Tag: usr

[slurm-users] Strange sbatch error with 21.08.2&5

Running test job with srun works: wayneh@login:~$ srun -G16 -p v100 /home/wayne.hendricks/job.sh 179851 Linux dgx1-1 5.4.0-94-generic #106-Ubuntu SMP Thu Jan 6 23:58:14 UTC 2022 x86_64 x86_64 x86_64 GNU/Linux 179851 Linux dgx1-2 5.4.0-94-generic #106-Ubuntu SMP Thu Jan 6 23:58:14 UTC 2022 x86_64 x86_64 x86_64 GNU/Linux Submitting the same with sbatch does…

Continue Reading [slurm-users] Strange sbatch error with 21.08.2&5

Bug#1002849: marked as done (python3-sage: missing Breaks+Replaces: sagemath-common (

Your message dated Sat, 08 Jan 2022 14:36:33 +0000 with message-id <e1n6cpd-0006a9…@fasolo.debian.org> and subject line Bug#1002849: fixed in sagemath 9.4-3 has caused the Debian Bug report #1002849, regarding python3-sage: missing Breaks+Replaces: sagemath-common (<< 9.4) to be marked as done. This means that you claim that the problem has been dealt…

Continue Reading Bug#1002849: marked as done (python3-sage: missing Breaks+Replaces: sagemath-common (

make Pyspark working inside jupyterhub

You need to configure the pyspark kernel. On my server jupyter kernels are located at: /usr/local/share/jupyter/kernels/ You can create a new kernel by making a new directory: mkdir /usr/local/share/jupyter/kernels/pyspark Then create the kernel.json file – I paste my as a reference: { “display_name”: “pySpark (Spark 1.6.0)”, “language”: “python”, “argv”: […

Continue Reading make Pyspark working inside jupyterhub

How to build mbedtls for arm gcc

I want to use mbedtls for my stm32 projects, but I have some problems with building. I have to build mbedtls with arm-none-gcc compiler, right? My command is :(in build directory). CC=/home/jareeeeczek/Arczbit/Firmware/ProgramingRelated/ARM_GCC/gcc-arm-none-eabi-10-2020-q4-major/bin/arm-none-eabi-gcc CFLAGS=’-fstack-protector-strong’ cmake -DUSE_SHARED_MBEDTLS_LIBRARY=On ../ and I have error while compiling test program: none-eabi-10-2020-q4-major/bin/arm-none-eabi-gcc CFLAGS=’-fstack-protector-strong’ cmake – DUSE_SHARED_MBEDTLS_LIBRARY=On ../…

Continue Reading How to build mbedtls for arm gcc

MCScanX: not found – githubmate

Hi CJ-Chen, Thanks for developing this tool. I having an issue when I try to use Quick Run MCScanX Wrapper. error log here: [Debug…All Standard Error Info will show as following:…] Curr log file:/tmp/TBtools.14595798488989250861.20210723103734.log Curr java version:11.0.11 Curr TBtools version:1.09854 Maxmum Memory for Curr TBtools: 4162846720 curVersion:1.09854:force Fetch Location:200 Factor:0.1516546094367225…

Continue Reading MCScanX: not found – githubmate

docx files fail to open in RStudio on Debian (at least 11) – Java rstudio

System details RStudio Edition : Dektop RStudio Version : 1.4.1717 and 2021.09.0+350 OS Version : Debian 11 R Version : 4.0.4 Steps to reproduce the problem Knit an R Markdown file to Word format. The file should be created. However, it’s not automatically opened. Click on the file in the…

Continue Reading docx files fail to open in RStudio on Debian (at least 11) – Java rstudio

No plan found in TAP output

On Thu, 23 Dec 2021 21:59:45 +0100, Paul Gevers wrote: > With a recent upload of libio-async-perl the autopkgtest of libio-async-perl > fails in testing on ppc64el when that autopkgtest is run with the binary > packages of libio-async-perl from unstable. It passes when run with only > packages from…

Continue Reading No plan found in TAP output

main-armv7-default][science/cp2k-data] Failed for cp2k-data-7.1.0 in stage

You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: beefy12.nyi.freebsd.org/data/main-armv7-default/p772274a15b8b_s0630a06b2a/logs/cp2k-data-7.1.0.log Build URL: beefy12.nyi.freebsd.org/build.html?mastername=main-armv7-default&build=p772274a15b8b_s0630a06b2a Log: =>> Building science/cp2k-data build started at Sun Dec 19…

Continue Reading main-armv7-default][science/cp2k-data] Failed for cp2k-data-7.1.0 in stage

Install Slurm 19.05 on a standalone machine running Ubuntu 20.04

Use apt to install the necessary packages: sudo apt install -y slurm-wlm slurm-wlm-doc Load file:///usr/share/doc/slurm-wlm/html/configurator.html in a browser (or on WSL2), and: 1. Set your machine’s hostname in `SlurmctldHost` and `NodeName`. 2. Set `CPUs` as appropriate, and optionally `Sockets`, `CoresPerSocket`, and `ThreadsPerCore`. Use command `lscpu` to find what you…

Continue Reading Install Slurm 19.05 on a standalone machine running Ubuntu 20.04

Error with file guillaumeKUnitigsAtLeast32bases_all.fasta, kUnitigLengths.txt is of size 0, must be at least of size 1.

Hello, I am trying running an assembly with MaSuRCa but am getting an error at the step: “Computing super reads from PE”. here’s the output with the error: [xxxx@vic Bovidae]$ cd Assembly_test/ [xxxx@vic Assembly_test]$ ls assemble.sh guillaumeKUnitigsAtLeast32bases_all.fasta.tmp masurca_assembly.o4302352 meanAndStdevByPrefix.pe.txt pe_data.tmp quorum_mer_db.jf work1 environment.sh guillaumeKUnitigsAtLeast32bases_all.jump.fasta masurca_config.txt pe.cor.fa pe.renamed.fastq super1.err ESTIMATED_GENOME_SIZE.txt masurca_assembly.e4302352…

Continue Reading Error with file guillaumeKUnitigsAtLeast32bases_all.fasta, kUnitigLengths.txt is of size 0, must be at least of size 1.

FTBFS on riscv64, linked with -lpthread instead of -pthread

Package: fastp Version: 0.23.2+dfsg-1 Severity: normal Tags: ftbfs upstream patch User: debian-ri…@lists.debian.org Usertags: riscv64 Dear maintainer, fastp currently fails to build from source on riscv64: | g++ ./obj/adaptertrimmer.o ./obj/basecorrector.o ./obj/duplicate.o ./obj/evaluator.o ./obj/fastareader.o ./obj/fastqreader.o ./obj/filter.o ./obj/filterresult.o ./obj/htmlreporter.o ./obj/jsonreporter.o ./obj/main.o ./obj/nucleotidetree.o ./obj/options.o ./obj/overlapanalysis.o ./obj/peprocessor.o ./obj/polyx.o ./obj/processor.o ./obj/read.o ./obj/readpool.o ./obj/seprocessor.o ./obj/sequence.o ./obj/stats.o ./obj/threadconfig.o…

Continue Reading FTBFS on riscv64, linked with -lpthread instead of -pthread

[moiexpositoalonsolab/grenepipe] freebayes causes early error about number of threads

Hi Lucas, got a weird one for you. If I change the caller from hapotypecaller to freebayes, I get the error below. It’s doubly strange because it seems to occur well before freebayes would be used in the pipeline. [Sat Dec 11 11:13:02 2021] rule samtools_stats: input: dedup/111D03-1.bam output: qc/samtools-stats/111D03-1.txt…

Continue Reading [moiexpositoalonsolab/grenepipe] freebayes causes early error about number of threads

RuntimeError: t == DeviceType::CUDAINTERNAL ASSERT FAILED when trying to calculate gradients

🐛 Describe the bug I am working on a constrained optimization problem using the augmented lagrange method. However, after calculating the first loss term in the optimization, I received the following error after trying to calculate the gradients with loss.backward(). /home/ihowell/Projects/validity/validity/generators/bern_vae.py:23: UserWarning: To copy construct from a tensor, it is…

Continue Reading RuntimeError: t == DeviceType::CUDAINTERNAL ASSERT FAILED when trying to calculate gradients

Augmentation using Albumentations in Pytorch OD

I followed the pytorch tutorial for object detection on the website here. I decided to add more augmentations using albumentations if it would improve my traning. However after calling the __getitem__() method in the dataset class I get this error. AttributeError Traceback (most recent call last) <ipython-input-54-563a9295c274> in <module>() —->…

Continue Reading Augmentation using Albumentations in Pytorch OD

JupyterHub & IRkernel misbehaving — next steps for debugging? – JupyterHub

I am trying to get an R kernel working in Jupyterhub — it was working on an Ubuntu 16.04 install but it stopped when I upgraded to 20.04 and did a fresh install of everything (default proxy and processor setups; no docker complexities; installed through pip). I followed the instructions…

Continue Reading JupyterHub & IRkernel misbehaving — next steps for debugging? – JupyterHub

NoMachine Forums – NoMachine and slurm created cgroups

Hello everyone, We installed NoMachine on clusters we use remotely. These clusters are handled with a scheduler called slurm. Every time a user allocate a node with slurm, its session enters a cgroup which bounds the resources the user can use. Slurm allows for example one user to use a…

Continue Reading NoMachine Forums – NoMachine and slurm created cgroups

How can the R location be customized for RStudio

How can the R location be customized for RStudio I previously used homebrew to install R and the package installer for RStudio. Recently I started using Boxen, which takes over homebrew. I had to re-install R from source using homebrew, and it now exists in my Boxen Cellar location. Now…

Continue Reading How can the R location be customized for RStudio

Is there a way to get RNAFold output for multifasta in tabular format?

Is there a way to get RNAFold output for multifasta in tabular format? 1 I am trying to calculate the MFE along with the secondary structure for multifasta using RNAFold. The output generated is of the format. >abc GGCGGAGGUAGGGAGGCACGCGAUGGUAUUUCAGAGCCUCCCGAAUACAACUCCAGGGUAGGGUGUUGAAAGCGUUGGAGAUGUCUAAAGACACCGCCAG (((((…..(((((((.(..((…….)).).)))))))……..((((((.((…………)).)))))).((((….))))))))).. (-35.80) >lmn GGGAGGCACGCGAUGGUAUUUCAGAGCCUCCCGAAUACAACUCCAGGGUAGGGUGUUGAAAGCGUUGGAGAUGUCUAAAGACACCGCCAGUACCACCCCA (((((((.(..((…….)).).)))))))………….((((..((((………((((.(.((((….)))).).)))))))))))).. (-29.30) >xyz CGAUGGUAUUUCAGAGCCUCCCGAAUACAACUCCAGGGUAGGGUGUUGAAAGCGUUGGAGAUGUCUAAAGACACCGCCAGUACCACCCCACCCCGGGACA ….(((……..)))(((((…………((((.(((((.((……((((.(.((((….)))).).)))))).))))).))))))))).. (-28.40) Is…

Continue Reading Is there a way to get RNAFold output for multifasta in tabular format?

main-arm64-default][devel/RStudio] Failed for RStudio-2021.09.1+372 in build

You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: ampere2.nyi.freebsd.org/data/main-arm64-default/p7539e33f88ff_s169b368a62/logs/RStudio-2021.09.1+372.log Build URL: ampere2.nyi.freebsd.org/build.html?mastername=main-arm64-default&build=p7539e33f88ff_s169b368a62 Log: =>> Building devel/RStudio build started at Wed Dec 8…

Continue Reading main-arm64-default][devel/RStudio] Failed for RStudio-2021.09.1+372 in build

Can’t install scikit-learn in Python

Hi I’m trying to install scikit-learn in Python on a mac, but failed. Does anyone having idea how to fix this? Thanks! The error message is as follows. Error message Command /usr/bin/python -c “import setuptools, tokenize;file=’/private/tmp/pip_build_root/scikit-learn/setup.py’;exec(compile(getattr(tokenize, ‘open’, open)(file).read().replace(‘ ‘, ‘ ‘), file, ‘exec’))” install –record /tmp/pip-UfI2WG-record/install-record.txt –single-version-externally-managed –compile failed with…

Continue Reading Can’t install scikit-learn in Python

find positions of a short sequence in a genome

Here’s a demo Python script you can modify for your use, which suggests the rough principle: #!/usr/bin/env python import sys import re bed = “””chr1t0t10tABCDEFGHIJ chr1t5t15tFGHIJABCDO chr1t10t20tABCDOPABCD””” string_to_match = sys.argv[1] pattern = re.compile(string_to_match) for line in bed.split(“n”): (chr, start, stop, id) = line.split(“t”) for match in pattern.finditer(id): sys.stdout.write(“t”.join([chr, str(int(start) +…

Continue Reading find positions of a short sequence in a genome

Socat not found in the /usr/bin folder in MacOS

Socat not found in the /usr/bin folder in MacOS 0 I have installed socat using brew install socat on my Mac and then tried to connect to the cluster. But it does not connect. It throws the following error message: zsh:1: no such file or directory: /usr/bin/socat kex_exchange_identification: Connection closed…

Continue Reading Socat not found in the /usr/bin folder in MacOS

Count 5’End Mapped To A Specific Genomic Position

Count 5’End Mapped To A Specific Genomic Position 7 I got several SAM/BAM files, and I am interested in 5’ends of the mapped reads. Is there any tools or scripts to count how many 5’ends are mapped at a specific genomic position? N.B. I am not try to count the…

Continue Reading Count 5’End Mapped To A Specific Genomic Position

GEMINI ISSUE

Using gemini found at: /usr/local/bin/gemini /usr/local/share/gemini/anaconda/lib/python2.7/site-packages/gemini/config.py:61: YAMLLoadWarning: calling yaml.load() without Loader=… is deprecated, as the default Loader is unsafe. Please read msg.pyyaml.org/load for full details. config = yaml.load(in_handle) CADD scores are being loaded (to skip use:–skip-cadd). GERP per bp is being loaded (to skip use:–skip-gerp-bp). Traceback (most recent call last):…

Continue Reading GEMINI ISSUE

Leaderboard download fails if leaderboard only contains one page

kaggle competitions leaderboard –download lux-ai-2021  ✔  kaggle  Traceback (most recent call last): File “/usr/local/Caskroom/miniforge/base/envs/kaggle/bin/kaggle”, line 11, in <module> sys.exit(main()) File “/usr/local/Caskroom/miniforge/base/envs/kaggle/lib/python3.9/site-packages/kaggle/cli.py”, line 67, in main out = args.func(**command_args) File “/usr/local/Caskroom/miniforge/base/envs/kaggle/lib/python3.9/site-packages/kaggle/api/kaggle_api_extended.py”, line 831, in competition_leaderboard_cli self.competition_leaderboard_download(competition, path, quiet) File “/usr/local/Caskroom/miniforge/base/envs/kaggle/lib/python3.9/site-packages/kaggle/api/kaggle_api_extended.py”, line 784, in competition_leaderboard_download self.download_file(response, outfile, quiet) File…

Continue Reading Leaderboard download fails if leaderboard only contains one page

Ensembl vep singularity

Ensembl vep singularity 0 Hello all, I would like to use variant effect prédictor on an hpc cluster. For that i use singularity with the docker image of vep : singularity pull –name vep.sif But i have a problem to use one plugin because a perl module is missing….

Continue Reading Ensembl vep singularity

alphafold colab github

for the third time worked! Found inside – Page iiThe eight-volume set comprising LNCS volumes 9905-9912 constitutes the refereed proceedings of the 14th European Conference on Computer Vision, ECCV 2016, held in Amsterdam, The Netherlands, in October 2016. Please make sure you have a large enough hard drive space, bandwidth…

Continue Reading alphafold colab github

Script To Calculate Dinucleotide Frequency For Many Sequences

Hi, everyone, I need to calculate dinucleotide frequency for many sequences. As i know, the R command count(seq, 2, freq = TRUE) can calculate only one sequence. I am new in perl. Does anyone has reliable script to complete this task? I downloaded one script (shown below), but when running…

Continue Reading Script To Calculate Dinucleotide Frequency For Many Sequences

‘Can’t connect to eutils.ncbi.nlm.nih.gov:443’

‘Can’t connect to eutils.ncbi.nlm.nih.gov:443′ 0 Using an AWS AMI to predict small RNA targets. Getting following error. =========Prepping RefSeq Files==================== [Wed Sep 8 08:34:12 UTC 2021] 500 Can’t connect to eutils.ncbi.nlm.nih.gov:443 No do_post output returned from ‘https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=NZ_CP039025&rettype=native&retmode=text&edirect=6.00&tool=edirect&email=ubuntu@ip-172-31-26-35.ec2.internal‘ Result of do_post http request is $VAR1 = bless( { ‘_msg’ => ‘Can’t…

Continue Reading ‘Can’t connect to eutils.ncbi.nlm.nih.gov:443’

Picard CalculateHsMetrics perTargetCoverage for Novaseq bams

Picard CalculateHsMetrics perTargetCoverage for Novaseq bams 0 Hello, I would like to use Picard’s CalculateHsMetrics to calculate per target coverage for Novaseq bam files. It seems that the tool is not able to calculate mean/normalized coverage for Novaseq bams but works well with Hiseq bams. Novaseq bams report quality scores…

Continue Reading Picard CalculateHsMetrics perTargetCoverage for Novaseq bams

Mirdeep2 Installation (Error In Make_Html.Pl)

Mirdeep2 Installation (Error In Make_Html.Pl) 1 Hi, I am trying to install mirdeep2. At the last step, I tested make_html.pl and error appeared as following: [liran@ip14-mp2 tools]$ make_html.pl Can’t locate PDF/API2.pm in @INC (@INC contains: /home/liran/tools/mirdeep2/lib64/perl5 /home/liran/tools/ViennaRNA-2.1.2/install_dir/lib64/perl5 /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /home/liran/tools/mirdeep2/make_html.pl line 9. BEGIN failed–compilation…

Continue Reading Mirdeep2 Installation (Error In Make_Html.Pl)

miRDeep2.pl error in make_html2.pl

miRDeep2.pl error in make_html2.pl 0 I have installed cpan install PDF::API2 And still got error Can’t locate PDF/API2.pm in @INC (@INC contains: /home/nbri/Tikshana/Ath/small_RNA/mirDeep/mirdeep2/lib/perl5 /home/nbri/vaishali/TOMATO_SRNA/new_analysis/mirdeep2-master/lib/perl5 /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64 /perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at /home/nbri/Tikshana/Ath/small_RNA/mirDeep/mirdeep2/bin/make_html2.pl line 25. BEGIN failed–compilation aborted at /home/nbri/Tikshana/Ath/small_RNA/mirDeep/mirdeep2/bin/make_html2.pl line 25 locate PDF/API2.pm /home/nbri/.cpan/build/PDF-API2-2.041-0/blib/lib/PDF/API2.pm /home/nbri/.cpan/build/PDF-API2-2.041-0/lib/PDF/API2.pm /home/nbri/.cpan/build/PDF-API2-2.041-1/blib/lib/PDF/API2.pm /home/nbri/.cpan/build/PDF-API2-2.041-1/lib/PDF/API2.pm /home/nbri/.cpan/build/PDF-API2-2.041-2/blib/lib/PDF/API2.pm…

Continue Reading miRDeep2.pl error in make_html2.pl

Bash operations

Bash operations 3 How to write a bash script that receives ANY integer numbers and print their mean with 2 decimal digit accuracy? Bash • 592 views Here’s one such script: #!/usr/bin/env bash echo ${1} | awk -v RS=” ” ‘{ n++; s+=$0 } END { printf(“%.2fn”, s/n) }’ To…

Continue Reading Bash operations

Trimmomatic error: cannot execute binary file: Exec format error

Trimmomatic error: cannot execute binary file: Exec format error 1 I am trying to run Trimmomatic from a docker container using this piece of command: docker run -v ~:/home -v /data:/data quay.io/biocontainers/trimmomatic:0.36–6 trimmomatic PE -trimlog /usr/local/share/trimmomatic-0.36-6/adapters/NexteraPE-PE.fa:2:30:10 | /data/Sample1_R1.fastq.gz /data/Sample1_R2.fastq.gz | Sample1_R1_paired.fastq.gz Sample1_R1_unpaired.fastq.gz Sample1_R2_paired.fastq.gz Sample1_R2_unpaired.fastq.gz this is the error I recieve…

Continue Reading Trimmomatic error: cannot execute binary file: Exec format error

Error when opening CEL files in python

Error when opening CEL files in python 0 Hi! I am trying to open a CEL file using: with open(“pathtofile/file.CEL”, “r”) as handle: c = CelFile.read(handle) and it is returning the error: ————————————————————————— UnicodeDecodeError Traceback (most recent call last) <ipython-input-24-1a8e8da51c49> in <module>() 1 with open(“/content/drive/MyDrive/explore genomics/MB-7138.CEL”, “r”) as handle: —->…

Continue Reading Error when opening CEL files in python

Downloading Files In Kaggle Gives

What if the grid variables in the source dataset DON’T share the same axis variables? Projected Gridded Data; Data Types; Media Files; AWS S3 Files; NcML; NCO. We use cookies on Kaggle to deliver our services analyze web traffic and improve your experience on the site. By using Kaggle you…

Continue Reading Downloading Files In Kaggle Gives

Failed to open required defaults file mysql.cnf

Failed to open required defaults file mysql.cnf 0 Hi everyone. I know this may be a more general problem but I don’t know where to ask. I’m trying to run Stacks but this error keeps appearing: Failed to open required defaults file: usr/miniconda3/envs/genomevol/share/stacks/sql/mysql.cnf I’ve tried updating mysql, installing mysql-server instead…

Continue Reading Failed to open required defaults file mysql.cnf

GSTAr.pl probelm running

GSTAr.pl probelm running 0 Hi, I want to run CleaveLand to analyze my degradome sequencing, however, I run with the below error. The resulting file is empty and when I check the Checking Dependencies, it shows me GSTAr: FAIL. I always get this error even running with the tutorial files….

Continue Reading GSTAr.pl probelm running

Python FASTA scripting

Python FASTA scripting 4 Hi all, I finally got that illusive Bioinformatician job and am now undergoing training. My first project is to write a FASTA parsing script that will take a FASTA file and split it into multiple files each containing a gene and its sequence. The task is…

Continue Reading Python FASTA scripting

More than one archive specified. Try –help.

Package: routine-update Version: 0.0.6 Severity: important Hi Andreas, when working on making sure the python-biopython watch file was appropriately fixed, I saw routine-update choke with the following error: $ routine-update gbp:info: Fetching from default remote for each branch gbp:info: Branch ‘master’ is already up to date. gbp:info: Branch ‘pristine-tar’ is already up to date. gbp:info: Branch…

Continue Reading More than one archive specified. Try –help.

What is the difference between the kernels of kaggle and googlecolab?

I fell in love with machine learning, the sun.I have one question.Why is it that I can run it in kaggle’s kernel, but not in googlecolab?I don’t know how to make it work.Please help me. kaggle.com G2Net / efficientnet_b7 / baseline [training] Explore and run machine learning code with Kaggle…

Continue Reading What is the difference between the kernels of kaggle and googlecolab?

Get chromosome sizes from fasta file

Get chromosome sizes from fasta file 4 Hello, I’m wondering whether there is a program that could calculate chromosome sizes from any fasta file? The idea is to generate a tab file like the one expected in bedtools genomecov for example. I know there’s the fetchChromSize program from UCSC, but…

Continue Reading Get chromosome sizes from fasta file

Difficulty Using FastX Toolkit on Mac

Difficulty Using FastX Toolkit on Mac 1 I downloaded the FastX toolkit precomplied binaries for “MacOS X 10.5.8 (32-bit)” (hannonlab.cshl.edu/fastx_toolkit/download.html). However, when I cd into the directory with the tools and try to execute any of them, I get the error: -bash: /usr/local/bin/fastq_quality_filter: cannot execute binary file I’m not positive…

Continue Reading Difficulty Using FastX Toolkit on Mac

local variable ‘feature_db’ referenced before assignment

Hi, I want to map annotations from rich gencode human gtf or gff3 to great apes’ genome. I tried to run liftoff (github.com/agshumate/Liftoff) but it returns error the below. Following the github issue’s post, I confirmed there’s no _db file before running, the annotation file is .gff3, the permission of…

Continue Reading local variable ‘feature_db’ referenced before assignment

Vcfutils error code

Vcfutils error code 20-08-2021 code at line (I think) just to get it to write a proper fq. Second issue is this error: substr outside of string at /usr/local/bin/object91.ru line We can do this in a single…

Continue Reading Vcfutils error code

Automate requests to Primer-BLAST

Automate requests to Primer-BLAST 0 I am trying to automate primer design by sending requests to Primer-BLAST. I am able to send the request, but cannot work out how to retrieve the results page. Once you click on the ‘Get Primers’ button (which executes primertool.cgi script) on the Primer-BLAST website,…

Continue Reading Automate requests to Primer-BLAST

How To Use Python Retrieve Results From Uniprot Automatically

How To Use Python Retrieve Results From Uniprot Automatically 3 You can use this: wget –quiet -O- ftp.uniprot.org/pub/databases/uniprot/currentrelease/knowledgebase/complete/uniprotsprot.dat.gz | zcat | python uniprot2go.py GO:0070337 GO:0016021 > out.fasta #!/usr/bin/env python “””Fetch uniprot entries for given go terms””” import sys from Bio import SwissProt #load go terms gos = set(sys.argv[1:]) sys.stderr.write(“Looking for…

Continue Reading How To Use Python Retrieve Results From Uniprot Automatically

problem with Trinity command run in denovo transcriptome assembly

problem with Trinity command run in denovo transcriptome assembly 0 I tried to run my Trinity command for the assembly but this is the error I’ve been getting .. please help let me know where did I go wrong. I’m new to this analysis field. Error, cannot locate Trinity-specific tool:…

Continue Reading problem with Trinity command run in denovo transcriptome assembly

problem in trinity installation

problem in trinity installation 0 I am using ubunto 16.4 I tried to install trinity by following the instructions on the web. After downloading and extracting, I typed “make” the “make plugins” Then I ran trinity on test data as mentioned i.e byu typing “./runMe.sh” but following error is shown:…

Continue Reading problem in trinity installation