Tag: WES

TMEM151A Variants Cause Paroxysmal Kinesigenic Dyskinesia (PKD)

Paroxysmal dyskinesia is the most prevalent kind of paroxysmal kinesigenic dyskinesia (PKD). Proline-rich transmembrane protein 2 (PRRT2) mutations are responsible for just one-third of PKD patients. For a study, researchers sought to look for a possible PKD causal gene. A total of 196 PRRT2-negative PKD patients were included in the…

Continue Reading TMEM151A Variants Cause Paroxysmal Kinesigenic Dyskinesia (PKD)

Postdoc / Research Scientist in Bioinformatics and Computational Genomics

Job Description Are you a computer geek with a strong interest in genomics? Do you want to use your computational skills to solve human diseases? At the Department of Neurology at Harvard Medical School and Brigham & Women’s Hospital, we have two vacant positions: postdoctoral fellow and research scientist in…

Continue Reading Postdoc / Research Scientist in Bioinformatics and Computational Genomics

UCSC and Amazon Web Services work to accelerate genomics research

The UC Santa Cruz Genomics Institute is collaborating with Amazon Web Services (AWS) to allow researchers to quickly and efficiently execute bioinformatics pipelines on AWS’s global cloud infrastructure. AWS and UCSC are committed to accelerating genomics research by integrating the Dockstore project, a leading repository for scientific and biomedical workflows…

Continue Reading UCSC and Amazon Web Services work to accelerate genomics research

dx: error: unrecognized arguments: running swiss army knife plink2

Hi, I was trying to run regenie workflow in ukb rap (part E). github.com/dnanexus/UKB_RAP/blob/main/GWAS/regenie_workflow/partE-step2-qc-filter.sh All the previous steps ran perfectly without any error. But in this step partE-step2-qc-filter.sh I am getting dx: error: unrecognized arguments: –bfile ukb23155_c22_b0_v1 –no-pheno –keep natd_wes_200k.phe –autosome –maf 0.01 –mac 20 –geno 0.1 –hwe 1e-15 –mind…

Continue Reading dx: error: unrecognized arguments: running swiss army knife plink2

Research Scientist, Bioinformatics on beHired.in

POSITION OVERVIEW: The Clinical Bioinformatics and Exploratory Analytics department at Gilead supports drug development and other business use cases by providing analytical, engineering, and visualization solutions for clinical and multi-omics data.  You will collaborate across functions to enable scientific and other business exploration and decision-making, including statistical analysis, genomic data…

Continue Reading Research Scientist, Bioinformatics on beHired.in

UMD Genome group

An email was successfully sent. MaSuRCA assembler MaSuRCA is whole genome assembly software. It combines the efficiency of the de Bruijn graph and Overlap-Layout-Consensus (OLC) approaches. MaSuRCA can assemble data sets containing only short reads from Illumina sequencing or a mixture of short reads and long reads (Sanger, 454, Pacbio and…

Continue Reading UMD Genome group

Copy number variants calling from WES data through eXome hidden Markov model (XHMM) identifies additional 2.5% pathogenic genomic imbalances smaller than 30 kb undetected by array-CGH

It has been estimated that Copy Number Variants (CNVs) account for 10%-20% of patients affected by Developmental Disorder (DD)/Intellectual Disability (ID). Although array comparative genomic hybridization (array-CGH) represents the gold-standard for the detection of genomic imbalances, common Agilent array-CGH 4 × 180 kb arrays fail to detect CNVs smaller than…

Continue Reading Copy number variants calling from WES data through eXome hidden Markov model (XHMM) identifies additional 2.5% pathogenic genomic imbalances smaller than 30 kb undetected by array-CGH

Bioinformatics script using Python/Biopython/Clustalw using stdout to iterate over a directory of proteins

What exactly is the error you are seeing? You shouldn’t set sys.sterr and sys.stdout to string values (the clustalw_cline() function returns the clustal stderr and stdout as strings), as you won’t be able to write anything to stdout from python. I tried to clean up and correct your code below….

Continue Reading Bioinformatics script using Python/Biopython/Clustalw using stdout to iterate over a directory of proteins

Roche hiring Sr Bioinformatics Scientist in Cambridge, Massachusetts, United States

SUMMARY We are seeking a talented and motivated Senior Bioinformatics Scientist who will be an integral member of the Sequencing team contributing to the support and development of ground-breaking next-generation sequencing (NGS) products. As a member of Roche’s Sequencing and Life Science (SLS), Scientific Support and Applications team, you will…

Continue Reading Roche hiring Sr Bioinformatics Scientist in Cambridge, Massachusetts, United States

Comparison of CNV analysis methods: Array CGH vs NGS

Rare genetic disorders are caused by variants in major functional genes. Most are SNV or INDEL variants, but SVs, such as CNVs or chromosomal variants, can also be the cause. Recently, a large-scale study has also been published showing that CNVs were identified in 11-12% more infants and children with…

Continue Reading Comparison of CNV analysis methods: Array CGH vs NGS

Do VQSR for HaplotypeCaller calls – Sarek

Expected Behavior Filter the calls from HaplotypeCaller with Variant Quality Score Recalibration according to GATK best practise (Tools VariantRecalibrator, ApplyRecalibration, see gatkforums.broadinstitute.org/gatk/discussion/39/variant-quality-score-recalibration-vqsr or a more recent version) Current Behavior Variant quality score recalibration currently not included. Asked Jan 26 ’18 at 08:25 malinlarsson 1 Answer: Keep in mind, that you’d…

Continue Reading Do VQSR for HaplotypeCaller calls – Sarek

Postdoctoral Scholar – Bioinformatics/Biomedical Data Science

The University of Nevada, Reno (UNR) appreciates your interest in employment at our growing institution. We want your application process to go smoothly and quickly. Final applications must be submitted prior to the close of the recruitment. If you need assistance or have questions regarding the application process, please contact…

Continue Reading Postdoctoral Scholar – Bioinformatics/Biomedical Data Science

Bioinformatics Analyst in Evanston, IL for Northwestern University

Details Posted: 23-Dec-21 Location: Evanston, Illinois Salary: Open Categories: Information Technology Staff/Administrative Department: MED-Center for Genetic MedSalary/Grade: EXS/8 Job Summary: Partners with clients to design, develop, implement and maintain business solutions regarding data management and analysis.  This includes database administration, data consolidation, data analysis and management reporting.  Utilizes software to…

Continue Reading Bioinformatics Analyst in Evanston, IL for Northwestern University

SOLVED:”Prlco Final | Suppose ; you perfor RFLP family= gene mapping – locate Gcnc _ Xwhich causes Brncti = discas (affected individuals are indicated by shadowing – the pedigree givcn below) DNA samples Were taken from each family member; restriction cnzyme BamHI WES used cleate DNA; cicavage products were resolved by gel clectrophoresis; and Southemn analysis (hybridization) Wis performed using radioactive probe which specifically identifies DNA fragments at # variable BamHI cleavage site (RFLP site). Below the pedigree givcn an image of an uutoradiogram which shows polymomphic restriction fragments from cach individual. The linkage, ilany. between the gcne X an polymorphic BamHI sites unknown What is the best explanation of the obscrved results? gcnctic C distance from RFLP sile renc Xise Iap unils Benctic , distance from RFLP site gene X is S0 map units the RFLP site and gene X ure located diflerent nuclear chromosome the RFLP site is located on the = mitochondrial genome the RFLP site Autoradiogram: 3 kb 2kb Size BamHI fragnients decrecs ncruplvid coli cell? Which of the following best fli duplicaled region on the chronosomnc meroploid cells have coli cells do not exis prokaryoles alwuys ! haploid B) meroploid cells arc formed by fusion of two haploid cells meroploid complete and onc partial chromosome mncroploid coli cclls usually contain one coli cells are former F + cells which lost their Ftecior meroploid _ bctwecn them . Ioci _ and B are $0 closely linked that no recombinatiove iF Ppsojtcoy 32. Suppose thut two produce FI and the’ progeny crossed AAbb individual with an JaBB individual You cross What proportions. 40 You expect I0 sce in Fz? further t0 mrducc F2. What phenotypic ratios and in A) 3A-B- : aabb AAbk a8B B) !A-B- : 1A-bb : aaB- aabb Aa Bb Aa Bb C)I A-bb ; 2 A-B aAB- D) 9 A-B- : 3 A-bb : mB

A beautiful set of quantitative experiments on the lac operon were done by the Müller-Hill group in the 1990 s. where repression of expression of the lacZ gene was measured in a population of different mutant $E .$ coli cells. The mutant cells differed in the number, sequence, and position…

Continue Reading SOLVED:”Prlco Final | Suppose ; you perfor RFLP family= gene mapping – locate Gcnc _ Xwhich causes Brncti = discas (affected individuals are indicated by shadowing – the pedigree givcn below) DNA samples Were taken from each family member; restriction cnzyme BamHI WES used cleate DNA; cicavage products were resolved by gel clectrophoresis; and Southemn analysis (hybridization) Wis performed using radioactive probe which specifically identifies DNA fragments at # variable BamHI cleavage site (RFLP site). Below the pedigree givcn an image of an uutoradiogram which shows polymomphic restriction fragments from cach individual. The linkage, ilany. between the gcne X an polymorphic BamHI sites unknown What is the best explanation of the obscrved results? gcnctic C distance from RFLP sile renc Xise Iap unils Benctic , distance from RFLP site gene X is S0 map units the RFLP site and gene X ure located diflerent nuclear chromosome the RFLP site is located on the = mitochondrial genome the RFLP site Autoradiogram: 3 kb 2kb Size BamHI fragnients decrecs ncruplvid coli cell? Which of the following best fli duplicaled region on the chronosomnc meroploid cells have coli cells do not exis prokaryoles alwuys ! haploid B) meroploid cells arc formed by fusion of two haploid cells meroploid complete and onc partial chromosome mncroploid coli cclls usually contain one coli cells are former F + cells which lost their Ftecior meroploid _ bctwecn them . Ioci _ and B are $0 closely linked that no recombinatiove iF Ppsojtcoy 32. Suppose thut two produce FI and the’ progeny crossed AAbb individual with an JaBB individual You cross What proportions. 40 You expect I0 sce in Fz? further t0 mrducc F2. What phenotypic ratios and in A) 3A-B- : aabb AAbk a8B B) !A-B- : 1A-bb : aaB- aabb Aa Bb Aa Bb C)I A-bb ; 2 A-B aAB- D) 9 A-B- : 3 A-bb : mB

Benchmarking the NVIDIA Clara Parabricks germline pipeline on AWS

This blog post was contributed by Ankit Sethia, PhD, and Timothy Harkins, PhD, at NVIDIA Parabricks, and Olivia Choudhury, PhD,  Sujaya Srinivasan, and Aniket Deshpande at AWS. This blog provides an overview of NVIDIA’s Clara Parabricks along with a guide on how to use Parabricks within the AWS Marketplace. It…

Continue Reading Benchmarking the NVIDIA Clara Parabricks germline pipeline on AWS

Polygenetic Risk Score Calculation

Polygenetic Risk Score Calculation 1 Hello all, My company has Whole exome sequencing (WES) data for individuals lying around and was wondering if this can be used to generate Polygenetic Risk Scores (PRS)? From what I researched online, it seems to be more so used for GWAS and not WES….

Continue Reading Polygenetic Risk Score Calculation

Biostar WGCNA

Showing : WGCNA • reset 4 days ago • updated 3 days ago wes • 0 12 days ago • updated 10 days ago jms2520 • 0 22 days ago • updated 21 days ago synat.keam • 0 8 weeks ago • updated 7 weeks ago wes • 0 updated…

Continue Reading Biostar WGCNA

Next Generation Sequencing Industry to Cross $34.8 Billion by 2027

DUBLIN, Dec. 8, 2021 /PRNewswire/ — The “Next Generation Sequencing Market, Global Forecast, Impact of COVID-19, Industry Trends, Growth, Opportunity By Types of Test, Company Analysis” report has been added to ResearchAndMarkets.com‘s offering. According to the report, the Global Next Generation Sequencing Market will reach US$ 34.8 Billion by 2027….

Continue Reading Next Generation Sequencing Industry to Cross $34.8 Billion by 2027

Lee Placito Fellowship in Bioinformatics

Job Details Lee Placito Fellowship in Bioinformatics Nuffield Department of Surgical Sciences, Old Road Campus Research Building, Headington, Oxford Grade 7: £33,309 – £40,927 per annum Contract type: Fixed term for 3 years Hours: Full-time About the role We are looking for an enthusiastic bioinformatician who has an interest in…

Continue Reading Lee Placito Fellowship in Bioinformatics

How to transform a whole-genome callset into whole-exome callset?

How to transform a whole-genome callset into whole-exome callset? 0 Hi all, I have a callset from whole-genome data and with this callset, I want to transform it into exome callset by extracting the variants using a exome target interval. I obtained two exome target list, one from 1KG project…

Continue Reading How to transform a whole-genome callset into whole-exome callset?

how to generate a file when snakemake pipeline failed

how to generate a file when snakemake pipeline failed 0 Hi there, I am working on a pipeline to make WES analyses. I am preparing that pipeline via snakemake. I have a problem about the input fasq file. Sometimes, users enter fastq files that are 8-9 mb. In this case,…

Continue Reading how to generate a file when snakemake pipeline failed

mixing hg38 and GRCh38 during variant calling

mixing hg38 and GRCh38 during variant calling 0 Hello everyone! I’ve been working on a variant calling pipeline for WES data and used a mix of hg38 and GRCh38 reference files after reading that hg38 is just an abbreviation of GRCh38, and that they refer to the same thing. But…

Continue Reading mixing hg38 and GRCh38 during variant calling

Filtering long indels from VCF

Filtering long indels from VCF 1 Hi, to create a multi-sample VCF in a large cohort of WES samples of very different quality I have to select only high-quality variants genotyped in as many samples as possible. I figured out that long indels have low quality only substitutions do not…

Continue Reading Filtering long indels from VCF

NGS – sample purity assesment

NGS – sample purity assesment 0 Hello community! I am preparing for my master thesis in bioinformatics and I wondering if there are any tools to get the information about sample purity like: amount of normal cells amount of tumor cells ..sample contamination (microorganisms etc.) – I already know that…

Continue Reading NGS – sample purity assesment

Detect fusion genes from WES data

Detect fusion genes from WES data 0 Hi guys, I want to find fusion genes from WES data. I searched some tools but generally they take input as RNA-seq data. Is there any suggestion about this situation? is to find fusion genes from wes data possible? I checked out the…

Continue Reading Detect fusion genes from WES data

Bioconductor – WES.1KG.WUGSC

DOI: 10.18129/B9.bioc.WES.1KG.WUGSC     This package is for version 3.10 of Bioconductor; for the stable, up-to-date release version, see WES.1KG.WUGSC. Whole Exome Sequencing (WES) of chromosome 22 401st to 500th exon from the 1000 Genomes (1KG) Project by the Washington University Genome Sequencing Center (WUGSC). Bioconductor version: 3.10 The assembled…

Continue Reading Bioconductor – WES.1KG.WUGSC

Kaggle Learn Pandas

Listing Results Kaggle learn pandas Learn Pandas Tutorials Kaggle Learn Kaggle.com All Courses 5 hours agoPrepares you for these Learn Courses: Geospatial Analysis, Data Cleaning. Tags: pandas. Instructor. Aleksey Bilogur. Educator. Aleksey is a civic data specialist and … 1. Creating, Reading and WritingCreating, Reading and Writing | Kaggle2. Indexing,…

Continue Reading Kaggle Learn Pandas

Nature Papers Examine Factors Affecting Mutation Detection, Map of Development, Sequencer Performance

An examination of how aspects of the sequencing and analysis process can influence efforts to detect cancer mutations in clinical samples is reported in Nature Biotechnology this week, highlighting the need for reproducibility and accuracy in precision oncology. While the falling costs of next-generation sequencing have led to a rise…

Continue Reading Nature Papers Examine Factors Affecting Mutation Detection, Map of Development, Sequencer Performance

Senior Bioinformatics Scientist job with Paramount Recruitment

Senior Bioinformatics Scientist *The company is offering flexible working options* I am working with a biotech company in Cambridge who is looking for a Senior Bioinformatics Scientist to join their growing Bioinformatics team. The company focus on identifying and developing cancer treatments by exploiting targets within DNA damage response (DDR)….

Continue Reading Senior Bioinformatics Scientist job with Paramount Recruitment

Bioinformatics Analyst I – Job at Medical College of Wisconsin in Milwaukee, WI

Position Description: Every great life-changing discovery begins the same way-with new knowledge. It can change everything, from a single life to the future of entire communities. That’s why academic medicine, and the continuous pursuit of knowledge, is at the center of everything we do…

Continue Reading Bioinformatics Analyst I – Job at Medical College of Wisconsin in Milwaukee, WI

Genomic Analysis of Lung Cancer in Never Smokers Identifies Three Molecular Subtypes

A genomic analysis of lung cancer in people with no history of smoking has found that a majority of these tumors arise from the accumulation of mutations caused by natural processes in the body. The international team of scientists, led by researchers at the National Cancer Institute (NCI), carried out…

Continue Reading Genomic Analysis of Lung Cancer in Never Smokers Identifies Three Molecular Subtypes

Research Scientist Bioinformatics at Exscientia

We are looking to hire an experienced bioinformatician who specializes in the analysis of human NGS data. The Research Scientist Bioinformatics will lead the development and expansion of our in-house NGS capabilities together with data managers and software developers, while also carrying out project-specific analyses. Exscientia GmbH is a company…

Continue Reading Research Scientist Bioinformatics at Exscientia

Head of Bioinformatics job in Princeton, NJ | GENMAB A/S

Genmab is focused on the creation and development of innovative and differentiated antibody products, with the aim of improving the lives of cancer patients. The Role The successful candidate will lead the global bioinformatics function and be responsible for many aspects of data including architecture, access, classification, standards, integration, pipelines…

Continue Reading Head of Bioinformatics job in Princeton, NJ | GENMAB A/S

Whole exome sequencing reveals a homozygous C1QBP deletion as the cause of progressive external ophthalmoplegia and multiple mtDNA deletions

Case Reports . 2021 Jul 4;S0960-8966(21)00176-0. doi: 10.1016/j.nmd.2021.06.014. Online ahead of print. Le Guo  1 , Periyasamy Govindaraj  2 , Mariëlle Kievit  3 , Irenaeus F M de Coo  1 , Mike Gerards  4 , Debby M E I Hellebrekers  5 , Alphons P M Stassen  5 , Narayanappa Gayathri  6 , Arun B Taly  7 , Bindu Parayil…

Continue Reading Whole exome sequencing reveals a homozygous C1QBP deletion as the cause of progressive external ophthalmoplegia and multiple mtDNA deletions

How to determine exact tRNA sequence

How to determine exact tRNA sequence 0 I use the tRNAscan-SE v2.0.9 for trna prediction. One of the trna predicted is trnG-GCC (with CORE 16.5). The sequence is shown below at coordinate 91435-91506: AGCGGAAGGATGAACCCTCAACCTCAGCCTTGGCAAGGCTATGCTCTACCATTAAGATTAAGCTATTTCCGC I also use MITOFY webserver for annotation. The same trnG-GCC (with CORE 25.78) was predicted by the…

Continue Reading How to determine exact tRNA sequence

Contig chr1 given as location, but this contig isn’t present in the Fasta sequence dictionary

Badly formed genome unclippedLoc: Contig chr1 given as location, but this contig isn’t present in the Fasta sequence dictionary 2 Hi everyone, I’m trying to run Mutect2 for WES cancer data. However, since their Resource bundle only supports h19 seems I cannot proceed (I want to compare it with Strelka2…

Continue Reading Contig chr1 given as location, but this contig isn’t present in the Fasta sequence dictionary

Where do I get a WES dataset of size

Where do I get a WES dataset of size <1GB 1 Can someone please tell me from where can I get the WES or WGS dataset of size <1GB WGS WES genomics • 164 views Just browse sra-explorer.info for datasets. I doubt you can meaningfully query for file size as…

Continue Reading Where do I get a WES dataset of size

Mapping transcripts to mitogenome

Mapping transcripts to mitogenome 0 I have performed de novo assembly of a plant mitogenome (non-model plant). In addition, I also perform de novo transcriptome assembly of this particular plant species. How to verify if the mitogenome assembly is correct making use of the RNA-Seq data? Should I align my…

Continue Reading Mapping transcripts to mitogenome

Making a living with bioinformatics

Please do not find this offensive in any way. Please do not get discouraged by this post. I mean nothing bad by this post. I just need some advice as lately (for a year now) I am finding it very difficult to “see the light at the end of the…

Continue Reading Making a living with bioinformatics