Tag: usr

Error when Installing BioConductor Package (‘affy’)

Hi, when I try to install Bioconductor package ‘affy’ Experience below error\ May I know how do I fix this? I’m currently using R4.2.2 on MacBook Air, M1\ R version 4.2.2 (2022-10-31) — “Innocent and Trusting”\ Copyright (C) 2022 The R Foundation for Statistical Computing\ Platform: aarch64-apple-darwin20 (64-bit) BiocManager::install(“affy”) ‘getOption(“repos”)’…

Continue Reading Error when Installing BioConductor Package (‘affy’)

query regarding error in installation of “goseq” R bioconductor package

query regarding error in installation of “goseq” R bioconductor package 0 @6d5973d2 Last seen 19 hours ago India I am trying to install “goseq” Bioconductor package in Rstudio (version- RStudio 2022.07.2 Build 576 ) on my system I have installed R version- 4.2.2 I getting many error messages which are…

Continue Reading query regarding error in installation of “goseq” R bioconductor package

r – Cannot Install maftools into BiocManager due to RSQLite

I am a relatively new R-user. I am currently working on trying to read .maf files via the maftools package released by Bioconductor. I am following the instructions as posted on the Bioconductor website (www.bioconductor.org/packages/devel/bioc/vignettes/maftools/inst/doc/maftools.html#4_Installation), however, everytime I attempt to run the installation, it gets stuck on RSQLite and I…

Continue Reading r – Cannot Install maftools into BiocManager due to RSQLite

[slurm-users] How to launch slurm services after installation

Hello, all supported build flags are available with “./configure –help” command. On of them is “–with-systemdsystemunitdir=DIR”, which will allow you to specify the directory for the systemd service files for all Slurm daemons. The most important of the flags is imho the “–prefix”, which sets the installation directory. I’ll describe my build setup shortly…

Continue Reading [slurm-users] How to launch slurm services after installation

Bug#1024835: python-pauvre: ftbfs with biopython 1.80

Source: python-pauvre Version: 0.2.3-1 Severity: important Tags: ftbfs Dear Maintainer, python-pauvre fails its build time test suite when built against biopython 1.80 in experimental but builds successfully against biopython 1.79. The relevant part of the log in case of failure shows: I: pybuild base:240: cd /<<PKGBUILDDIR>>/.pybuild/cpython3_3.10_pauvre/build; python3.10 -m unittest discover -v test_normal_plotting_scenario (pauvre.tests.test_synplot.libSeq_test_case) This…

Continue Reading Bug#1024835: python-pauvre: ftbfs with biopython 1.80

aports – Alpine packages build scripts

not compatible with python3.11 as it still uses long deprecated getargspec API 5 tests fail: > […] > File “/home/buildozer/aports/testing/livestreamer/src/livestreamer-1.12.2/src/livestreamer/stream/__init__.py”, line 4, in <module> > from .akamaihd import AkamaiHDStream > File “/home/buildozer/aports/testing/livestreamer/src/livestreamer-1.12.2/src/livestreamer/stream/akamaihd.py”, line 15, in <module> > from ..packages.flashmedia import FLV, FLVError > File “/home/buildozer/aports/testing/livestreamer/src/livestreamer-1.12.2/src/livestreamer/packages/flashmedia/__init__.py”, line 4, in <module> >…

Continue Reading aports – Alpine packages build scripts

No module named ‘upstream_ontologist.tests’ (and more)

Source: lintian-brush Version: 0.134 Severity: serious User: debian…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of lintian-brush the autopkgtest of lintian-brush fails in testing when that autopkgtest is run with the binary packages of lintian-brush from unstable. It passes when run with only packages from testing. In tabular form:…

Continue Reading No module named ‘upstream_ontologist.tests’ (and more)

Issue with replica generation with syle ‘final’ in NEB – LAMMPS General Discussion

Hello everyone I am running NEB calculation for diffusion of Si atom in 64 atoms supercell. I am facing error with number of replicas “ERROR: Cannot use NEB with a single replica”. I am using neb command with style “final” as ‘neb 0.0 0.1 1000 1000 100 final sic.final’.It’s mentioned…

Continue Reading Issue with replica generation with syle ‘final’ in NEB – LAMMPS General Discussion

Jupyter Sagemath Kernel With Code Examples

Jupyter Sagemath Kernel With Code Examples In this session, we are going to try to solve the Jupyter Sagemath Kernel puzzle by using the computer language. The code that follows serves as an illustration of this point. mkdir -p /usr/local/share/jupyter/kernels ln -nsf /opt/SageMath/local/share/jupyter/kernels/sagemath /usr/local/share/jupyter/kernels/sagemath The Jupyter Sagemath Kernel was solved…

Continue Reading Jupyter Sagemath Kernel With Code Examples

r – monocle3 installation issues

I have R 4.2.1 and the latest R studio build 554 on a macOS Monterey. I am trying to install monocle3 using the following : BiocManager::install(‘monocle3’) I get a really long error message BiocManager::install(“monocle3”) ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.15…

Continue Reading r – monocle3 installation issues

How to read the AUGUSTUS results

Hi, everyone. I used AUGUSTUS to make a genetic prediction for a certain fish, but I don’t know how to read the results. I mainly do not understand the following three points. 1.What does “sequence number” mean? How is it different from scaffold number? 2.What does “none” mean? Does it…

Continue Reading How to read the AUGUSTUS results

‘info jupyterhub’ displays the manpage although it suggests ‘info’ to get the full doc

Package: jupyterhub Version: 2.0.0+ds1-2 Severity: normal X-Debbugs-Cc: gkni…@australdx.fr Dear Maintainer, ‘man jupyterhub’ ends with: > The full documentation for jupyterhub is maintained as a Texinfo manual. If the info and jupyterhub programs are properly installed at your site, the command > info jupyterhub > should give you access to the complete manual. although…

Continue Reading ‘info jupyterhub’ displays the manpage although it suggests ‘info’ to get the full doc

The JupyterHub pod is failing – JupyterHub

Hello, I have an instance of JupyterHub deployed using ODH (Open Data Hub). The pods were running fine from past couple of months but suddenly since last two days the pods have started getting Restarted automatically. The errors which I am able to see from the previous logs of the…

Continue Reading The JupyterHub pod is failing – JupyterHub

GPU inference doesn’t work when importing open3d

Thanks for your error report and we appreciate it a lot. Checklist I have searched related issues but cannot get the expected help. I have read the FAQ documentation but cannot get the expected help. The bug has not been fixed in the latest version. Describe the bug The GPU…

Continue Reading GPU inference doesn’t work when importing open3d

Whole Genome Association Study of the Plasma Metabolome Identifies Metabolites Linked to Cardiometabolic Disease in Black Individuals

Division of Cardiovascular Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA, US Usman A. Tahir, Daniel H. Katz, Jeremy M. Robbins, Zsu-Zsu Chen, Mark D. Benson, Daniel E. Cruz, Debby Ngo, Shuliang Deng, Xu Shi, Shuning Zheng, Aaron S. Eisman, Laurie Farrell, James G. Wilson & Robert E. Gerszten Broad Institute of Harvard and MIT, Cambridge, MA, US Julian Avila-Pachecho, Alexander G….

Continue Reading Whole Genome Association Study of the Plasma Metabolome Identifies Metabolites Linked to Cardiometabolic Disease in Black Individuals

Cannot setup Jupyterhub+Jupyterlab to run as a service on Ubuntu machine

I am supposed to set up Jupyterhub Server for my team at work The idea is that everybody gets a JupyterLab interface in the browser when they access http://ourserverip:<port>. I’ve been following this link for the instructions. I literally followed every step at the exact same order and fail at…

Continue Reading Cannot setup Jupyterhub+Jupyterlab to run as a service on Ubuntu machine

r – View() function in RStudio Server opens new tab but does not display data

I am running an Ubuntu 18.04.6 LTS server on Google Cloud Compute Engine. I have downloaded RStudio Server onto my machine and kept getting this message: Warning message: R graphics engine version 15 is not supported by this version of RStudio. The Plots tab will be disabled until a newer…

Continue Reading r – View() function in RStudio Server opens new tab but does not display data

Bug#1017483: loguru: autopkgtest regression: RecursionError: maximum recursion depth exceeded

Source: loguru Version: 0.6.0-1 Severity: serious User: debi…@lists.debian.org Usertags: regression Dear maintainer(s), I looked at the results of the autopkgtest of you package because it was showing up as a regression for the upload of python3-defaults on all architectures. However, it turns out that your test very recently regressed in…

Continue Reading Bug#1017483: loguru: autopkgtest regression: RecursionError: maximum recursion depth exceeded

Bug#1016498: rope: autopkgtest regression: No module named ‘pkg_resources’

Source: rope Version: 1.2.0-1 Severity: serious User: debian…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of rope the autopkgtest of rope fails in testing when that autopkgtest is run with the binary packages of rope from unstable. It passes when run with only packages from testing. In tabular form:…

Continue Reading Bug#1016498: rope: autopkgtest regression: No module named ‘pkg_resources’

[gmx-users] dssp

Hi,I have a problem with dssp programme.I have the programme in /home/m/DSSP. When I writeexport DSSP=/usr/local/binand then I check /usr/local/bin I couldn’t see dssp.How can I handle this problem. I have caheceked gromacs website export DSSP=/path/to/dssp setenv DSSP /path/to/dssp commands are written.Could you write export DSSP=/path/to/dssp command according to me….

Continue Reading [gmx-users] dssp

[Buildroot] [git commit branch/2022.02.x] package/libmodsecurity: needs dynamic library with libcurl and mbedtls

[Buildroot] [git commit branch/2022.02.x] package/libmodsecurity: needs dynamic library with libcurl and mbedtls – Peter Korsgaard From: Peter Korsgaard <peter@korsgaard.com> To: buildroot@buildroot.org Subject: [Buildroot] [git commit branch/2022.02.x] package/libmodsecurity: needs dynamic library with libcurl and mbedtls Date: Tue, 19 Jul 2022 18:35:54 +0200 [thread overview] Message-ID: <20220719162323.01D1283DF5@busybox.osuosl.org> (raw) commit: git.buildroot.net/buildroot/commit/?id=2d021a7e7163d13b604d508602288e7190ab63dc branch: git.buildroot.net/buildroot/commit/?id=refs/heads/2022.02.x

Continue Reading [Buildroot] [git commit branch/2022.02.x] package/libmodsecurity: needs dynamic library with libcurl and mbedtls

Precompile errors with `pkg> update` or `pkg> add` for some packages – General Usage

In the package manager I was getting some precompilation errors when trying to update Julia. So I have removed all the offending packages, which included Pluto and tried to add Pluto again with the following result: (@v1.7) pkg> precompile (@v1.7) pkg> add Pluto Resolving package versions… Updating `~/.julia/environments/v1.7/Project.toml` [c3e4b0f8] +…

Continue Reading Precompile errors with `pkg> update` or `pkg> add` for some packages – General Usage

Bug#1014506: slurm-wlm: flaky autopkgtest: sbatch fails without

Source: slurm-wlm Version: 21.08.8.2-1 Severity: serious X-Debbugs-CC: debian…@lists.debian.org User: debian…@lists.debian.org Usertags: flaky Dear maintainer(s), I looked at the results of the autopkgtest of you package on armhf because it was showing up as a regression for the upload of perl. I noticed that the test regularly fails and I saw…

Continue Reading Bug#1014506: slurm-wlm: flaky autopkgtest: sbatch fails without

[slurm-users] “Plugin is corrupted” message when using drmaa / debugging libslurm

On 28/06/2022 23:14, Chris Samuel wrote: > On 28/6/22 12:19 pm, Jean-Christophe HAESSIG wrote: Hi, Yes I also found it and that’s where I saw the detailed debug3 & debug4 calls. > it’s when it’s checking it can load the plugin and not hit any > unresolved library symbols. The…

Continue Reading [slurm-users] “Plugin is corrupted” message when using drmaa / debugging libslurm

Left and right DataArray objects are not close

Source: python-xarray Version: 2022.06.0~rc1-1 Severity: serious User: debi…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of python-xarray the autopkgtest of python-xarray fails in testing when that autopkgtest is run with the binary packages of python-xarray from unstable. It passes when run with only packages from testing. In tabular form: …

Continue Reading Left and right DataArray objects are not close

ERROR No such moleculetype NA – User discussions

GROMACS version:GROMACS modification: Yes/No I got this errorwhen I run the line: gmx grompp -f em.mdp -c solv_ions.gro -p topol.top -o em.tpr -maxwarn 10in the topol.top there is 3 NA atoms 🙂 GROMACS – gmx grompp, 2020.1-Ubuntu-2020.1-1 (-: GROMACS is written by: Emile Apol Rossen Apostolov Paul Bauer Herman J.C….

Continue Reading ERROR No such moleculetype NA – User discussions

Convert ONNX RuntimeError: tin_shift_forward_impl: implementation for device cpu not found.

when convert tin to onnx meet this issue: RuntimeError: tin_shift_forward_impl: implementation for device cpu not found. env:sys.platform: linuxPython: 3.8.10 (default, Jun 2 2021, 10:49:15) [GCC 9.4.0]CUDA available: TrueGPU 0,1: Tesla T4CUDA_HOME: /usr/local/cudaNVCC: Cuda compilation tools, release 11.4, V11.4.120GCC: x86_64-linux-gnu-gcc (Ubuntu 9.3.0-17ubuntu1~20.04) 9.3.0PyTorch: 1.9.1+cu111PyTorch compiling details: PyTorch built with: GCC 7.3…

Continue Reading Convert ONNX RuntimeError: tin_shift_forward_impl: implementation for device cpu not found.

python 3.x – PySpark on Jupyterhub K8s || Unable to query data || Class org.apache.hadoop.fs.s3a.S3AFileSystem not found

Pyspark Version: 2.4.5 Hive Version: 1.2 Hadoop Version: 2.7 AWS-SDK Jar: 1.7.4 Hadoop-AWS: 2.7.3 When I am trying to show data I am getting Class org.apache.hadoop.fs.s3a.S3AFileSystem not found while I am passing all the information which all are required. I passed all three for this config fs.s3.aws.credentials.provider org.apache.hadoop.fs.s3a.BasicAWSCredentialsProvider com.amazonaws.auth.InstanceProfileCredentialsProvider com.amazonaws.auth.EnvironmentVariableCredentialsProvider…

Continue Reading python 3.x – PySpark on Jupyterhub K8s || Unable to query data || Class org.apache.hadoop.fs.s3a.S3AFileSystem not found

main-i386-default][science/cp2k] Failed for cp2k-9.1.0 in configure

You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: beefy17.nyi.freebsd.org/data/main-i386-default/p429f3de9bdcd_s2573e6ced9/logs/cp2k-9.1.0.log Build URL: beefy17.nyi.freebsd.org/build.html?mastername=main-i386-default&build=p429f3de9bdcd_s2573e6ced9 Log: =>> Building science/cp2k build started at Sat Jun 4…

Continue Reading main-i386-default][science/cp2k] Failed for cp2k-9.1.0 in configure

#1012224 – python-tornado: autopkgtest regression in testing

#1012224 – python-tornado: autopkgtest regression in testing – Debian Bug report logs Reply or subscribe to this bug. Toggle useless messages Report forwarded to debian-bugs-dist@lists.debian.org, Debian Python Team <team+python@tracker.debian.org>:Bug#1012224; Package src:python-tornado. (Wed, 01 Jun 2022 18:00:03 GMT) (full text, mbox, link). Acknowledgement sent to Graham Inggs <ginggs@debian.org>:New Bug report received…

Continue Reading #1012224 – python-tornado: autopkgtest regression in testing

Go Echo API Server for openapi

A hello world service. Overview This server was generated by the openapi-generator project. By using the OpenAPI-Spec from a remote server, you can easily generate a server stub. To see how to make this your own, look here: README API version: 1.0 Build date: 2022-05-28T21:42:12.319613+10:00[Australia/Sydney] export GO_POST_PROCESS_FILE=”/usr/local/bin/gofmt -w” openapi-generator generate…

Continue Reading Go Echo API Server for openapi

[Kernel-packages] [Bug 1969434] Autopkgtest regression report (linux-meta-oem-5.17/5.17.0.1005.5)

All autopkgtests for the newly accepted linux-meta-oem-5.17 (5.17.0.1005.5) for jammy have finished running. The following regressions have been reported in tests triggered by the package: dahdi-linux/1:2.11.1~dfsg-1ubuntu11 (amd64) r8168/8.049.02-1ubuntu1 (amd64) Please visit the excuses page listed below and investigate the failures, proceeding afterwards as per the StableReleaseUpdates policy regarding autopkgtest regressions…

Continue Reading [Kernel-packages] [Bug 1969434] Autopkgtest regression report (linux-meta-oem-5.17/5.17.0.1005.5)

[slurm-users] gres/gpu count lower than reported

Hello Fellow Slurm Admins,   I have a new Slurm installation that was working and running basic test jobs until I added gpu support. My worker nodes are now all in drain state, with gres/gpu count reported lower than configured (0 < 4)   This is in spite of the…

Continue Reading [slurm-users] gres/gpu count lower than reported

python – Install autodock vina via pip in Windows

I trying to install vina using pip and get this error: C:\Users\chase>pip install vina Collecting vina Using cached vina-1.2.3.tar.gz (95 kB) Installing build dependencies … done Getting requirements to build wheel … error ERROR: Command errored out with exit status 1: command: ‘D:\Anaconda\python.exe’ ‘D:\Anaconda\lib\site- packages\pip\_vendor\pep517\in_process\_in_process.py’ get_requires_for_build_wheel ‘C:\Users\chase\AppData\Local\Temp\tmpo4147jnr’ cwd: C:\Users\chase\AppData\Local\Temp\pip-install- x0_x1cyl\vina_418ca6103711445caf359fdf3574d54b…

Continue Reading python – Install autodock vina via pip in Windows

docker compose – How to enable authentication via openLDAP on JupyterHub without SSL certificate?

I am trying to create a JupyterHub that uses an LDAP to authenticate users. The JupyterHub is working but when I am trying log on the web page show a Error 500. I must clarify that when I tried it with the PAM method it worked without problems, but when…

Continue Reading docker compose – How to enable authentication via openLDAP on JupyterHub without SSL certificate?

No rule to make target ‘/usr/lib/x86_64-linux-gnu/libpython3.10.so’

Source: opm-grid Version: 2021.10-3 Severity: serious User: debian…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of opm-grid the autopkgtest of opm-grid fails in testing when that autopkgtest is run with the binary packages of opm-grid from unstable. It passes when run with only packages from testing. In tabular form:…

Continue Reading No rule to make target ‘/usr/lib/x86_64-linux-gnu/libpython3.10.so’

[slurm-users] Issues with pam_slurm_adopt

Hi, I have an issue with pam_slurm_adopt when I moved from 21.08.5 to 21.08.6. It no longer works. When I log straight to the node with root account : Apr 8 19:06:49 magi46 pam_slurm_adopt[20400]: Ignoring root user Apr 8 19:06:49 magi46 sshd[20400]: Accepted publickey for root from 172.16.0.3 port 50884 ssh2:…

Continue Reading [slurm-users] Issues with pam_slurm_adopt

cgview: Can’t locate Bio/SeqIO.pm in @INC

Tried two new images quay.io/biocontainers/cgview:1.0–5 quay.io/biocontainers/cgview:1.0–4 Same issue: Digest: sha256:c824eff236de755b06805a02df35f58c67d3aa4c73c09fb7dce3742336ab57f3 Status: Downloaded newer image for quay.io/biocontainers/cgview:1.0–4 Can’t locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /usr/local/lib/site_perl/5.26.2/x86_64-linux-thread-multi /usr/local/lib/site_perl/5.26.2 /usr/local/lib/5.26.2/x86_64-linux-thread-multi /usr/local/lib/5.26.2 .) at /usr/local/bin/cgview_xml_builder.pl line 17. BEGIN failed–compilation aborted at /usr/local/bin/cgview_xml_builder.pl line 17. Read more here:…

Continue Reading cgview: Can’t locate Bio/SeqIO.pm in @INC

Loading environment modules on a cluster from my python script

I recently ran into this. A simple way around this would be to include the dependencies before the command you want, and separate them with a semi-colon cmd = ‘module load intel/2016.4; “gromacs command”‘ p = sub.Popen(cmd, shell=True, stderr = sub.STDOUT, stdout = sub.PIPE).communicate()[0] where “gromacs command” represents however you…

Continue Reading Loading environment modules on a cluster from my python script

Enable MBEDTLS debugging Nordic provided security backend (for CoAP Secure via OpenThread on nRF5340) – Nordic Q&A – Nordic DevZone

Goal Hi guys, is there an option to enable MBEDTLS debugging as with the CONFIG_MBEDTLS_DEBUG_LEVEL=4 for the MBEDTLS_BUILTIN? I am trying to setup a DTLS client based in order to establish a CoAP Secure Session via Openthread to a Borderrouter and I am struggling in the handshake process. It would…

Continue Reading Enable MBEDTLS debugging Nordic provided security backend (for CoAP Secure via OpenThread on nRF5340) – Nordic Q&A – Nordic DevZone

GDCquery_Maf error

GDCquery_Maf error 0 @76e1237b Last seen 1 day ago Singapore Hi all, I really need some help. I am trying to run GDCquery_Maf which worked fine until yesterday. Now I get the following error: Error in GDCquery(paste0(“TCGA-“, tumor), data.category = “Simple Nucleotide Variation”, : Please set a valid workflow.type argument…

Continue Reading GDCquery_Maf error

/usr/share/sagemath/bin/sage-python: line 2: 96052 Killed sage -python “$@”

It looks the Python gets killed during running a long loop and task didn’t finish. [354, -70, 185, -239] 3.1415926589061544881 j = -48 /usr/share/sagemath/bin/sage-python: line 2: 96052 Killed sage -python “$@” I hope to upload the run-file here… But I just paste it below: eps=2^-52 digits=[2,3,5,7] ndig=len(digits) eran=[ceil(30*log(1/eps)/log(digits[i])) for i…

Continue Reading /usr/share/sagemath/bin/sage-python: line 2: 96052 Killed sage -python “$@”

golang-github-albenik-go-serial: autopkgtest regression on ppc64el: undefined: unix.TCGETS2

Source: golang-github-albenik-go-serial Version: 2.5.0-1 Severity: serious User: debian…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of golang-github-albenik-go-serial the autopkgtest of golang-github-albenik-go-serial fails in testing when that autopkgtest is run with the binary packages of golang-github-albenik-go-serial from unstable. It passes when run with only packages from testing. In tabular form:…

Continue Reading golang-github-albenik-go-serial: autopkgtest regression on ppc64el: undefined: unix.TCGETS2

#1008368 – pigx-rnaseq: FTBFS: configure: error: R package rmarkdown not found.

#1008368 – pigx-rnaseq: FTBFS: configure: error: R package rmarkdown not found. – Debian Bug report logs Reported by: Lucas Nussbaum <lucas@debian.org> Date: Sat, 26 Mar 2022 21:12:04 UTC Severity: serious Tags: bookworm, ftbfs, sid Found in version pigx-rnaseq/0.0.19-2 Reply or subscribe to this bug. Toggle useless messages Report forwarded to…

Continue Reading #1008368 – pigx-rnaseq: FTBFS: configure: error: R package rmarkdown not found.

Running rstudio (but not R alone) inside of a conda environment complains about finding Rccp.so

I find that when I try to load some packages in a conda environement, when using rstudio (but not when I’m using R directly), I get an error message about a missing Rcpp.so file. I activate my conda environment (which is running R version 4.1), open RStudio (which I installed…

Continue Reading Running rstudio (but not R alone) inside of a conda environment complains about finding Rccp.so

AnnotationHub installation ‘Rcpp’ 1.0.6 is already loaded, but >= 1.0.7 is required

Hello, I am currently trying to install AnnotationHub but I am running into problems. I use R 4.0.4, renv (version 0.15.4) and BiocVersion 3.12. When I run BiocManager::install(“AnnotationHub”), I get the following error: Warning message: This project is configured to use R version ‘4.1.1’, but ‘4.0.4’ is currently being used….

Continue Reading AnnotationHub installation ‘Rcpp’ 1.0.6 is already loaded, but >= 1.0.7 is required

#1007974 – polyml: autopkgtest regression on amd64: relocation in read-only section `.text’

#1007974 – polyml: autopkgtest regression on amd64: relocation in read-only section `.text’ – Debian Bug report logs Reply or subscribe to this bug. Toggle useless messages Report forwarded to debian-bugs-dist@lists.debian.org, Debian Science Maintainers <debian-science-maintainers@lists.alioth.debian.org>:Bug#1007974; Package src:polyml. (Sat, 19 Mar 2022 20:39:04 GMT) (full text, mbox, link). Acknowledgement sent to Paul…

Continue Reading #1007974 – polyml: autopkgtest regression on amd64: relocation in read-only section `.text’

Error on Rstudio cloud when installing DESeq2 package : rprogramming

Hi! I am using the free account on R studio cloud. And I am getting this error: * installing *source* package ‘DESeq2’ … ** using staged installation ** libs g++ -std=gnu++14 -I”/opt/R/4.1.2/lib/R/include” -DNDEBUG -I’/cloud/lib/x86_64-pc-linux-gnu-library/4.1/Rcpp/include’ -I’/cloud/lib/x86_64-pc-linux-gnu-library/4.1/RcppArmadillo/include’ -I/usr/local/include -fpic -g -O2 -c DESeq2.cpp -o DESeq2.o g++: fatal error: Killed signal terminated program…

Continue Reading Error on Rstudio cloud when installing DESeq2 package : rprogramming

Debian — File list of package minimap2/bookworm/i386

/usr/bin/minimap2 /usr/share/doc-base/minimap2.minimap2 /usr/share/doc/minimap2/changelog.Debian.gz /usr/share/doc/minimap2/copyright /usr/share/doc/minimap2/minimap2.pdf /usr/share/doc/minimap2/run-unit-test /usr/share/doc/minimap2/test/MT-human.fa.gz /usr/share/doc/minimap2/test/MT-orang.fa.gz /usr/share/doc/minimap2/test/q-inv.fa.gz /usr/share/doc/minimap2/test/q2.fa /usr/share/doc/minimap2/test/t-inv.fa.gz /usr/share/doc/minimap2/test/t2.fa /usr/share/doc/minimap2/test_script /usr/share/man/man1/minimap2.1.gz Read more here: Source link

Continue Reading Debian — File list of package minimap2/bookworm/i386

#1007732 – ccache: autopkgtest regression: cannot execute ‘cc1plus’

#1007732 – ccache: autopkgtest regression: cannot execute ‘cc1plus’ – Debian Bug report logs Reply or subscribe to this bug. Toggle useless messages Report forwarded to debian-bugs-dist@lists.debian.org, Joel Rosdahl <joel@debian.org>:Bug#1007732; Package src:ccache. (Tue, 15 Mar 2022 20:27:05 GMT) (full text, mbox, link). Acknowledgement sent to Paul Gevers <elbrus@debian.org>:New Bug report received…

Continue Reading #1007732 – ccache: autopkgtest regression: cannot execute ‘cc1plus’

Pymc3 linker error – v3

Hi all,I have been using pymc3 for about a year. A few months ago I changed from an intel mac to an M1 mac. Suddenly, I can’t use pymc3 anymore. I keep getting the following error that I have no idea how to interpret: You can find the C code…

Continue Reading Pymc3 linker error – v3

Error installing package in RStudio – Software & Applications

Guys, I am trying to install this package on RStudio. I tried to install it on a windows virtual machine and it worked. I thought you guys could know what is happening and how to fix it. When I try to install the following happens: > install.packages(“minqa”) #This package is…

Continue Reading Error installing package in RStudio – Software & Applications

#1007013 – freecad: autopkgtest regression on arm64 and armhf: syntax error

#1007013 – freecad: autopkgtest regression on arm64 and armhf: syntax error – Debian Bug report logs Reply or subscribe to this bug. Toggle useless messages Report forwarded to debian-bugs-dist@lists.debian.org, Debian Science Maintainers <debian-science-maintainers@lists.alioth.debian.org>:Bug#1007013; Package src:freecad. (Thu, 10 Mar 2022 14:21:07 GMT) (full text, mbox, link). Acknowledgement sent to Paul Gevers…

Continue Reading #1007013 – freecad: autopkgtest regression on arm64 and armhf: syntax error

Bug#1006850: python-munch: autopkgtest regression: No module named ‘pkg_resources’

Source: python-munch Version: 2.5.0-1 Severity: serious User: debian…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of python-munch the autopkgtest of python-munch fails in testing when that autopkgtest is run with the binary packages of python-munch from unstable. It passes when run with only packages from testing. In tabular form:…

Continue Reading Bug#1006850: python-munch: autopkgtest regression: No module named ‘pkg_resources’

Nvcc fatal : A single input file is required for a non-link phase when an outputfile is specified – CUDA Programming and Performance

Hello, During I execute setup.py through pytorch, I faced the error “nvcc fatal : single input file is required for a non-link phase when an outputfile is specified” Could you help me out solving the problem? Code is like below. import osimport reimport subprocessimport sys from setuptools import setup#from skbuild…

Continue Reading Nvcc fatal : A single input file is required for a non-link phase when an outputfile is specified – CUDA Programming and Performance

Efficient way of mapping UniProt IDs to representative UniRef90 IDs?

You can do this directly on UniProt: www.uniprot.org/uploadlists/ Just paste or upload your list of UniProt IDs, and select “UniProtKB AC/ID” in the “From” field and “UniParc” in the “To” field I’ve also written a script, pasted below, that can do this with some useful options: $ uniprot_map.pl -h uniprot_map.pl…

Continue Reading Efficient way of mapping UniProt IDs to representative UniRef90 IDs?

[slurm-users] step creation temporarily disabled, retrying (Requested nodes are busy)

I have a slurm cluster on centos7 installed through yum, I also have mpich installed. However I can’t make it work through slurm, these are the logs form running the job: # srun –mpi=pmi2 -N3 -vvv /usr/lib64/mpich/bin/mpirun /scratch/mpi-helloworld srun: defined options srun: ——————– ——————– srun: mpi    …

Continue Reading [slurm-users] step creation temporarily disabled, retrying (Requested nodes are busy)

File “sage/symbolic/pynac_impl.pxi”, Exception. Unhandled SIGSEGV: A segmentation fault occurred

I am not sure if this is a bug in Python or sagemath. Using sagemath 9.5 on Linux Arch. I’ll describe the problem in words, then given MWE to reproduce it. I have an integrand integrand = “F(x)*(-x^2+x)^(1/2)” as string. I pass it to a subprocess using multiprocessing. When I…

Continue Reading File “sage/symbolic/pynac_impl.pxi”, Exception. Unhandled SIGSEGV: A segmentation fault occurred

Request exclusive use of slurm batch nodes for a parpool that is less than the total number of cores. –

Hi, is there a way to tell a slurm matlab job to run in exclusive mode on 2 nodes even though the parpool is using fewer than the total number of cores? Our slurm batch nodes have 128 cores, but I am only requesting a parpool of 240, but I…

Continue Reading Request exclusive use of slurm batch nodes for a parpool that is less than the total number of cores. –

No such file or directory)

I have R(version 4.1.2) installed on Fedora35. When I tried to install “DESeq2”, I got the following warning. 1: .inet_warning(msg) : installation of package ‘genefilter’ had non-zero exit status 2: .inet_warning(msg) : installation of package ‘locfit’ had non-zero exit status 3: .inet_warning(msg) : installation of package ‘DESeq2’ had non-zero exit…

Continue Reading No such file or directory)

Bug#1004037: Segmentation fault in plink2 (Was: src:plink2: fails to migrate to testing for too long: autopkgtest regression)

Control: reopen -1 Control: tags -1 confirmed Control: tags -1 upstream Control: forwarded -1 Christopher Chang <chrch…@alumni.caltech.edu> Hi Christopher (and Dylan), I verified the latest version (29 Jan 2022) of plink2 with the same result for the CI test we are doing in Debian (which was written by Dylan): $…

Continue Reading Bug#1004037: Segmentation fault in plink2 (Was: src:plink2: fails to migrate to testing for too long: autopkgtest regression)

Unable to install RStudio on Mac OSX 10.10

I was able to solve this problem by deleting all R/RStudio resources which remained from installing them manually from .dmg: Uninstall CRAN R GUI app (drag it into the trash) Uninstall RStudio app (drag it into the trash) From Terminal: $ rm -rf ~/.rstudio-desktop/ $ rm -rf /Library/Frameworks/R.framework /Applications/R.app /usr/bin/R…

Continue Reading Unable to install RStudio on Mac OSX 10.10

Bioinformatics script using Python/Biopython/Clustalw using stdout to iterate over a directory of proteins

What exactly is the error you are seeing? You shouldn’t set sys.sterr and sys.stdout to string values (the clustalw_cline() function returns the clustal stderr and stdout as strings), as you won’t be able to write anything to stdout from python. I tried to clean up and correct your code below….

Continue Reading Bioinformatics script using Python/Biopython/Clustalw using stdout to iterate over a directory of proteins

bioconductor – Trouble installing Rhtslib in R/R studio

I’m using RStudio on Ubuntu 18 and I’m trying to install the htslib package from the Bioconductor repo, but I’m stuck now. This is what I get: * installing *source* package ‘Rhtslib’ … ** using non-staged installation via StagedInstall field ** libs cd “htslib-1.7” && make -f “/usr/lib/R/etc/Makeconf” -f “Makefile.Rhtslib”…

Continue Reading bioconductor – Trouble installing Rhtslib in R/R studio

python – Error when trying to install autodocking Vina

I’m trying to install Autodock Vina with pip command. But when I run the command pip install -U numpy vina: I get a the following error: Collecting vina Using cached vina-1.2.3.tar.gz (95 kB) Installing build dependencies … done Getting requirements to build wheel … error error: subprocess-exited-with-error × Getting requirements…

Continue Reading python – Error when trying to install autodocking Vina

google colaboratory – AlphaFold out of memory error with 15 GB of RAM and 95 GB of disc space unused?

I’m trying to use this notebook to run AlphaFold to predict the structure of a large protein. I’ve used this notebook many times for proteins of reasonable size (300-800 aa, if that’s helpful) without any problems, but this protein is almost 2,400 aa. I first tried to run it on…

Continue Reading google colaboratory – AlphaFold out of memory error with 15 GB of RAM and 95 GB of disc space unused?

Bug#1004869: python-xarray: autopkgtest regression on i386

Source: python-xarray Version: 0.21.0-1 X-Debbugs-CC: debi…@lists.debian.org Severity: serious User: debi…@lists.debian.org Usertags: regression Hi Maintainer python-xarray’s autopkgtests are failing on the i386 architecture [1]. I’ve copied what I hope is the relevant part of the log below. Regards Graham [1] ci.debian.net/packages/p/python-xarray/unstable/i386/ =================================== FAILURES =================================== ___________________ test_interpolate_chunk_advanced[linear] ____________________ method = ‘linear’ @requires_scipy @requires_dask @pytest.mark.parametrize(“method”, [“linear”, “nearest”]) @pytest.mark.filterwarnings(“ignore:Increasing number…

Continue Reading Bug#1004869: python-xarray: autopkgtest regression on i386

python – Biopython cannot export numpy

I am trying to use Biopython using anaconda and the Jupiter notebook with Python3. However, simply import numpy gives the following error: ————————————————————————— ImportError Traceback (most recent call last) File /Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-packages/numpy/core/__init__.py:23, in <module> 22 try: —> 23 from . import multiarray 24 except ImportError as exc: File /Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-packages/numpy/core/multiarray.py:10, in <module>…

Continue Reading python – Biopython cannot export numpy

autopkgtest regression on armhf and i386

Source: django-q Version: 1.3.9-2 X-Debbugs-CC: debian…@lists.debian.org Severity: serious User: debian…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of django-q the autopkgtest of django-q fails in testing when that autopkgtest is run with the binary packages of django-q from unstable. It passes when run with only packages from testing. In…

Continue Reading autopkgtest regression on armhf and i386

[lammps-users] installing lammps with cmake – LAMMPS Mailing List Mirror

Dear LAMMPS experts, I am trying to build lammps with cmake command with cmake3 by using this command line: cmake3 -C ../cmake/presets/most.cmake ../cmake It seemed that installation was successful according to the below report: — <<< Build configuration >>> Operating System: Linux CentOS Linux 7 Build type: RelWithDebInfo Install path:…

Continue Reading [lammps-users] installing lammps with cmake – LAMMPS Mailing List Mirror

have trouble in installing biopython package

I would suggest the root of your problem is this line: /usr/libexec/gcc/powerpc-apple-darwin10/4.2.1/as: assembler (/usr/bin/../libexec/gcc/darwin/ppc/as or /usr/bin/../local/libexec/gcc/darwin/ppc/as) for architecture ppc not installed XCode 4 doesn’t like trying to compile things with the PPC architecture, so you need to stop it trying: env ARCHFLAGS=”-arch i386 -arch x86_64″ python setup.py install (DISCLAIMER: I…

Continue Reading have trouble in installing biopython package

python – Stop execution of my notebook without inputting anything

I tried to build a model using lightgbm with the dataset of kaggle’s competition, which is www.kaggle.com/c/ubiquant-market-prediction, on google colaboratory. I wrote codes to build a model by reference to some notebook and it works on kaggle notebook, but it doesn’t work on google colaboratory. The following lines were outputted….

Continue Reading python – Stop execution of my notebook without inputting anything

How to fix deeptoolsintervals fatal error: python.h? ( Python, Python 3.X )

Problem : ( Scroll to solution ) I tried installing pip3 install deeptoolsintervals the error is: deeptoolsintervals/tree/tree.c:1:20: fatal error: Python.h: No such file or directory compilation terminated. error: command ‘/usr/bin/x86_64-linux-gnu-gcc’ failed with exit code 1 I have Ubuntu 16.04.7 and Python versions installed: ls /usr/bin | grep python dh_python2 dh_python3…

Continue Reading How to fix deeptoolsintervals fatal error: python.h? ( Python, Python 3.X )

Install CUDA on NVIDIA Jetson Nano

Hardware Pre-requisite Jetson Nano A 5V 4Ampere Charger 64GB SD card Software Preparing Your Raspberry Pi Flashing Jetson SD Card Image Unzip the SD card image Insert SD card into your system. Bring up Etcher tool and select the target SD card to which you want to flash the image….

Continue Reading Install CUDA on NVIDIA Jetson Nano

Jupyterhub – nltk – unable to use stopwords – resource stopwords not found ( Python, Nltk )

Problem : ( Scroll to solution ) I am using below code to use stopwords through jupyter notebook. I have hosted jupyter on Linux server and using the notebook. python3 -m nltk.downloader stopwords python3 -m nltk.downloader words python3 -m nltk.downloader punkt python3 >>>from nltk.corpus import stopwords >>>stop_words = set(stopwords.words(“english”)) >>>print(stop_words)…

Continue Reading Jupyterhub – nltk – unable to use stopwords – resource stopwords not found ( Python, Nltk )

Gst-nvivafilter – Jetson AGX Xavier

Platforms: Jetson AGX Xavier Jetpack 4.5 Cuda 10.2 IMX274 camera Hi fellow developers, I am having difficulties at making custom CUDA implementation. I have succesfully run the below pipeline. gst-launch-1.0 nvarguscamerasrc ! ‘video/x-raw(memory:NVMM), width=(int)3840, height=(int)2160, format=(string)NV12, framerate=(fraction)60/1’ ! nvivafilter cuda-process=true customer-lib-name=”libnvsample_cudaprocess.so” ! ‘video/x-raw(memory:NVMM), format=(string)NV12’ ! nvvidconv ! nvegltransform ! nveglglessink…

Continue Reading Gst-nvivafilter – Jetson AGX Xavier

[slurm-users] Strange sbatch error with 21.08.2&5

Running test job with srun works: wayneh@login:~$ srun -G16 -p v100 /home/wayne.hendricks/job.sh 179851 Linux dgx1-1 5.4.0-94-generic #106-Ubuntu SMP Thu Jan 6 23:58:14 UTC 2022 x86_64 x86_64 x86_64 GNU/Linux 179851 Linux dgx1-2 5.4.0-94-generic #106-Ubuntu SMP Thu Jan 6 23:58:14 UTC 2022 x86_64 x86_64 x86_64 GNU/Linux Submitting the same with sbatch does…

Continue Reading [slurm-users] Strange sbatch error with 21.08.2&5

Bug#1002849: marked as done (python3-sage: missing Breaks+Replaces: sagemath-common (

Your message dated Sat, 08 Jan 2022 14:36:33 +0000 with message-id <e1n6cpd-0006a9…@fasolo.debian.org> and subject line Bug#1002849: fixed in sagemath 9.4-3 has caused the Debian Bug report #1002849, regarding python3-sage: missing Breaks+Replaces: sagemath-common (<< 9.4) to be marked as done. This means that you claim that the problem has been dealt…

Continue Reading Bug#1002849: marked as done (python3-sage: missing Breaks+Replaces: sagemath-common (

make Pyspark working inside jupyterhub

You need to configure the pyspark kernel. On my server jupyter kernels are located at: /usr/local/share/jupyter/kernels/ You can create a new kernel by making a new directory: mkdir /usr/local/share/jupyter/kernels/pyspark Then create the kernel.json file – I paste my as a reference: { “display_name”: “pySpark (Spark 1.6.0)”, “language”: “python”, “argv”: […

Continue Reading make Pyspark working inside jupyterhub

How to build mbedtls for arm gcc

I want to use mbedtls for my stm32 projects, but I have some problems with building. I have to build mbedtls with arm-none-gcc compiler, right? My command is :(in build directory). CC=/home/jareeeeczek/Arczbit/Firmware/ProgramingRelated/ARM_GCC/gcc-arm-none-eabi-10-2020-q4-major/bin/arm-none-eabi-gcc CFLAGS=’-fstack-protector-strong’ cmake -DUSE_SHARED_MBEDTLS_LIBRARY=On ../ and I have error while compiling test program: none-eabi-10-2020-q4-major/bin/arm-none-eabi-gcc CFLAGS=’-fstack-protector-strong’ cmake – DUSE_SHARED_MBEDTLS_LIBRARY=On ../…

Continue Reading How to build mbedtls for arm gcc

MCScanX: not found – githubmate

Hi CJ-Chen, Thanks for developing this tool. I having an issue when I try to use Quick Run MCScanX Wrapper. error log here: [Debug…All Standard Error Info will show as following:…] Curr log file:/tmp/TBtools.14595798488989250861.20210723103734.log Curr java version:11.0.11 Curr TBtools version:1.09854 Maxmum Memory for Curr TBtools: 4162846720 curVersion:1.09854:force Fetch Location:200 Factor:0.1516546094367225…

Continue Reading MCScanX: not found – githubmate

docx files fail to open in RStudio on Debian (at least 11) – Java rstudio

System details RStudio Edition : Dektop RStudio Version : 1.4.1717 and 2021.09.0+350 OS Version : Debian 11 R Version : 4.0.4 Steps to reproduce the problem Knit an R Markdown file to Word format. The file should be created. However, it’s not automatically opened. Click on the file in the…

Continue Reading docx files fail to open in RStudio on Debian (at least 11) – Java rstudio

No plan found in TAP output

On Thu, 23 Dec 2021 21:59:45 +0100, Paul Gevers wrote: > With a recent upload of libio-async-perl the autopkgtest of libio-async-perl > fails in testing on ppc64el when that autopkgtest is run with the binary > packages of libio-async-perl from unstable. It passes when run with only > packages from…

Continue Reading No plan found in TAP output

main-armv7-default][science/cp2k-data] Failed for cp2k-data-7.1.0 in stage

You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: beefy12.nyi.freebsd.org/data/main-armv7-default/p772274a15b8b_s0630a06b2a/logs/cp2k-data-7.1.0.log Build URL: beefy12.nyi.freebsd.org/build.html?mastername=main-armv7-default&build=p772274a15b8b_s0630a06b2a Log: =>> Building science/cp2k-data build started at Sun Dec 19…

Continue Reading main-armv7-default][science/cp2k-data] Failed for cp2k-data-7.1.0 in stage

Install Slurm 19.05 on a standalone machine running Ubuntu 20.04

Use apt to install the necessary packages: sudo apt install -y slurm-wlm slurm-wlm-doc Load file:///usr/share/doc/slurm-wlm/html/configurator.html in a browser (or on WSL2), and: 1. Set your machine’s hostname in `SlurmctldHost` and `NodeName`. 2. Set `CPUs` as appropriate, and optionally `Sockets`, `CoresPerSocket`, and `ThreadsPerCore`. Use command `lscpu` to find what you…

Continue Reading Install Slurm 19.05 on a standalone machine running Ubuntu 20.04

Error with file guillaumeKUnitigsAtLeast32bases_all.fasta, kUnitigLengths.txt is of size 0, must be at least of size 1.

Hello, I am trying running an assembly with MaSuRCa but am getting an error at the step: “Computing super reads from PE”. here’s the output with the error: [xxxx@vic Bovidae]$ cd Assembly_test/ [xxxx@vic Assembly_test]$ ls assemble.sh guillaumeKUnitigsAtLeast32bases_all.fasta.tmp masurca_assembly.o4302352 meanAndStdevByPrefix.pe.txt pe_data.tmp quorum_mer_db.jf work1 environment.sh guillaumeKUnitigsAtLeast32bases_all.jump.fasta masurca_config.txt pe.cor.fa pe.renamed.fastq super1.err ESTIMATED_GENOME_SIZE.txt masurca_assembly.e4302352…

Continue Reading Error with file guillaumeKUnitigsAtLeast32bases_all.fasta, kUnitigLengths.txt is of size 0, must be at least of size 1.

FTBFS on riscv64, linked with -lpthread instead of -pthread

Package: fastp Version: 0.23.2+dfsg-1 Severity: normal Tags: ftbfs upstream patch User: debian-ri…@lists.debian.org Usertags: riscv64 Dear maintainer, fastp currently fails to build from source on riscv64: | g++ ./obj/adaptertrimmer.o ./obj/basecorrector.o ./obj/duplicate.o ./obj/evaluator.o ./obj/fastareader.o ./obj/fastqreader.o ./obj/filter.o ./obj/filterresult.o ./obj/htmlreporter.o ./obj/jsonreporter.o ./obj/main.o ./obj/nucleotidetree.o ./obj/options.o ./obj/overlapanalysis.o ./obj/peprocessor.o ./obj/polyx.o ./obj/processor.o ./obj/read.o ./obj/readpool.o ./obj/seprocessor.o ./obj/sequence.o ./obj/stats.o ./obj/threadconfig.o…

Continue Reading FTBFS on riscv64, linked with -lpthread instead of -pthread

[moiexpositoalonsolab/grenepipe] freebayes causes early error about number of threads

Hi Lucas, got a weird one for you. If I change the caller from hapotypecaller to freebayes, I get the error below. It’s doubly strange because it seems to occur well before freebayes would be used in the pipeline. [Sat Dec 11 11:13:02 2021] rule samtools_stats: input: dedup/111D03-1.bam output: qc/samtools-stats/111D03-1.txt…

Continue Reading [moiexpositoalonsolab/grenepipe] freebayes causes early error about number of threads

RuntimeError: t == DeviceType::CUDAINTERNAL ASSERT FAILED when trying to calculate gradients

🐛 Describe the bug I am working on a constrained optimization problem using the augmented lagrange method. However, after calculating the first loss term in the optimization, I received the following error after trying to calculate the gradients with loss.backward(). /home/ihowell/Projects/validity/validity/generators/bern_vae.py:23: UserWarning: To copy construct from a tensor, it is…

Continue Reading RuntimeError: t == DeviceType::CUDAINTERNAL ASSERT FAILED when trying to calculate gradients

Augmentation using Albumentations in Pytorch OD

I followed the pytorch tutorial for object detection on the website here. I decided to add more augmentations using albumentations if it would improve my traning. However after calling the __getitem__() method in the dataset class I get this error. AttributeError Traceback (most recent call last) <ipython-input-54-563a9295c274> in <module>() —->…

Continue Reading Augmentation using Albumentations in Pytorch OD

JupyterHub & IRkernel misbehaving — next steps for debugging? – JupyterHub

I am trying to get an R kernel working in Jupyterhub — it was working on an Ubuntu 16.04 install but it stopped when I upgraded to 20.04 and did a fresh install of everything (default proxy and processor setups; no docker complexities; installed through pip). I followed the instructions…

Continue Reading JupyterHub & IRkernel misbehaving — next steps for debugging? – JupyterHub

NoMachine Forums – NoMachine and slurm created cgroups

Hello everyone, We installed NoMachine on clusters we use remotely. These clusters are handled with a scheduler called slurm. Every time a user allocate a node with slurm, its session enters a cgroup which bounds the resources the user can use. Slurm allows for example one user to use a…

Continue Reading NoMachine Forums – NoMachine and slurm created cgroups

How can the R location be customized for RStudio

How can the R location be customized for RStudio I previously used homebrew to install R and the package installer for RStudio. Recently I started using Boxen, which takes over homebrew. I had to re-install R from source using homebrew, and it now exists in my Boxen Cellar location. Now…

Continue Reading How can the R location be customized for RStudio

Is there a way to get RNAFold output for multifasta in tabular format?

Is there a way to get RNAFold output for multifasta in tabular format? 1 I am trying to calculate the MFE along with the secondary structure for multifasta using RNAFold. The output generated is of the format. >abc GGCGGAGGUAGGGAGGCACGCGAUGGUAUUUCAGAGCCUCCCGAAUACAACUCCAGGGUAGGGUGUUGAAAGCGUUGGAGAUGUCUAAAGACACCGCCAG (((((…..(((((((.(..((…….)).).)))))))……..((((((.((…………)).)))))).((((….))))))))).. (-35.80) >lmn GGGAGGCACGCGAUGGUAUUUCAGAGCCUCCCGAAUACAACUCCAGGGUAGGGUGUUGAAAGCGUUGGAGAUGUCUAAAGACACCGCCAGUACCACCCCA (((((((.(..((…….)).).)))))))………….((((..((((………((((.(.((((….)))).).)))))))))))).. (-29.30) >xyz CGAUGGUAUUUCAGAGCCUCCCGAAUACAACUCCAGGGUAGGGUGUUGAAAGCGUUGGAGAUGUCUAAAGACACCGCCAGUACCACCCCACCCCGGGACA ….(((……..)))(((((…………((((.(((((.((……((((.(.((((….)))).).)))))).))))).))))))))).. (-28.40) Is…

Continue Reading Is there a way to get RNAFold output for multifasta in tabular format?

main-arm64-default][devel/RStudio] Failed for RStudio-2021.09.1+372 in build

You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: ampere2.nyi.freebsd.org/data/main-arm64-default/p7539e33f88ff_s169b368a62/logs/RStudio-2021.09.1+372.log Build URL: ampere2.nyi.freebsd.org/build.html?mastername=main-arm64-default&build=p7539e33f88ff_s169b368a62 Log: =>> Building devel/RStudio build started at Wed Dec 8…

Continue Reading main-arm64-default][devel/RStudio] Failed for RStudio-2021.09.1+372 in build

Can’t install scikit-learn in Python

Hi I’m trying to install scikit-learn in Python on a mac, but failed. Does anyone having idea how to fix this? Thanks! The error message is as follows. Error message Command /usr/bin/python -c “import setuptools, tokenize;file=’/private/tmp/pip_build_root/scikit-learn/setup.py’;exec(compile(getattr(tokenize, ‘open’, open)(file).read().replace(‘ ‘, ‘ ‘), file, ‘exec’))” install –record /tmp/pip-UfI2WG-record/install-record.txt –single-version-externally-managed –compile failed with…

Continue Reading Can’t install scikit-learn in Python

find positions of a short sequence in a genome

Here’s a demo Python script you can modify for your use, which suggests the rough principle: #!/usr/bin/env python import sys import re bed = “””chr1t0t10tABCDEFGHIJ chr1t5t15tFGHIJABCDO chr1t10t20tABCDOPABCD””” string_to_match = sys.argv[1] pattern = re.compile(string_to_match) for line in bed.split(“n”): (chr, start, stop, id) = line.split(“t”) for match in pattern.finditer(id): sys.stdout.write(“t”.join([chr, str(int(start) +…

Continue Reading find positions of a short sequence in a genome

Socat not found in the /usr/bin folder in MacOS

Socat not found in the /usr/bin folder in MacOS 0 I have installed socat using brew install socat on my Mac and then tried to connect to the cluster. But it does not connect. It throws the following error message: zsh:1: no such file or directory: /usr/bin/socat kex_exchange_identification: Connection closed…

Continue Reading Socat not found in the /usr/bin folder in MacOS

Count 5’End Mapped To A Specific Genomic Position

Count 5’End Mapped To A Specific Genomic Position 7 I got several SAM/BAM files, and I am interested in 5’ends of the mapped reads. Is there any tools or scripts to count how many 5’ends are mapped at a specific genomic position? N.B. I am not try to count the…

Continue Reading Count 5’End Mapped To A Specific Genomic Position

GEMINI ISSUE

Using gemini found at: /usr/local/bin/gemini /usr/local/share/gemini/anaconda/lib/python2.7/site-packages/gemini/config.py:61: YAMLLoadWarning: calling yaml.load() without Loader=… is deprecated, as the default Loader is unsafe. Please read msg.pyyaml.org/load for full details. config = yaml.load(in_handle) CADD scores are being loaded (to skip use:–skip-cadd). GERP per bp is being loaded (to skip use:–skip-gerp-bp). Traceback (most recent call last):…

Continue Reading GEMINI ISSUE