: the plethora of bioinformatics tools and databases. I commented to him that merely keeping up with what is available is difficult in the context of a full-time job, let alone mastering what you feel to be the best-in-class…

Continue Reading Is there a database of bioinformatics tools & databases?

Senior Bioinformatics Scientist II/ Staff Bioinformatics Scientist

Inscripta was founded in 2015 and recently launched the world’s first benchtop Digital Genome Engineering platform. The company is growing aggressively, investing in its leadership, team, and technology with a recent $150mm financing round led by Fidelity and TRowe price. The company’s advanced CRISPR-based platform, consisting of an instrument, reagents,…

Continue Reading Senior Bioinformatics Scientist II/ Staff Bioinformatics Scientist

Bioconductor – Rariant

    This package is for version 3.0 of Bioconductor; for the stable, up-to-date release version, see Rariant. Identification and Assessment of Single Nucleotide Variants through Shifts in Non-Consensus Base Call Frequencies Bioconductor version: 3.0 The ‘Rariant’ package identifies single nucleotide variants from sequencing data based on the difference of…

Continue Reading Bioconductor – Rariant

Bioconductor – BSgenome.Hsapiens.UCSC.hg19

    This package is for version 3.2 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Hsapiens.UCSC.hg19. Full genome sequences for Homo sapiens (UCSC version hg19) Bioconductor version: 3.2 Full genome sequences for Homo sapiens (Human) as provided by UCSC (hg19, Feb. 2009) and stored in Biostrings objects. Author:…

Continue Reading Bioconductor – BSgenome.Hsapiens.UCSC.hg19

Bioconductor – csaw

    This package is for version 3.2 of Bioconductor; for the stable, up-to-date release version, see csaw. ChIP-seq analysis with windows Bioconductor version: 3.2 Detection of differentially bound regions in ChIP-seq data with sliding windows, with methods for normalization and proper FDR control. Author: Aaron Lun <alun at wehi.edu.au>,…

Continue Reading Bioconductor – csaw

Interpretting phastConsElements from USCS Table Browser

Interpretting phastConsElements from USCS Table Browser 0 I am trying to understand the information present in PhastCons elements bed files from USCS Table Browser. Following the information I found here I managed to get a description of the column names, but not a description of what they are measuring. I…

Continue Reading Interpretting phastConsElements from USCS Table Browser

TCGA dataset normalization

TCGA dataset normalization 0 hi. i am new to machine learning. i want to normalize my data which I downloaded from UCSC Xena browser for pancreatic cancer TCGA PAAD is its id. when I try to run this code it is showing error given below library( “DESeq2” ) library(ggplot2) countData…

Continue Reading TCGA dataset normalization

What is the codification in genestrand 1 and 2?

What is the codification in genestrand 1 and 2? 0 Hi there, I’m doing some peak annotation using ChIPseeker library(ChIPseeker) library(TxDb.Hsapiens.UCSC.hg38.knownGene) library(clusterProfiler) library(annotables) library(org.Hs.eg.db) txdb <- TxDb.Hsapiens.UCSC.hg38.knownGene peaks= readPeakFile(“peaks_”, header = F) peakAnno <- annotatePeak(peaks, tssRegion=c(-3000, 3000), TxDb=txdb, annoDb=”org.Hs.eg.db”) peaks_annot <- as.data.frame(peakAnno) In my annotation file “geneStrand” is codified as…

Continue Reading What is the codification in genestrand 1 and 2?

Bioconductor – VanillaICE

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see VanillaICE. A Hidden Markov Model for high throughput genotyping arrays Bioconductor version: 3.4 Hidden Markov Models for characterizing chromosomal alterations in high throughput SNP arrays. Author: Robert Scharpf <rscharpf at jhu.edu>, Kevin Scharpf,…

Continue Reading Bioconductor – VanillaICE

Convert UCSC isoform ID to Ensembl transcript ID

Convert UCSC isoform ID to Ensembl transcript ID 2 Hello everyone, I have a few UCSC isoform IDs and I would like to convert them to the corresponding Ensembl transcript IDs. I have tried to use some online conversion tools (such as DAVID), looked up the UCSC annotation files, but…

Continue Reading Convert UCSC isoform ID to Ensembl transcript ID

Associate Director, Computational Biology/Bioinformatics Job Opening in Cambridge, MA at Obsidian Therapeutics

About Us… Obsidian Therapeutics is pioneering engineered cell and gene therapies to deliver transformative outcomes for patients. Obsidian’s programs apply our CytoDriveTM technology in Cell and Gene therapy products to control expression of proteins for enhanced therapeutic efficacy and safety. We’re proud of our diverse talented team and committed to…

Continue Reading Associate Director, Computational Biology/Bioinformatics Job Opening in Cambridge, MA at Obsidian Therapeutics

Database for Enhancers with Coordinates

Database for Enhancers with Coordinates 4 Can anyone recommend some good databases for extracting bed files with enhancer coordinates. I have used UCSC in the past, I was hoping to find some alternatives ChIP-Seq genome • 163 views • link updated 11 minutes ago by Papyrus &starf; 1.3k • written…

Continue Reading Database for Enhancers with Coordinates

Bioconductor – FunciSNP

DOI: 10.18129/B9.bioc.FunciSNP     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see FunciSNP. Integrating Functional Non-coding Datasets with Genetic Association Studies to Identify Candidate Regulatory SNPs Bioconductor version: 3.11 FunciSNP integrates information from GWAS, 1000genomes and chromatin feature to identify functional SNP in…

Continue Reading Bioconductor – FunciSNP

Visulization of raw 4C-seq reads in UCSC

Visulization of raw 4C-seq reads in UCSC 1 I’m trying to create bedGraph files to view raw and normalised reads from a 4C-seq experiment to view in UCSC for two biological replicates. Is there a simple way to do this? I’ve tried using bamCoverage and expected to get peaks for…

Continue Reading Visulization of raw 4C-seq reads in UCSC

How to download BED file with all the fields?

How to download BED file with all the fields? 2 Hello, my goal : to download a certain BED file from ucsc website that contains all these fields: bin chrom chromStart chromEnd name score strand signalValue pValue qValue peak I will describe my actions and my problem: – I go…

Continue Reading How to download BED file with all the fields?

how to to download a BED file from ucsc to directory using linux

how to to download a BED file from ucsc to directory using linux 2 Hello, my goal : to download a BED file as desribed here to my directory using linux commands . in the meantine, I am trying to download the wanted file directly in the following way: my…

Continue Reading how to to download a BED file from ucsc to directory using linux

Bioconductor – ChIPComp

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see ChIPComp. Quantitative comparison of multiple ChIP-seq datasets Bioconductor version: 3.4 ChIPComp detects differentially bound sharp binding sites across multiple conditions considering matching control. Author: Hao Wu, Li Chen, Zhaohui S.Qin, Chi Wang Maintainer:…

Continue Reading Bioconductor – ChIPComp

Bioconductor – chipseq

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see chipseq. chipseq: A package for analyzing chipseq data Bioconductor version: 3.4 Tools for helping process short read data for chipseq experiments Author: Deepayan Sarkar, Robert Gentleman, Michael Lawrence, Zizhen Yao Maintainer: Bioconductor Package…

Continue Reading Bioconductor – chipseq

Exon coordinates and sequence

I did it like that: 1- Download refGene.txt.gz and hg19.fasta from the UCSC goldenpath. ( note: convert hg19.2bit to hg19.fa using twoBitToFa ) 2- Create a bed file with exon coordiniate using my awk script // to_transcript.awk BEGIN { OFS =”t” } { name=$2 name2=$13 sens = $4 ==”+” ?…

Continue Reading Exon coordinates and sequence

Liftover nonmodel VCF

Liftover nonmodel VCF 1 Hi all, I have a FASTA genome assembly and a VCF for my (nonmodel) study species. Now I want to liftover the VCF to the Zebra Finch genome (www.ncbi.nlm.nih.gov/assembly/GCF_003957565.1). I’ve found Picard LiftOver GATK and CrossMap, but both require a UCSC chain file, which apparently can…

Continue Reading Liftover nonmodel VCF

Annovar: Mouse database download

Annovar: Mouse database download 1 Hi there, I want to work with specific mouse strain from ucsc browser (A/J) on my annovar. How do I download it? perl annotate_variation.pl -buildver mm10 -downdb -webfrom annovar refGene mousedb –> is for mm10 db I have tried –> perl annotate_variation.pl -buildver 16 Strains…

Continue Reading Annovar: Mouse database download

How to get enome feature annotation through NCBI api ?

How to get enome feature annotation through NCBI api ? 1 Hi, I wanna get the whole genome annotion result with some information ,like transcript,exon,gene etc , As we know ,NCBI has provided the GFF file containing the above information , but I wanna get the latest content from NCBI…

Continue Reading How to get enome feature annotation through NCBI api ?

UCSC MySQL access

UCSC MySQL access 1 Anyone know if the public can still access UCSC db remotely? Can’t seem to get access :/ genome.ucsc.edu/goldenPath/help/mysql.html XXX@XXX-MacBook-Pro:~$ mysql –user=genome –host=genome-mysql.soe.ucsc.edu -A -P 3306 ERROR 2002 (HY000): Can’t connect to MySQL server on ‘genome-mysql.soe.ucsc.edu‘ (36) XXX@XXX-MacBook-Pro:~$ mariadb –version mariadb Ver 15.1 Distrib 10.5.8-MariaDB, for osx10.15…

Continue Reading UCSC MySQL access

SNP exon region UCSC

SNP exon region UCSC 2 how i can get SNP in only exons regions genome with UCSC? UCSC get the all SNP of gene region, and there is no filter option to get only exon region. tx ucsc SNP exon • 245 views • link updated 2 hours ago by…

Continue Reading SNP exon region UCSC

UCSC Gene Table Exon Frames Generating Stop Codons

Hi, I’m using UCSC gene tables, and I am running into trouble with interpreting exon frames. In some cases, using the exon frame from the tables creates stop codons, which shouldn’t be happening in coding regions. As an example, from the hg19 gene NM_001369291 on chromosome 22, I have this…

Continue Reading UCSC Gene Table Exon Frames Generating Stop Codons

Converting between UCSC id and gene symbol with bioconductor annotation resources

You need to use the Homo.sapiens package to make that mapping. > library(Homo.sapiens) Loading required package: AnnotationDbi Loading required package: stats4 Loading required package: BiocGenerics Loading required package: parallel Attaching package: ‘BiocGenerics’ The following objects are masked from ‘package:parallel’: clusterApply, clusterApplyLB, clusterCall, clusterEvalQ, clusterExport, clusterMap, parApply, parCapply, parLapply, parLapplyLB, parRapply,…

Continue Reading Converting between UCSC id and gene symbol with bioconductor annotation resources

Bioconductor – ramr

DOI: 10.18129/B9.bioc.ramr     Detection of Rare Aberrantly Methylated Regions in Array and NGS Data Bioconductor version: Release (3.13) ramr is an R package for detection of low-frequency aberrant methylation events in large data sets obtained by methylation profiling using array or high-throughput bisulfite sequencing. In addition, package provides functions…

Continue Reading Bioconductor – ramr

How to rename the elements in columns(txdb)?

How to rename the elements in columns(txdb)? 0 Hello Biostars Community, I made a txdb object using: mm39.txdb <- makeTxDbFromEnsembl(organism = “Mus musculus”) and then made the CompressedGRangesList : txns <- GRangesList(cds(mm39.txdb, columns = c(“CDSSTART”,”CDSEND”))) I am trying to figure out how to rename CDSSTART to cdsStart and CDSEND to…

Continue Reading How to rename the elements in columns(txdb)?

Convert between UCSC gene id(?) and gene symbol with bioconductor

Convert between UCSC gene id(?) and gene symbol with bioconductor 0 I would like to convert between what I think are UCSC gene ids and gene symbols (see example below). I would prefer to do this with a bioconductor annotation package (org.Hs.eg.db) rather than biomart. Is “UCSC gene id” the…

Continue Reading Convert between UCSC gene id(?) and gene symbol with bioconductor

Bioconductor – TxDb.Dmelanogaster.UCSC.dm3.ensGene

    This package is for version 2.9 of Bioconductor; for the stable, up-to-date release version, see TxDb.Dmelanogaster.UCSC.dm3.ensGene. Annotation package for the Dmelanogaster_UCSC_dm3_ensGene_TxDb object Bioconductor version: 2.9 Contains the Dmelanogaster_UCSC_dm3_ensGene_TxDb object annotation database as generated from UCSC Author: Marc Carlson Maintainer: Biocore Data Team <bioconductor at r-project.org> Citation (from within…

Continue Reading Bioconductor – TxDb.Dmelanogaster.UCSC.dm3.ensGene